Journal of Virological Methods 212 (2015) 47–52

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR P.A. Desingu a , S.D. Singh a , K. Dhama a , O.R. Vinodh Kumar b,∗ , R. Singh c , R.K. Singh d a

Avian Diseases Section, Division of Pathology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India Division of Medicine, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India c Division of Pathology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India d Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India b

a b s t r a c t Article history: Received 23 July 2014 Received in revised form 31 October 2014 Accepted 11 November 2014 Available online 20 November 2014 Keywords: Newcastle disease virus Degenerate primer Nested RT-PCR NDV pathotyping

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I “fusion” (F) gene Class II specific external primer A and B (535 bp), internal primer C and D (238 bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535 bp and 424 bp) while virulent strains showed four bands (535 bp, 424 bp, 349 bp and 238 bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Newcastle disease is one of the most economically important diseases of poultry across the globe. It is caused by Newcastle disease virus (Avian Paramayxovirus Type-1, APMV-1) belonging to the genus Avulavirus in the family Paramyxoviridae under the order Mononegavirales (ICTV, 2012). Avian paramyxoviruses (APMVs) have been classified into twelve serotypes (APMV 1-12), out of which APMV-1 is found to be frequently associated with naturally occurring NDV infections of economic significance in poultry (Nayak et al., 2012; Terregino et al., 2013). The virus isolates within the serotype APMV-1 viruses infect more than 200 species of birds (OIE, 2012). Of all the avian species, chickens are the most susceptible, while ducks and geese are the least susceptible species. The serotype APMV-1 has two distinct clades (class I and II), which are subdivided into nine recognized genotypes. Class I isolates are primarily recovered from waterfowls and are reported to be the

∗ Corresponding author. Tel.: +91 8859784853; fax: +91 5812310074. E-mail address: [email protected] (O.R.V. Kumar). http://dx.doi.org/10.1016/j.jviromet.2014.11.005 0166-0934/© 2014 Elsevier B.V. All rights reserved.

low virulent strains, while class II are recovered from poultry, pet and wild birds, and contains mostly the high virulent strains (Kim et al., 2007). The NDV isolates in general may broadly be categorized into three major pathotypes, depending on the severity of the disease or virulence as velogenic, mesogenic and lentogenic. The low virulent isolates of NDV (Lentogenic) usually cause mild respiratory or enteric infections. The NDV strains of intermediate virulence (Mesogenic) cause primarily the respiratory disease. The highly virulent isolates (Velogenic) are associated with high mortality and are further classified as neurotropic or viscerotropic, based on the pathological manifestation of the disease (OIE, 2012). Several viral isolates identified within the class I NDV but all the isolates, except IECK90187 isolate, were found to be lentogenic (Alexander et al., 1992; Liu et al., 2011). Liu et al. (2011) used class II specific primers to detect NDV belonging to class II of APMVI. The OIE recommended methods for NDV pathotyping include the determination of intracerebral pathogenicity index (ICPI) and demonstration of amino acid motif in the fusion (F) gene cleavage site after sequencing. Few workers have used degenerative primer based reverse transcription-polymerase chain reaction (RTPCR) to detect and differentiate NDV pathotypes (Kant et al., 1997;

48

P.A. Desingu et al. / Journal of Virological Methods 212 (2015) 47–52

Table 1 NDV F gene primers used in this study and their location. Code

Sense

Sequence

Location (fusion) F genea

Product size

Refs.

A B C D

Positive Negative Positive Negative

ATGGGCYCCAGACYCTTCTAC CTGCCACTGCTAGTTGTGATAATCC GCAGCTGCAGGGATTGTGGT AGCGT(C/T)TCTGTCTCCT

47–67 581–557 158–177 395–380

535bp (external primers)

Liu et al. (2011)

238bp (internal primers)

Toyoda et al. (1989) Kant et al. (1997)

a

Numbering according to Toyoda et al. (1989).

Tiwari et al., 2004; Zhang et al., 2010). The use of semi-nested RTPCR amplification of the F gene sequences of NDV showed better diagnostic sensitivity (Zhang et al., 2010). Therefore, the present study aimed to develop a rapid, simple, and an economical novel method of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes, which could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and for molecular epidemiological surveillance studies. 2. Materials and methods 2.1. Virus isolates and serum The NDV isolates/strains and LaSota strain specific serum, maintained in the freeze dried form, were obtained from the Virology Laboratory Repository, Avian Disease Section, Division of Pathology, Indian Veterinary Research Institute (IVRI), Izatnagar (UP), India, and used for this study. 2.2. Propagation of NDV isolates The freeze dried NDV isolates/strains were reconstituted in one ml of 1% phosphate buffered saline (PBS, pH 7.2). For virus propagation, the inoculums were prepared as per standard protocol (OIE, 2012). The reconstituted 0.2 ml of inoculums were inoculated into 9–11-day-old specific pathogen free (SPF) embryonated chicken eggs (Venkateshwara Hatcheries Private Limited, Pune, India) via allantoic route, and the eggs were incubated at 37 ◦ C till death of embryos or a maximum period of 120 h, whichever was earlier. The embryos were candled every day, the dead embryos were chilled at 4 ◦ C for overnight and the harvested allantoic fluids were tested for hemagglutination (HA) activity (OIE, 2012). The allantoic fluids which were negative for HA activity were further passaged at least once more in embryonated chicken eggs. The presence of NDV in the allantoic fluids was confirmed by hemagglutination inhibition (HI) test employing LaSota strain specific serum and RT-PCR. 2.3. RT-PCR primers The external primers (A and B) of 535 bp length were used to amplify class II NDV while the internal primers (C and D) of 238 bp were used for secondary amplification (Table 1) (Fig. 1). The internal degenerative reverse primer D is present in the F gene cleavage site of the virus, and amplifies only the velogenic and mesogenic strains of NDV (Kant et al., 1997; Tiwari et al., 2004).

Fig. 1. Location of external and internal primers and their combination of four different product sizes.

2.4. RNA extraction and nested RT-PCR The allantoic fluids harvested from the virus inoculated embroyonated chicken eggs were subjected to total RNA extraction with TRIzolR reagent (Invitrogen, Carlsbad, USA) as per the manufacturer’s instructions. The extracted RNA was used to synthesize cDNA employing random hexamer primers (MBI Fermentas, Pittsburgh, USA). Reverse transcription (RT) for the first strand synthesis was carried out by Revert aid H minus enzyme (MMuLV-RT) (MBI Fermentas, Pittsburgh, USA). The primary RT-PCR assay was carried out with class II specific primers A and B of 535 bp length (Liu et al., 2011). The RT-PCR was optimized in a standard 25 ␮l reaction mixture containing cDNA 3.0 ␮l, DreamTaq PCR Master mix 2X (Thermo Scientific, Pittsburgh, USA) 12.5 ␮l, forward primer (10 p mol/␮l) 1.0 ␮l, reverse primer (10 p mol/␮l) 1.0 ␮l and nuclease free water 7.5 ␮l. The cyclic conditions for primary amplification were initial denaturation at 95 ◦ C for 4 min, followed by 35 cycles of 94 ◦ C for 40 s, 52 ◦ C for 50 s, 72 ◦ C for 50 s and final extension at 72 ◦ C for 5 min. The secondary amplification was carried out using primers C and D of 255 bp length in nested RT-PCR, optimized in a standard 25 ␮l reaction mixture as like for primary amplification and using the unpurified 1 ␮l primary RT-PCR product as a template. The cyclic conditions for the secondary amplification were same as of primary amplification with the exception of annealing temperature of 57 ◦ C for 50 s. The PCR products were analyzed by electrophoresis in 1.5% agarose gel stained with ethidium bromide (0.5 ␮g/ml). 2.5. Standardization of multiple bands for NDV pathotyping in nested RT-PCR The primary RT-PCR was carried out as explained above with the use of two primers A and B, while four different combinations of primers C and D (i) with C and D primers, (ii) without C and D primers, (iii) only with C primer, and (iv) only with D primer, respectively, were used in the secondary RT-PCR to confirm the multiple banding patterns for different NDV pathotypes. These primer combinations were tested for detecting avirulent (LaSota) and virulent (NDV/Peafowl/Haryana/IVRI-037/12) NDV (Table 2). The synthesized cDNA and primary RT-PCR products were purified by using GeneJET PCR purification kit (Thermo Scientific, Pittsburgh, USA) as per manufacturer’s instructions, and were used as template for secondary RT-PCR to confirm the band pattern. Table 2 Different combination of internal primers and their band pattern in the nested RTPCR for virulent and avirulent NDV. Isolates and primer combinations

Band pattern in the nested RT-PCR

Virulent NDV

4 bands of 535 bp,424 bp, 349 bp and 238 bp 2 bands of 535 bp, 424 bp 2 bands of 535 bp, 424 bp 1 band of 535 bp 1 band of 535 bp 2 bands of 535 bp, 424 bp 2 bands of 535 bp, 349 bp 1 band of 535 bp

Avirulent Avirulent without D primer Avirulent without C primer Avirulent without C & D primer Virulent without D primer Virulent without C primer Virulent without C & D primer

P.A. Desingu et al. / Journal of Virological Methods 212 (2015) 47–52

49

2.6. Sensitivity determination of the developed nested RT-PCR The NDV F gene class II specific RT-PCR products (535 bp) were purified by using GeneJET PCR purification Kit (Thermo Scientific, Pittsburgh, USA) as per manufacturer’s instructions. These purified RT-PCR products were quantified by Nanodrop (NanoVue Plus Spectrophotometer, GE Healthcare, Pittsburgh, USA). The nanodrop values were used to calculate the copy number of RT-PCR products with the use of dsDNA copy number calculator software (https://cels.uri.edu/gsc/cndna.html). The known copy number of RT-PCR products was tenfold serially diluted, and for each dilution the RT-PCR was performed using external primers (class II specific, 535 bp) and nested RT-PCR primers. The virulent peafowl isolate (NDV/Peafowl/Haryana/IVRI-037/12) and avirulent (LaSota) strain was used to determine the sensitivity of the developed nested RTPCR assay. 2.7. Comparison of nested RT-PCR with determination of F0 cleavage site amino acid motif The 25 NDV field isolates (10 – chicken; 8 – pigeon; 3 – peafowl; 2 – Guinea fowl; 1 – Quail; 1 – Crane origin) and 9 vaccine stains were propagated in SPF embryonated chicken eggs through allantoic route and subjected to nested RT-PCR for differential detection of the NDV pathotypes. The RT-PCR amplified NDV F gene products were sequenced with by commercial sequencing centre (BioServe, India). From the nucleotide sequence, the amino acid motif in the F0 cleavage site was determined using Expasy translation tool (http://web.expasy.org/translate/). 3. Results 3.1. Propagation of NDV isolates

Fig. 2. Different combination of internal primers and their band pattern in the nested RT-PCR for virulent and avirulent NDV. Lane: 1 – Virulent NDV, 2 – Avirulent, 3 – Avirulent without D primer, 4 – Avirulent without C primer, 5 – Marker, 6 – Avirulent without C & D primer, 7 – Virulent without D primer, 8 – Virulent without C primer, 9 – Virulent without C & D primer.

3.4. Comparison of nested RT-PCR with determination of F0 cleavage site amino acid motif The sequence analysis of the 25 field NDV isolates and 9 vaccine strains revealed that 21 of the virus isolates and 6 mesogenic NDV vaccine strains possessed virulent amino acid motif of 112 RRQ(R/K) RF117 at the F gene cleavage site, and produced 4 bands with the developed nested RT-PCR, which together confirmed these to be as virulent strains. While 4 of the field NDV isolates and 3 lentogenic NDV vaccine strains possessed avirulent amino acid motif of 112 G(R/K)QGRL117 at the F gene cleavage site, and produced 2 bands with the developed nested RT-PCR, which together confirmed these to be as avirulent strain (Table 3) (Figs. 3–5). The newly developed nested RT-PCR in the present study thus showed similar results as of sequencing and demonstration of amino acids motif at the F gene cleavage site when applied with different NDV isolates/strains recovered from different species of birds.

The harvested allantoic fluids of all the 34 reconstituted NDV isolates/strains, propagated in SPF embryonated chicken eggs, were found positive for HA test and the presence of NDV was confirmed by HI test using LaSota anti-serum raised in chicken. 3.2. NDV pathotyping based on multiple bands in nested RT-PCR The nested RT-PCR was carried out for standardization of multiple bands with various primer combinations on virulent NDV (NDV/Peafowl/Haryana/IVRI-037/12), showed different band patterns (i) with C and D primers – 4 bands of 535 bp, 424 bp, 349 bp and 238 bp, (ii) without C and D primers – one band of 535 bp, (iii) without C primer-2 bands of 535 bp, 349 bp, and (iv) without D primer-2 bands of 535 bp, 424 bp. Similarly, the avirulent NDV (LaSota strain) also showed different band patterns (i) with C and D primers – two bands of 535 bp, 424 bp, (ii) without C and D primers – one band of 535 bp, (iii) without C primer – one band of 535 bp, and (iv) without D primer – two bands of 535 bp, 424 bp (Fig. 2). The synthesized cDNA and the purified primary RT-PCR products, used as template for secondary RT-PCR, showed single band of 238 bp for the virulent NDV (NDV/Peafowl/Haryana/IVRI-037/12) and no band for the avirulent NDV (LaSota strain).

Fig. 3. Primary RT-PCR amplification. Lane: M – ladder, 1 – NDV/Peafowl/Rewari/ India/IVRI-0037/12, 2 – NDV/Peafowl/Haryana/India/IVRI-0024, 3 – NDV/Peafowl/ Delhi/India/IVRI-0022, 4 – Lasota, 5 – H strain, 6 – R2 B, 7 – Komarov, 8 – Pi07/AD/01 (PPMV-1), 9 – Pi01/AD/91 (PPMV-1), 10 – CARI sample, 11 – F strain, 12 – Pi05/AD/97 (PPMV-1), 13 – 108/Bareilly/AD-IVRI/91, 14 – 127/Faizabad/AD-IVRI/92.

Fig. 4. Nested RT-PCR amplification. Lane: M–ladder, 1 – NDV/Peafowl/Rewari/ India/IVRI-0037/12, 2 – NDV/Peafowl/Haryana/India/IVRI-0024, 3 – NDV/Peafowl/ Delhi/India/IVRI-0022, 4 – Lasota, 5 – H strain, 6 – R2 B, 7 – Komarov, 8 – Pi07/AD/01 (PPMV-1), 9 – Pi01/AD/91 (PPMV-1), 10 – F strain, 11 – 123/Kathua/AD-IVRI/92, 12–Pi05/AD/97 (PPMV-1), 13 – 108/Bareilly/AD-IVRI/91, 14 – 127/Faizabad/ADIVRI/92.

3.3. Sensitivity of the developed nested RT-PCR The sensitivity of the developed RT-PCR primary amplification and secondary amplification for the virulent NDV isolate (NDV/ Peafowl/Haryana/IVRI-037/12) was 3.46 × 101 and 3.46 × 100 copy numbers, respectively, and for the avirulent NDV (LaSota strain) it was 4.33 × 101 and 4.33 × 100 copy numbers, respectively.

Fig. 5. Nested RT-PCR amplification. Lane: M – ladder, 1 – PiAD388/Quail/India, 2 – PiAD33/Guinea fowl/India, 3 – PiAD18/Guinea fowl/India, 4 – PiAD55/Pigeon/India, 5 – 129/FAIZABAD/AD-IVRI/92, 6 – crane/ADS/IVRI/13, 7 – 1/chicken/IVRI/13, 8 – IVRI/92; 9 – Pi02/AD/91 (PPMV-1), 10 – Pi04/AD/94 (PPMV-1), 11 – IVRI/91, 12 – Mukteswar, 13 – Roakin, 14 – Beaudette C.

50

P.A. Desingu et al. / Journal of Virological Methods 212 (2015) 47–52

4. Discussion Newcastle disease is one of the most economically important poultry diseases caused by APMV-I and has two classes namely class I and II. The class I isolates are reported to be low virulent strains, while class II includes most of the highly virulent, all vaccine strains, and reasonable numbers of avirulent strains (Liu et al., 2011). There is a high similarity between virulent, vaccine and avirulent NDV strains, which hinders the diagnosis of NDV. Liu et al. (2011) identified 40 class II NDV isolates out of the 67 field isolates tested by class II specific RT-PCR. Similarly, in the present study all the NDV isolates were found to be positive by class II specific RTPCR and thus confirmed as to be of class II NDV. Even though ICPI is gold standard for determining the virulence/pathotype of the NDV strains, however several studies have emphasized the use of routine in vitro tests for this purpose. The use of molecular techniques to determine the F0 cleavage site sequence by RT-PCR, followed by analysis of the amplified product by restriction enzyme analysis, probe hybridization or nucleotide sequencing is gaining attention (Miller et al., 2010; OIE, 2012; Naveen et al., 2013). For the pathotypic characterization of the NDV isolates, the nucleotide variation around the F gene cleavage site is considered to be the primary molecular determinant for NDV virulence (Glickman et al., 1988; Aldous and Alexander, 2001). Hence, the OIE new definition of

Newcastle disease includes the determination of the F0 cleavage sequence which may give a clear indication of the virulence of the causative virus (OIE, 2012). Kant et al. (1997) used two reverse primers for the detection of NDV pathotypes, one for virulent (velogenic and mesogenic), and the other for avirulent (lentogenic) strain detection. However, Tiwari et al. (2004) contradicted this finding of Kant et al. (1997) and demonstrated that the reverse avirulent primer could also amplify virulent NDV pathotypes. Zhang et al. (2010) used new degenerate primer based semi nested RT-PCR and recorded increased sensitivity for detecting virulent NDV pathotypes. In the present study the use of class II specific APMV-1 primer as an external primer to avoid the amplification of avirulent class I NDV. The use of virulent NDV (velogenic and mesogenic) specific primer of Kant et al. (1997) as an internal reverse primer to differential detection of NDV increased the diagnostic sensitivity. The multiple bands amplified with the developed nested RT-PCR can help avoiding the false positive and false negative results which commonly occur due to RT-PCR reaction mixture, cyclic conditions and other human errors during performing RT-PCR. In general, with the use of nested RT-PCR for detecting NDV the lentogenic strains might not produce any band because the D nested reverse degenerate primer is specific for virulent strains, but in the present study, the lentogenic strain also produced two

Table 3 Comparison of amino acid motif at F gene cleavage site (112–117) and number of bands in the developed nested RT-PCR.

Accession Number

Isolate/strai n name

Primer_1 (Reverse complement of degenerate primer D, Y= C) Primer_2 (Reverse complement of primer D, Y= T)

Nucleotide at F gene cleavage site (395-380 position)

Amino Species acid motif F gene cleavage site (112117 position) AGG AGA CAG AGA CGC T RRQRR? -

... ... ... .A.

... .

...K.?

-

Number bands in nested RT-PCR

AY581301a

PiAD388/Qu ail/India

... ... ... ... ... .

.....F

Quail

Four

AY581302a

PiAD33/Gui nea fowl/India

... ... ... ... ... .

.....F

Guinea fowl

Four

AY581303 a

PiAD18/Gui nea fowl/India

... ... ... ... ... .

.....F

Guinea fowl

Four

AY581304 a

PiAD55/Pige on/India

... ... ... .A. ... .

...K.F

Pigeon

Four

AY581305 a

PiADPrd/Pig eon/India

... ... ... .A. ... .

...K.F

Pigeon

Four

AJ781075 a

Pi07/AD/01

... ... ... .A. ... .

...K.F

Pigeon

Four

AJ781070 a

Pi01/AD/91

... ... ... .A. ... .

...K.F

Pigeon

Four

AJ781071 a

Pi02/AD/91

... ... ... .A. ... .

...K.F

Pigeon

Four

a

Pi04/AD/94

... ... ... .A. ... .

...K.F

Pigeon

Four

AJ781073 a

Pi05/AD/97

... ... ... .A. ... .

...K.F

Pigeon

Four

AJ781072

P.A. Desingu et al. / Journal of Virological Methods 212 (2015) 47–52 Table 3 (Continued )

AJ781074 a

Pi06/AD/01

... ... ... .A. ... .

...K.F

Pigeon

Four

KJ398399 b

NDV/Peafow ... ... ... .A. ... . l/Delhi/IVRI0022/12

...K.F

Peafow l

Four

KJ398400 b

NDV/Peafow ... ... ... .A. ... . l/Haryana/ IVRI-037/12

...K.F

Peafow l

Four

KJ398401 b

NDV/Peafow ... ... ... ... ... . l/UP/IVRI024/1

.....F

Peafow l

Four

KJ627774 b

129/Faizabad ... ... ... .A. ... . ...K.F /AD-IVRI/92

Chicke n

Four

KJ627775 b

127/Faizabad ... ... ... .A. ... . /AD-IVRI/92

...K.F

Chicke n

Four

KJ627776 b

108/Bareilly/ AD-IVRI/91

... ... ... .A. ... .

...K.F

Chicke n

Four

KJ627781 b

1/chicken/IV RI/13

... ... ... ... ... .

.....F

Chicke n

Four

KJ627782 b

123/Kathua/ AD-IVRI/92

... ... ... .A. ... .

...K.F

Chicke n

Four

KJ627783 b

IVRI/92

... ... ... .A. ... .

...K.F

Chicke n

Four

KJ627784 b

IVRI/91

... ... ... .A. ... .

...K.F

Chicke n

Four

AF224505 c

Mukteswar

... ... ... ... ... . ... ... ... ... ... . ... ... ... .A. ... .

.....F

-

Four

.....F

-

Four

...K.F

-

Four

Y16170

c

JX316216

H strain c

R2B

JN872154 c

Beaudette C

... ... ... .A. ... .

...K.F

-

Four

JN863121c

Roakin

... ... ... .A. ... .

...K.F

-

Four

Komarov

... ... ... .A. ... .

...K.F

-

Four

KJ627778 b

4/chicken/IV RI/1

G.. ... ... G.G ... C

G..G.L

Chicke n

Two

KJ627779 b

3/chicken/IV RI/13

G.. ... ... G.G ... C

G..G.L

Chicke n

Two

KJ627780 b

2/chicken/IV RI/13

G.. ... ... G.G ... C

G..G.L

Chicke n

Two

KJ627773 b

crane/ADS/I VRI/13

G.. .A. ... G.G ... C

GK.G.L

Crane

Two

JN872150 c

B1

G.. ... ... G.G ... C

G..G.L

-

Two

EF440343c

F strain

G..G.L

-

Two

c

LaSota

G.. ... ... G.G ... C G.. ... ... G.G ... C

G..G.L

-

Two

EF440345

EF440344

c

Superscript a – sequences submitted in previous studies; b – sequences submitted during the present study; c – sequences taken from NCBI GenBank.

51

52

P.A. Desingu et al. / Journal of Virological Methods 212 (2015) 47–52

bands which could help in avoiding other error(s) giving rise to false negative results. The virulent NDV isolates/strains produced four bands with this newly developed nested RT-PCR. The different internal primer combinations employed in the nested RT-PCR with virulent NDV (NDV/Peafowl/Haryana/IVRI-037/12), showed different banding patterns (i) with C and D primers – 4 bands of 535 bp, 424 bp, 349 bp and 238 bp, because all the four primers (two external primers and two internal primers) have worked together producing four bands, (ii) without C and D primers – one band of 535 bp, because only the external primers used, (iii) without C primer-2 bands of 535 bp, 349 bp, because three primers (two external primer and one internal primer) worked together producing two bands, and (iv) without D primer-2 bands of 535 bp, 424 bp, because three primers (two external primer and one internal primer) worked together producing two bands. Similarly, the avirulent NDV (LaSota strain) also showed different band patterns (i) with C and D primers – two bands of 535 bp, 424 bp, because three primers (two external primer and one internal primer) worked together, however primer D could not work in the case of avirulent NDV and thus resulted in production of two bands, (ii) without C and D primers – one band of 535 bp, because only external primers used, (iii) without C primer – one band of 535 bp, because only the external primers worked, however primer D could not work in case of avirulent NDV and produced single band, and (iv) without D primer – two bands of 535 bp, 424 bp, because three primers (two external primer and one internal primer) worked together producing two bands. The synthesized cDNA (without primary RTPCR) and the purified primary RT-PCR products showed only single band with the use of internal primers during the present study. This revealed that all the four primers (two internal and two external primers) worked together in the developed nested RT-PCR, and produced four bands in the case of virulent NDV. While in the case of avirulent NDV, the internal primer D did not work, but two external primers and one internal primer worked together and produced two bands. The developed nested RT-PCR with the use of degenerate primer was found to be 10 times more sensitive as compared to conventional RT-PCR amplification for NDV detection, and was able to detect up to 3 and 4 genome copies for virulent and avirulent NDV, respectively. The sequence analysis and the developed nested RT-PCR showed similar results in pathotype pattern determination of all the field NDV isolates and vaccine strains used in this study. The pigeon, quail, guinea fowl, peafowl and crane NDV isolates showed concurrent results in both the nested RT-PCR and demonstration of specific amino acid motif used for assessing virulence status; hence the developed nested RT-PCR has potential to be exploited for detecting and differentiating NDV pathotypes. The amino acid motif at F gene cleavage site 113 RXR/KRF117 is specific for virulent NDV pathotypes (Saif, 2008). The amino acid motif pattern of 112 R-R-K-K-R-F117 in pigeon variant PMV-1 isolates have been correlated to both high and low virulence isolates/strains in ICPI tests conducted in chickens (Werner et al., 1999). The virulent motif 112 G-R-Q-K-R-F117 of PPMV-1 isolates exhibited low virulence in chickens (Collins et al., 1996; Zanetti et al., 2001). In the present study, the amino acid motif pattern of pigeon isolate was 112 R-R-Q-K-R-F117 (virulent pattern) and the developed nested RT-PCR showed four bands, indicating virulence nature of the PPMV-1. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR banding patterns.

5. Conclusion The present study reports the use of degenerate primer based nested RT-PCR as an alternate rapid and simple

diagnostic test for accurate detection and differentiation of NDV pathotypes. The developed nested RT-PCR demonstrated a unique multiple band pattern with NDV isolates/strains which can be highly useful for pathotyping of the virus and avoiding false positive/negative results. Further studies regarding application of this test with clinical samples are needed which could define its potent practical utility for characterizing NDV field isolates as well as for molecular epidemiological surveillance and monitoring.Competing interests The authors declare that they have no competing interests. Acknowledgements The authors are highly thankful to Indian Veterinary Research Institute, Izatnagar and Indian Council of Agriculture Research, New Delhi for providing necessary facilities to carry out this research work. References Aldous, E.W., Alexander, D.J., 2001. Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1). Avian Pathol. 30, 117–128. Alexander, D.J., Campbell, G., Manvell, R.J., Collins, M.S., Parsons, G., McNulty, M.S., 1992. Characterization of an antigenically unusual virus responsible for two outbreaks of Newcastle disease in the Republic in Ireland in 1990. Vet. Rec. 130, 65–68. Collins, M.S., Strong, I., Alexander, D.J., 1996. Pathogenicity and phylogenetic evaluation of the variant Newcastle disease viruses termed “pigeon PMV-1 viruses” based on the nucleotide sequence of the fusion protein gene. Arch. Virol. 141, 635–647. Glickman, R.L., Syddall, R.J., Iorio, R.M., Sheehan, J.P., Bratt, M.A., 1988. Quantitative basic residue requirements in the cleavage-activation site of the fusion glycoprotein as a determinant of virulence for Newcastle disease virus. J. Virol. 62, 354–356. ICTV, 2012. http://www.ictvonline.org/virusTaxonomy.asp (assessed 18.03.14). Kant, A., Koch, G., Van Roozelaar, D.J., Balk, F., Ter Huurne, A., 1997. Differentiation of virulent and non-virulent strains of Newcastle disease virus within 24 hours by polymerase chain reaction. Avian Pathol. 26, 837–849. Kim, L.M., King, D.J., Curry, P.E., Suarez, D.L., Swayne, D.E., Stallknecht, D.E., Slemons, R.D., Pedersen, J.C., Senne, D.A., Winker, K., Afonso, C.L., 2007. Phylogenetic diversity among low-virulence Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype distributions to those of poultry-origin isolates. J. Virol. 81, 12641–12653. Liu, H., Zhao, Y., Zheng, D., Lv, Y., Zhang, W., Xu, T., Li, J., Wang, Z., 2011. Multiplex RT-PCR for rapid detection and differentiation of class I and class II Newcastle disease viruses. J. Virol. Methods 171, 149–155. Miller, P.J., Decanini, E.L., Afonso, C.L., 2010. Newcastle disease: evolution of genotypes and the related diagnostic challenges. Infect. Genet. Evol. 10, 26–35. Naveen, K.A., Singh, S.D., Kataria, J.M., Barathidasan, R., Dhama, K., 2013. Detection and differentiation of pigeon paramyxovirus serotype-1 (PPMV-1) isolates by RT-PCR and restriction enzyme analysis. Trop. Anim. Health Prod. 45 (5), 1231–1236. Nayak, B., Diasa, F.M., Kumara, S., Palduraia, A., Collinsb, P.L., Samal, S.K., 2012. Avian paramyxovirus serotypes 2-9 (APMV-2-9) vary in the ability to induce protective immunity in chickens against challenge with virulent Newcastle disease virus (APMV-1). Vaccine 30, 2220–2227. O.I.E., 2012. OIE Terrestrial Manual. Newcastle Disease, vol. 3., pp. 14 (Chapter 2). Saif, Y.M., 2008. Diseases of poultry, 12th ed. Blackwell Publishing Professional, 2121 State Avenue, Ames, Iowa 50014 USA, pp. 75–100 (Chapter 3). Terregino, C., Aldous, E.W., Heidari, A., Fuller, C.M., De Nardi, R., Manvell, R.J., Beato, M.S., Shell, W.M., Monne, I., Brown, I.H., Alexander, D.J., Capua, I., 2013. Antigenic and genetic analyses of isolate APMV/wigeon/Italy/3920-1/2005 indicate that it represents a new avian paramyxovirus (APMV-12). Arch. Virol. 158, 2233–2243. Tiwari, A.K., Kataria, R.S., Nanthakumar, T., Dash, B.B., Desai, G., 2004. Differential detection of Newcastle disease virus strains by degenerate primers based RTPCR. Comp. Immunol. Microbiol. Infect. Dis. 27, 163–169. Werner, O., Romer-Oberdorfer, A., Kollne, B., Manvell, R.J., Alexander, D.J., 1999. Characterization of avian paramyxovirus type 1 strains isolated in Germany during 1992 to 1996. Avian Pathol. 28, 79–88. Zanetti, F., Mattiello, R., Garbino, C., Kaloghlian, A., Terrera, M.V., Boviez, J., Palma, E., Carrillo, E., Berinstein, A., 2001. Biological and molecular characterization of a pigeon paramyxovirus type-1 isolate found in Argentina. Avian Dis. 45, 567–571. Zhang, L., Pan, Z., Geng, S., Chen, X., Hu, S., Liu, H., Wu, Y., Jiao, X., Liu, X., 2010. Sensitive, semi-nested RT-PCR amplification of fusion gene sequences for the rapid detection and differentiation of Newcastle disease virus. Res.Vet. Sci. 89, 282–289.