Med Microbiol Immunol (2015) 204:193–203 DOI 10.1007/s00430-014-0354-1
ORIGINAL INVESTIGATION
A report of rifampin‑resistant leprosy from northern and eastern India: identification and in silico analysis of molecular interactions Sundeep Chaitanya Vedithi · Mallika Lavania · Manoj Kumar · Punit Kaur · Ravindra P. Turankar · Itu Singh · Astha Nigam · Utpal Sengupta
Received: 14 June 2014 / Accepted: 20 August 2014 / Published online: 9 September 2014 © Springer-Verlag Berlin Heidelberg 2014
Abstract Presence of point mutations within the drug resistance determining regions of Mycobacterium leprae (M. leprae) genome confers molecular basis of drug resistance to dapsone, rifampin and ofloxacin in leprosy. This study is focused on the identification of mutations within the rpoB gene region of M. leprae that are specific for rifampin interaction, and further in silico analysis was carried out to determine the variations in the interactions. DNA and RNA were isolated from slit skin scrapings of 60 relapsed leprosy patients. PCR targeting rpoB gene region and amplicon sequencing was performed to determine point mutations. mRNA expression levels of rpoB and high-resolution melt analysis of mutants were performed using Rotor Gene Q Realtime PCR. Molecular docking was performed using LigandFit Software. Ten cases having point mutations within the rpoB gene region were identified and were clinically confirmed to be resistant to rifampin. A new mutation at codon position Gln442His has been identified. There is a 9.44-fold upregulation in the mRNA expression of rpoB gene in mutant/resistant samples when compared with the wild/sensitive samples. In silico docking analysis of rifampin with wild-type and Gln442His mutant RpoB proteins revealed a variation in
S. C. Vedithi · M. Lavania · R. P. Turankar · I. Singh · A. Nigam · U. Sengupta (*) Stanley Browne Laboratory, The Leprosy Mission Community Hospital, Nand Nagri, New Delhi 110093, India e-mail: [email protected] S. C. Vedithi e-mail: [email protected] M. Kumar · P. Kaur Department of Biophysics, All India Institute of Medical Sciences, Aurobindo Marg, Ansari Nagar, New Delhi 110029, India
the hydrogen-bonding pattern leading to a difference in the total interaction energy and conformational change at position Asp441. These preliminary downstream functional observations revealed that the presence of point mutations within the rifampin resistance determining regions of rpoB gene plays a vital role in conferring genetic and molecular basis of resistance to rifampin in leprosy. Keywords Rifampin resistance · Mycobacterium leprae · Point mutations · Multidrug therapy · Relapse · Leprosy
Introduction Leprosy, a chronic infectious disease, is caused by an obligate intracellular pathogen—Mycobacterium leprae (M. leprae). Although the prevalence of this disease has significantly gone down after the introduction of WHO regimen of multidrug therapy (MDT), the incidence remains a constant peril with approximately 220.000 cases reported globally in 2011 out of which 127.295 cases were reported from India alone. A poor understanding on the mode of transmission of this disease might be responsible for the resultant stability in the annual new case detection rates in endemic areas. However, the infection has been shown to spread via the respiratory route, and active cases of lepromatous leprosy are known to harbor M. leprae in their nasal chambers and discharge them into the environment. The sites of predilection of bacilli are both the peripheral nerves and mucous membranes, and here, they reside in schwann cells and macrophages, respectively. Involvement of peripheral nerves causes nerve damage leading to loss of sensation and nerve function impairment, which, if left untreated, may result in permanent nerve damage leading to disfigurement and deformities [1].
13
194
Due to the emergence and spread of dapsone-resistant M. leprae from 1976, WHO recommended and implemented control measure for leprosy with MDT with the inclusion of rifampin in 1985 and ofloxacin in 1996 [2, 3] and attained an elimination figure of prevalence rate less than 1 case per 10.000 population in 2005 in India (National Leprosy Eradication Programme (NLEP), 2005). India achieved elimination of leprosy in December, 2005 [4]. At this stage of elimination in the background of an inadequate understanding on the modes of entry, gene regulation, metabolism and survival of M. leprae in the host, the emergence of drug resistance might pose a great threat of resurgence of this disease with drug-resistant strains of M. leprae in endemic countries. Presence of single nucleotide polymorphisms within genes that encode for active drug targets like DNA gyrase (for ofloxacin), RNA polymerase β subunit (for rifampin) and dihydropteroate synthases (folp) (for dapsone) was considered as the exclusive basis for detection of drug resistance in leprosy. However, these approaches were qualitative because they only aid in detection, and confirmation should be done through correlation with clinical outcomes of the disease. The actual downstream functional implications of these point mutations within the genes encoding active drug targets and their differential gene expression patterns within the resistant and susceptible strains were scarcely explored. Most of the point mutations identified within the above mentioned M. leprae genes were non-synonymous as they induce an amino acid change in the encoded proteins, thereby leading to the structural variations in the proteins and alterations in the drug interactions making M. leprae resistant to the standard MDT regimen [5]. In this study, clinical samples were screened from patients that were either not responding to treatment or were recurrently relapsing in spite of the MDT, for primary and secondary resistance to rifampin using PCR, and later were confirmed through DNA sequencing. Further, the differential mRNA expression profiles of rpoB gene encoding RNA polymerase β subunit were determined across the mutant and the wild genotypes of M. leprae. Realtime PCR-based high-resolution melt analysis (HRM) of the DNA samples was also performed in order to understand the variations in the melting curve patterns of the mutants in comparison with wild type as reported earlier [6]. This was followed by in silico analysis of structural variations within amino acid sequence variants of RpoB, and later variations in the rifampin interactions were also analyzed. We identified a novel mutation at the amino acid position 442 in the RpoB protein sequence of M. leprae, which correlated with clinical unresponsiveness of patients to rifampin.
13
Med Microbiol Immunol (2015) 204:193–203
Materials and methods Study subjects Leprosy patients who were clinically determined as nonresponders to MDT or cases who have relapsed according the WHO criteria of relapse in leprosy (multibacillary leprosy cases with new skin lesions and with bacteriological index (BI) of more than 2 + even after completion of the full WHO MDT regimen) were enrolled in the study. A total of 60 leprosy cases with the above criteria attending The Leprosy Mission (TLM) Community Hospitals in India were enrolled in the study after taking informed consent for participation following the ethical guidelines of the institutional ethics committee. The demographic, clinical and treatment details of the study subjects are mentioned in Table 1. Sample details Slit skin smear samples were collected from the sites of the skin lesions and from the peripheral extremities of the right and left ear lobes in 70 % ethanol and were sent to Stanley Browne Laboratory at TLM Community Hospital, Shahdara, for subsequent processing. Mycobacterial DNA and RNA extraction from the skit skin smear samples This was performed as described earlier by Turankar et al. [7]. Briefly, the slit skin smear samples in 70 % ethanol were centrifuged at 10,000 rpm for 20 min at 4 °C followed by removal of supernatant and air-drying of the pellet overnight at 37 °C for removal of traces of ethanol. Later, 100 μl of lysis buffer (containing 100 mM Tris buffer at pH 8.5, 1 mg/ml of proteinase K and 0.05 % Tween 20) was added to the pellet and was incubated for 16 hrs’ at 60 °C in a water bath. This was followed by the deactivation of proteinase K at 97 °C for 15 Min. The resultant suspension was used as DNA sample for PCR. The RNA extractions were performed using TRI reagent as per the manufacturer’s instructions. cDNA was constructed for 1 µg of total RNA from each sample using ProtoScript M-MuLV First Strand cDNA Synthesis Kit (NEB #6300S, New England Biolabs Inc.) as per the manufacturer’s instructions. Detection of M. leprae DNA Presence of M. leprae DNA in the slit skin smear samples was confirmed through PCR targeting repetitive gene region (RLEP), which is unique for M. leprae. This 129-bp fragment was amplified using primers and PCR conditions as described earlier by Donoghue et al. [8].
Med Microbiol Immunol (2015) 204:193–203
195
Table 1 Demographic, clinical and epidemiological characteristics of the study subjects (n = 60) Si. no.
Characteristic
1
Gender Male Female Age (in years) 15–29 30–34 35–59 >60 MDT Treatment Type and Duration MDT for 12 months MDT for 24 months MDT for 36 months MDT for >36 months Irregular MDT + DDS monotherapy DDS monotherapy WHO Classification of Leprosy Paucibacillary
2
3
4
5
6
7
8
Multibacillary Ridley & Jopling Classification Tuberculoid Leprosy (TT) Borderline Tuberculoid Leprosy (BT) Borderline Borderline Leprosy (BB) Borderline Lepromatous Leprosy (BL) Lepromatous Leprosy BI 2+ to 3+ 3.33+ to 4.33+ ≥5+ Clinical manifestations at relapse New skin lesions Neuritis Type I reactions Type II reactions Duration of relapsea 1–5 years 5–10 years 10–15 years >15 years
Number of Study Subjects (%)
50 (83.33) 10 (16.67) 9 (15.00) 6 (10.00) 32 (53.33) 13 (21.67) 40 (66.67) 11 (18.33) 4 (6.67) 1 (1.67) 2 (3.33) 1 (1.67) 1 (1.67) 4 (6.67) 56 (93.33) 0 (0.00) 7 (11.67) 0 (0.00) 21 (35.00) 32 (53.33) 19 (31.67) 29 (48.33) 18 (30.00) 42 (70.00) 12 (20.00) 2 (3.33) 10 (16.67) 10 (16.67) 12 (20.00) 28 (46.67) 9 (15.00)
a
Duration of relapse is the time duration in years after completion of the WHO-recommended complete dose (12 months) of MB MDT to the time when patient has reported at the hospital with symptoms of relapse
a 20 μl PCR mix was prepared using 10 μl of Hot Start PCR Master Mix (Qiagen Inc., Netherlands), 2 μl of Q solution (Qiagen Inc., Netherlands), ≈2 μg of DNA and forward and reverse primers for rpoB as GTCGAGGCGATCACGCCGCA and CGACAATGAACCGATCAGAC, respectively, each at a concentration of 0.25 μM. This mix was cycled 37 times at 94 °C for 1 min, 60 °C for 1 min and 70 °C for 1 min, which was preceded by initial denaturation at 95 °C for 15 min and terminated by a final extension at 72 °C for 10 min. Three to five microliters of the amplified PCR product was electrophoresed on 2 % agarose gel for detection of rpoB amplicons. The DNA bands on the agarose gel were detected in a gel imaging cabinet (Alpha Imager Inc., USA). Later, the whole volume of the amplicon was loaded on the gel, electrophoresed, and the band of interest (of approximate size of 276 bp) was detected by using 100-bp-molecular-weight DNA marker. This band was then excised from the gel on a manual UV illuminator using a scalpel blade and the DNA was eluted from the band by using Gel Elution Kit (Sigma Aldrich Inc.). The presence of mutations within the amplified product is further confirmed by DNA sequencing through a commercial agency (Xplorigen Technologies Pvt. Limited, Delhi, India). Sequence data were analyzed by using molecular evolutionary genetics analysis (MEGA) software (version 5). Realtime PCR and high‑resolution melt analysis This was performed as described earlier by Li et al. [5] with minor modifications. A 20-µl PCR mix containing 10 µl of 2 X SYBR Green (VeriQuest SYBR Green—Affymetrix) master mix, 0.5 µl each of forward and reverse primers for rpoB (sequences same as above), 7 µl of nuclease free water and 2 µl of cDNA was prepared, and PCR was performed on Rotor Gene Q Realtime PCR machine (Qiagen Inc., Netherlands). Data acquisitions were performed on green and HRM channels. The cycling parameters included an initial denaturation at 95 °C for 10 min followed by 45 cycles of 95 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s, and later, the reaction was terminated by a heteroduplex formation step of 95 °C for 5 s and 60 °C for 1 min. Later, the amplicons were subjected to high-resolution melt, and the melting curves were generated by heating the amplicons from 65 to 95 °C in 0·2 °C increments at a rate of 10 s/step. The quantification of the template DNA was performed based on a standard curve that was developed with the five BR 4923 standards (Brazilian Strain of M. leprae). Post-PCR, HRM analysis was performed using Rotor Gene Q Software.
Detection of rpoB mutations
In silico analysis of rifampin interactions with wild‑type and mutant (Gln442His) RpoB
This was performed as per the WHO guidelines of Sentinel Surveillance Study on Drug Resistance in leprosy [9]. Briefly,
The homology model of RNA polymerase B (RpoB) of M. leprae was constructed utilizing the three-dimensional
13
196
(3D) crystal structures of native RpoB of T. thermophilus at 2.6 Å resolution (PDB ID: 1IW7, chain C) [10] and RpoB of T. aquaticus complexed with rifampin at 3.3 Å resolution (PDB ID: 1I6V, chain C) [10] possessing a sequence identity of 49.8 and 49.4 %, respectively, by using MODELLER 8.2 [11, 12]. The stereochemistry of the generated model was verified by using PROCHECK [13]. The structure was refined by side chain refinement program, namely ChiRotor [14], and the energy was minimized to remove steric clashes. Short molecular dynamic (MD) simulations were performed to relax the structure in the possible lowest energy conformation. The model of the mutant protein (R442Q) was generated by build mutant program [15] and is refined in a similar manner to that of the wildtype protein. These refined models were used to assess the role of mutation on the binding of rifampin with the help of LigandFit [16] molecular docking program. The refined model of wild-type as well as mutant proteins was taken as receptor, and the volume corresponding to rifampin in crystal complex (PDB ID: 1I6V) [17] was defined as the binding site for docking studies. The crystal structure of rifampin was taken, and CHARMm force field parameters along with partial charges were assigned to the structure (c33b1) [18, 19]. The prepared rifampin structure was energy minimized and then docked in the defined binding site using LigandFit docking protocol. The interaction energy of the docked complex with wild-type and mutant proteins was calculated with the help of CHARMm force field parameters (c33b1).
Results Clinical characteristics of the study subjects Clinical characteristics of all the 60 study subjects were obtained from the hospital patient information systems (HMS) of source hospitals, and statistically significant higher proportion of cases (53.33 %) (p
ORIGINAL INVESTIGATION
A report of rifampin‑resistant leprosy from northern and eastern India: identification and in silico analysis of molecular interactions Sundeep Chaitanya Vedithi · Mallika Lavania · Manoj Kumar · Punit Kaur · Ravindra P. Turankar · Itu Singh · Astha Nigam · Utpal Sengupta
Received: 14 June 2014 / Accepted: 20 August 2014 / Published online: 9 September 2014 © Springer-Verlag Berlin Heidelberg 2014
Abstract Presence of point mutations within the drug resistance determining regions of Mycobacterium leprae (M. leprae) genome confers molecular basis of drug resistance to dapsone, rifampin and ofloxacin in leprosy. This study is focused on the identification of mutations within the rpoB gene region of M. leprae that are specific for rifampin interaction, and further in silico analysis was carried out to determine the variations in the interactions. DNA and RNA were isolated from slit skin scrapings of 60 relapsed leprosy patients. PCR targeting rpoB gene region and amplicon sequencing was performed to determine point mutations. mRNA expression levels of rpoB and high-resolution melt analysis of mutants were performed using Rotor Gene Q Realtime PCR. Molecular docking was performed using LigandFit Software. Ten cases having point mutations within the rpoB gene region were identified and were clinically confirmed to be resistant to rifampin. A new mutation at codon position Gln442His has been identified. There is a 9.44-fold upregulation in the mRNA expression of rpoB gene in mutant/resistant samples when compared with the wild/sensitive samples. In silico docking analysis of rifampin with wild-type and Gln442His mutant RpoB proteins revealed a variation in
S. C. Vedithi · M. Lavania · R. P. Turankar · I. Singh · A. Nigam · U. Sengupta (*) Stanley Browne Laboratory, The Leprosy Mission Community Hospital, Nand Nagri, New Delhi 110093, India e-mail: [email protected] S. C. Vedithi e-mail: [email protected] M. Kumar · P. Kaur Department of Biophysics, All India Institute of Medical Sciences, Aurobindo Marg, Ansari Nagar, New Delhi 110029, India
the hydrogen-bonding pattern leading to a difference in the total interaction energy and conformational change at position Asp441. These preliminary downstream functional observations revealed that the presence of point mutations within the rifampin resistance determining regions of rpoB gene plays a vital role in conferring genetic and molecular basis of resistance to rifampin in leprosy. Keywords Rifampin resistance · Mycobacterium leprae · Point mutations · Multidrug therapy · Relapse · Leprosy
Introduction Leprosy, a chronic infectious disease, is caused by an obligate intracellular pathogen—Mycobacterium leprae (M. leprae). Although the prevalence of this disease has significantly gone down after the introduction of WHO regimen of multidrug therapy (MDT), the incidence remains a constant peril with approximately 220.000 cases reported globally in 2011 out of which 127.295 cases were reported from India alone. A poor understanding on the mode of transmission of this disease might be responsible for the resultant stability in the annual new case detection rates in endemic areas. However, the infection has been shown to spread via the respiratory route, and active cases of lepromatous leprosy are known to harbor M. leprae in their nasal chambers and discharge them into the environment. The sites of predilection of bacilli are both the peripheral nerves and mucous membranes, and here, they reside in schwann cells and macrophages, respectively. Involvement of peripheral nerves causes nerve damage leading to loss of sensation and nerve function impairment, which, if left untreated, may result in permanent nerve damage leading to disfigurement and deformities [1].
13
194
Due to the emergence and spread of dapsone-resistant M. leprae from 1976, WHO recommended and implemented control measure for leprosy with MDT with the inclusion of rifampin in 1985 and ofloxacin in 1996 [2, 3] and attained an elimination figure of prevalence rate less than 1 case per 10.000 population in 2005 in India (National Leprosy Eradication Programme (NLEP), 2005). India achieved elimination of leprosy in December, 2005 [4]. At this stage of elimination in the background of an inadequate understanding on the modes of entry, gene regulation, metabolism and survival of M. leprae in the host, the emergence of drug resistance might pose a great threat of resurgence of this disease with drug-resistant strains of M. leprae in endemic countries. Presence of single nucleotide polymorphisms within genes that encode for active drug targets like DNA gyrase (for ofloxacin), RNA polymerase β subunit (for rifampin) and dihydropteroate synthases (folp) (for dapsone) was considered as the exclusive basis for detection of drug resistance in leprosy. However, these approaches were qualitative because they only aid in detection, and confirmation should be done through correlation with clinical outcomes of the disease. The actual downstream functional implications of these point mutations within the genes encoding active drug targets and their differential gene expression patterns within the resistant and susceptible strains were scarcely explored. Most of the point mutations identified within the above mentioned M. leprae genes were non-synonymous as they induce an amino acid change in the encoded proteins, thereby leading to the structural variations in the proteins and alterations in the drug interactions making M. leprae resistant to the standard MDT regimen [5]. In this study, clinical samples were screened from patients that were either not responding to treatment or were recurrently relapsing in spite of the MDT, for primary and secondary resistance to rifampin using PCR, and later were confirmed through DNA sequencing. Further, the differential mRNA expression profiles of rpoB gene encoding RNA polymerase β subunit were determined across the mutant and the wild genotypes of M. leprae. Realtime PCR-based high-resolution melt analysis (HRM) of the DNA samples was also performed in order to understand the variations in the melting curve patterns of the mutants in comparison with wild type as reported earlier [6]. This was followed by in silico analysis of structural variations within amino acid sequence variants of RpoB, and later variations in the rifampin interactions were also analyzed. We identified a novel mutation at the amino acid position 442 in the RpoB protein sequence of M. leprae, which correlated with clinical unresponsiveness of patients to rifampin.
13
Med Microbiol Immunol (2015) 204:193–203
Materials and methods Study subjects Leprosy patients who were clinically determined as nonresponders to MDT or cases who have relapsed according the WHO criteria of relapse in leprosy (multibacillary leprosy cases with new skin lesions and with bacteriological index (BI) of more than 2 + even after completion of the full WHO MDT regimen) were enrolled in the study. A total of 60 leprosy cases with the above criteria attending The Leprosy Mission (TLM) Community Hospitals in India were enrolled in the study after taking informed consent for participation following the ethical guidelines of the institutional ethics committee. The demographic, clinical and treatment details of the study subjects are mentioned in Table 1. Sample details Slit skin smear samples were collected from the sites of the skin lesions and from the peripheral extremities of the right and left ear lobes in 70 % ethanol and were sent to Stanley Browne Laboratory at TLM Community Hospital, Shahdara, for subsequent processing. Mycobacterial DNA and RNA extraction from the skit skin smear samples This was performed as described earlier by Turankar et al. [7]. Briefly, the slit skin smear samples in 70 % ethanol were centrifuged at 10,000 rpm for 20 min at 4 °C followed by removal of supernatant and air-drying of the pellet overnight at 37 °C for removal of traces of ethanol. Later, 100 μl of lysis buffer (containing 100 mM Tris buffer at pH 8.5, 1 mg/ml of proteinase K and 0.05 % Tween 20) was added to the pellet and was incubated for 16 hrs’ at 60 °C in a water bath. This was followed by the deactivation of proteinase K at 97 °C for 15 Min. The resultant suspension was used as DNA sample for PCR. The RNA extractions were performed using TRI reagent as per the manufacturer’s instructions. cDNA was constructed for 1 µg of total RNA from each sample using ProtoScript M-MuLV First Strand cDNA Synthesis Kit (NEB #6300S, New England Biolabs Inc.) as per the manufacturer’s instructions. Detection of M. leprae DNA Presence of M. leprae DNA in the slit skin smear samples was confirmed through PCR targeting repetitive gene region (RLEP), which is unique for M. leprae. This 129-bp fragment was amplified using primers and PCR conditions as described earlier by Donoghue et al. [8].
Med Microbiol Immunol (2015) 204:193–203
195
Table 1 Demographic, clinical and epidemiological characteristics of the study subjects (n = 60) Si. no.
Characteristic
1
Gender Male Female Age (in years) 15–29 30–34 35–59 >60 MDT Treatment Type and Duration MDT for 12 months MDT for 24 months MDT for 36 months MDT for >36 months Irregular MDT + DDS monotherapy DDS monotherapy WHO Classification of Leprosy Paucibacillary
2
3
4
5
6
7
8
Multibacillary Ridley & Jopling Classification Tuberculoid Leprosy (TT) Borderline Tuberculoid Leprosy (BT) Borderline Borderline Leprosy (BB) Borderline Lepromatous Leprosy (BL) Lepromatous Leprosy BI 2+ to 3+ 3.33+ to 4.33+ ≥5+ Clinical manifestations at relapse New skin lesions Neuritis Type I reactions Type II reactions Duration of relapsea 1–5 years 5–10 years 10–15 years >15 years
Number of Study Subjects (%)
50 (83.33) 10 (16.67) 9 (15.00) 6 (10.00) 32 (53.33) 13 (21.67) 40 (66.67) 11 (18.33) 4 (6.67) 1 (1.67) 2 (3.33) 1 (1.67) 1 (1.67) 4 (6.67) 56 (93.33) 0 (0.00) 7 (11.67) 0 (0.00) 21 (35.00) 32 (53.33) 19 (31.67) 29 (48.33) 18 (30.00) 42 (70.00) 12 (20.00) 2 (3.33) 10 (16.67) 10 (16.67) 12 (20.00) 28 (46.67) 9 (15.00)
a
Duration of relapse is the time duration in years after completion of the WHO-recommended complete dose (12 months) of MB MDT to the time when patient has reported at the hospital with symptoms of relapse
a 20 μl PCR mix was prepared using 10 μl of Hot Start PCR Master Mix (Qiagen Inc., Netherlands), 2 μl of Q solution (Qiagen Inc., Netherlands), ≈2 μg of DNA and forward and reverse primers for rpoB as GTCGAGGCGATCACGCCGCA and CGACAATGAACCGATCAGAC, respectively, each at a concentration of 0.25 μM. This mix was cycled 37 times at 94 °C for 1 min, 60 °C for 1 min and 70 °C for 1 min, which was preceded by initial denaturation at 95 °C for 15 min and terminated by a final extension at 72 °C for 10 min. Three to five microliters of the amplified PCR product was electrophoresed on 2 % agarose gel for detection of rpoB amplicons. The DNA bands on the agarose gel were detected in a gel imaging cabinet (Alpha Imager Inc., USA). Later, the whole volume of the amplicon was loaded on the gel, electrophoresed, and the band of interest (of approximate size of 276 bp) was detected by using 100-bp-molecular-weight DNA marker. This band was then excised from the gel on a manual UV illuminator using a scalpel blade and the DNA was eluted from the band by using Gel Elution Kit (Sigma Aldrich Inc.). The presence of mutations within the amplified product is further confirmed by DNA sequencing through a commercial agency (Xplorigen Technologies Pvt. Limited, Delhi, India). Sequence data were analyzed by using molecular evolutionary genetics analysis (MEGA) software (version 5). Realtime PCR and high‑resolution melt analysis This was performed as described earlier by Li et al. [5] with minor modifications. A 20-µl PCR mix containing 10 µl of 2 X SYBR Green (VeriQuest SYBR Green—Affymetrix) master mix, 0.5 µl each of forward and reverse primers for rpoB (sequences same as above), 7 µl of nuclease free water and 2 µl of cDNA was prepared, and PCR was performed on Rotor Gene Q Realtime PCR machine (Qiagen Inc., Netherlands). Data acquisitions were performed on green and HRM channels. The cycling parameters included an initial denaturation at 95 °C for 10 min followed by 45 cycles of 95 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s, and later, the reaction was terminated by a heteroduplex formation step of 95 °C for 5 s and 60 °C for 1 min. Later, the amplicons were subjected to high-resolution melt, and the melting curves were generated by heating the amplicons from 65 to 95 °C in 0·2 °C increments at a rate of 10 s/step. The quantification of the template DNA was performed based on a standard curve that was developed with the five BR 4923 standards (Brazilian Strain of M. leprae). Post-PCR, HRM analysis was performed using Rotor Gene Q Software.
Detection of rpoB mutations
In silico analysis of rifampin interactions with wild‑type and mutant (Gln442His) RpoB
This was performed as per the WHO guidelines of Sentinel Surveillance Study on Drug Resistance in leprosy [9]. Briefly,
The homology model of RNA polymerase B (RpoB) of M. leprae was constructed utilizing the three-dimensional
13
196
(3D) crystal structures of native RpoB of T. thermophilus at 2.6 Å resolution (PDB ID: 1IW7, chain C) [10] and RpoB of T. aquaticus complexed with rifampin at 3.3 Å resolution (PDB ID: 1I6V, chain C) [10] possessing a sequence identity of 49.8 and 49.4 %, respectively, by using MODELLER 8.2 [11, 12]. The stereochemistry of the generated model was verified by using PROCHECK [13]. The structure was refined by side chain refinement program, namely ChiRotor [14], and the energy was minimized to remove steric clashes. Short molecular dynamic (MD) simulations were performed to relax the structure in the possible lowest energy conformation. The model of the mutant protein (R442Q) was generated by build mutant program [15] and is refined in a similar manner to that of the wildtype protein. These refined models were used to assess the role of mutation on the binding of rifampin with the help of LigandFit [16] molecular docking program. The refined model of wild-type as well as mutant proteins was taken as receptor, and the volume corresponding to rifampin in crystal complex (PDB ID: 1I6V) [17] was defined as the binding site for docking studies. The crystal structure of rifampin was taken, and CHARMm force field parameters along with partial charges were assigned to the structure (c33b1) [18, 19]. The prepared rifampin structure was energy minimized and then docked in the defined binding site using LigandFit docking protocol. The interaction energy of the docked complex with wild-type and mutant proteins was calculated with the help of CHARMm force field parameters (c33b1).
Results Clinical characteristics of the study subjects Clinical characteristics of all the 60 study subjects were obtained from the hospital patient information systems (HMS) of source hospitals, and statistically significant higher proportion of cases (53.33 %) (p
