Appl Microbiol Biotechnol DOI 10.1007/s00253-013-5356-1
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
A rapid fluorescence polarization-based method for genotypic detection of drug resistance in Mycobacterium tuberculosis Yisuo Sun & Shufen Li & Lin Zhou & Lin Zhou & Qiu Zhong & Shisong Fang & Tao Chen & Lijun Bi & Wai-Kin Mat & Cunyou Zhao & Hong Xue
Received: 11 August 2013 / Revised: 21 October 2013 / Accepted: 22 October 2013 # Springer-Verlag Berlin Heidelberg 2014
Abstract Rapid detection of drug-resistant Mycobacterium tuberculosis is critical to the effective early treatment and prevention of the transmission of tuberculosis. However, conventional drug susceptibility tests for M. tuberculosis require up to several weeks. In the present study, the One Label Extension genotyping method was adapted for rapid detection of drug resistance-associated sequence variations in six genes of M. tuberculosis , viz. rpoB , rpsL , rrs, embB , katG , or inhA . The method utilizes polymerase chain reaction
Yisuo Sun, Shufen Li, and Lin Zhou contributed equally to this study. Y. Sun : W. CCG (viz. L511P) GAC > GTC (viz. D516V) TCG > CAG (viz. S522Q) TCG > TTG (viz. S522L) CAC > TAC (viz. H526Y)
GTTCTTCGGCACCAGCCAGC CCAGCTGAGCCAATTCATGG CGGCGCTTGTGGGTCAACCCC CGGCGCTTGTGGGTCAACCCC AACCCGCTGTCGGGGTTGACC
TCG > TTG (viz. S531L) TCG > TTT (viz. S531F) TCG > TGG (viz. S531W) TCG > CAG (viz. S531Q) CTG > CCG (viz. L533P) AAG > AGG (viz. K43R) AAG > CGG (viz. K43R) AAG > AGG (viz. K88R) 461C > T 513A > C 874G > A ATG > GTG (viz. M306V) ATG > CTG (viz. M306L) ATG > ATC (viz. M306I) CTG > GTG (viz. L402V) ATG > ATA (viz. M306I) AGC > ACC (viz. S315T) -15C > T
CCCACAAGCGCCGACTGT CCCACAAGCGCCGACTGT AGACCGCCGGGCCCCAGCGCC AGACCGCCGGGCCCCAGCGCC CGTGACAGACCGCCGGGCCCC GCGTGTACACCACCACTCCGA GCGTGTACACCACCACTCCGA CTGGTGCGCGGCGGCCGGGTGA TCCACCTACCGTCAATCCGAGA ACCGGCCAACTACGTGCCAGC TAGCCTTGCGGCCGTACTCCC CGGACGACGGCTACATCCTGGGC CGGACGACGGCTACATCCTGG GTCGGCGACTCGGGC TGGATGCCGTTCAACAACGGC GTCGGCGACTCGGGC ACCGGTAAGGACGCGATCACCA TCACCCCGACAACCTATC
rpsL
rrs
embB
katG inhA
In the preceding formulae, [number of drug resistant isolates without mutations] might be regarded as false negatives, and [number of drug susceptible isolates with mutations] might be regarded as false positives. Notably, however, because the presence or absence of mutation determined by DNA sequencing was in all instances identical to that determined by the OLE assay (see Results section), the false negatives and false positives were indicative of imperfect correlations between mutation and drug susceptibility, and not to any methodological error due to the OLE assay. Statistical analysis Data analysis was carried out using the software package VassarStats at http://www.vassarstats.net/. The lower and upper limits of the 95 % confidence interval (CI) for a proportion were calculated according to two methods (Newcombe 1998). Chi-square test with a two-by-two contingency table was performed for statistical significance, which was defined as P value TTG), and 85.7 % of the isolates with the S531L was RIF-resistant based
Appl Microbiol Biotechnol Table 3 Correlation of genotypes at mutational sites in drug resistance genes identified by DNA sequencing or OLE assay with drug susceptibility phenotypes
Gene
rpoB
rpsL
rrs
embB
katG
b
Lacking in prediction power for EMB susceptibility, and therefore removed from the analysis shown in Table 4
inhA
Na based on OLE assay
Drug susceptibility test Ra
Sa
% R (95 % CIa)
CTG > CCG (viz. L511P)
4
4
4
0
100.0 (39.6–100.0)
GAC > GTC (viz. D516V) TCG > CAG (viz. S522Q) TCG > TTG (viz. S522L) CAC > TAC (viz. H526Y) TCG > TTG (viz. S531L) TCG > TTT (viz. S531F) TCG > TGG (viz. S531W) TCG > CAG (viz. S531Q) CTG > CCG (viz. L533P) Total AAG > AGG (viz. K43R) AAG > CGG (viz. K43R) AAG > AGG (viz. K88R) Total 461C > T 513A > C 874G > A Total ATG > GTG (viz. M306V)
3 1 1 1 14 2 1 1 2 30 25 1 4 30 3 3 1 7 7
3 1 1 1 14 2 1 1 2 30 25 1 4 30 3 3 1 7 7
2 1 1 1 12 2 1 1 1 26 24 1 4 29 3 2 1 6 5
1 0 0 0 2 0 0 0 1 4 1 0 0 1 0 1 0 1 2
66.7 (12.5–98.2) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 85.7 (56.2–97.5) 100.0 (19.8–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 50.0 (2.7–97.3) 86.7 (68.4–95.6) 96.0 (77.7–99.8) 100.0 (5.5–100.0) 100.0 (39.6–100.0) 96.7 (81.0–99.8) 100.0 (31.0–100.0) 66.7 (12.5–98.2) 100.0 (5.5–100.0) 85.7 (42.0–99.3) 71.4 (30.3–94.9)
ATG > CTG (viz. M306L) ATG > ATC (viz. M306I) CTG > GTG (viz. L402V) ATG > ATA (viz. M306I) GAG > GCG (viz. E378A)b
1 1 1 3
1 1 1 3
1 1 1 1
0 0 0 2
100.0 (5.5–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 33.3 (1.8–87.5)
3 1 2 19 22 22 8 8
N.A.b N.A.b N.A.b 19 22 22 8 8
0 0 0 9 21 21 5 5
3 1 2 10 1 1 3 3
0.0 (0.0–69.0) 0.0 (0.0–94.5) 0.0 (0.0–80.2) 47.4 (25.2–70.5) 95.5 (75.1–99.8) 95.5 (75.1–99.8) 62.5 (25.9–89.8) 95.5 (75.1–99.8)
b
a
N = total number of the strains displaying the mutation, CI = confidence interval, R = drug resistant, S = drug susceptible, N.A. = not applicable
Na based on sequencing
Mutation
ATG > GTG (viz. M396V) GGC > AGC (viz. G406S)b Total AGC > ACC (viz.S315T) Total −15C > T Total
on drug susceptibility test results. Drug resistance was observed in all four isolates with the L511P (CTG > CCG) mutation, two out of three isolates with the D516V (GAC > GTC), two isolates with the S531F (TCG > TTT), one isolate each with S522Q (TCG > CAG), S522L (TCG > TTG), H526Y (CAC>TAC), S531W (TCG > TGG), and S531Q (TCG > CAG), and one out of two isolates with L533P (CTG > CCG). RpsL and rrs Thirty isolates displayed three nonsynonymous mutations of rpsL, viz. K43R (AAG > AGG and AAG > CGG) and K88R (AAG > AGG). Twenty-four out of twenty-five isolates with the K43R (AAG > AGG) mutation were STR-resistant and one was STR-susceptible. STR-resistance was observed in the one isolate with K43R
(AAG > CGG) and the four isolates with K88R (AAG > AGG). For the rrs gene, seven isolates displayed three single-point mutations, viz. 461C > T, 513A > C and 874G > A. STR-resistance was observed in the 874G > A isolate, all three isolates with 461C > T, and two out of three isolates with 513A > C. EmbB Nineteen isolates displayed one or more nonsynonymous mutations. The most prevalent mutation was M306V (ATG > GTG), where 71.4 % of the mutants were EMB-resistant. EMB-resistance was observed in one isolate each with M306L (ATG > CTG), M306I (ATG > ATC) and L402V (CTG > GTG), and one out of three isolates with M306I (ATG > ATA). However, 100 % of the isolates with E378A (GAG > GCG), M396V (ATG > GTG), or G406S
Appl Microbiol Biotechnol
(GGC > AGC) was EMB-susceptible, which accordingly were not tested with the OLE assay. KatG and inhA Twenty-two isolates displayed katG mutations with S315T (AGC > ACC), 21 of which were INHresistant. For the inhA gene, 8 isolates displayed the −15C > T mutation, 5 of which were INH-resistant.
Analysis of mutational sites in MTB-drug resistance genes by OLE assay The OLE method as described in Methods employed two separate OLE reactions for each PCR-product DNA template. Each reaction contained a TAMRA-dNTP complementary to either the wild-type or mutant base at the target site. When the extension primer undergoes chain extension to enable incorporation of the fluorescent TAMRA-dNTP complementary to the target site nucleotide, the identity of the target site nucleotide is thereby revealed (Fig. 1). The method is similar to that reported previously (Yu et al. 2006) except for replacement of the fluorescence-labeled ddNTP employed in that study by fluorescence-labeled dNTP in the present study. When the OLE method was used to analyze a target site for the S531L (TCG > TTG) mutation of rpoB gene on a DNA template in Fig. 2, the nucleotide residue at the target was dCMP in the wild-type and dTMP in the mutant. Therefore, the wild-type genotype would enable the incorporation of TAMRA-dCTP into the extension primer, whereas the mutant genotype would enable the incorporation of TAMRA-dTTP into the extension primer instead. Accordingly, when DNA templates prepared from MTB isolates were tested for the TTG mutation, one group yielded significant incorporation of TAMRA-dTMP, but not TAMRA-dCMP (cluster of triangles at left upper corner of graph); another group yielded significant incorporation of TAMRA-dCMP but not TAMRA-dTMP (cluster of circles at right lower corner of graph) and corresponded to the wild-type genotype. The same two-cluster distinction was likewise observed for the other targets sites in Fig. 2, in each case providing a clear-cut indication of the mutant or wildtype genotype at the target site examined. Upon comparison between the genotype of each target site determined by OLE and the genotype determined by direct DNA sequencing of PCR amplicons, 100 % agreement between the two sets of determinations was obtained for all of the 121 clinical samples. These results fully validated the accuracy of the OLE method for the high-throughput genotyping of drug resistant MTB mutation sites. Performance of OLE assay with the selected markers Table 3 shows the correlations obtained between genotypes at mutational sites and drug susceptibility/resistance phenotype.
Because the genotypes revealed by DNA sequencing and those revealed by OLE assay were identical for all the isolates, the numbers of mutation (N) scored by DNA sequencing in column 3 were identical to those scored by OLE assay in column 4 for all the mutations. As shown in Table 4, the correlations obtained for the 121 clinical samples yielded sensitivity and specificity values of respectively 83.9 % (95 % CI, 65.5–93.9 %, P
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
A rapid fluorescence polarization-based method for genotypic detection of drug resistance in Mycobacterium tuberculosis Yisuo Sun & Shufen Li & Lin Zhou & Lin Zhou & Qiu Zhong & Shisong Fang & Tao Chen & Lijun Bi & Wai-Kin Mat & Cunyou Zhao & Hong Xue
Received: 11 August 2013 / Revised: 21 October 2013 / Accepted: 22 October 2013 # Springer-Verlag Berlin Heidelberg 2014
Abstract Rapid detection of drug-resistant Mycobacterium tuberculosis is critical to the effective early treatment and prevention of the transmission of tuberculosis. However, conventional drug susceptibility tests for M. tuberculosis require up to several weeks. In the present study, the One Label Extension genotyping method was adapted for rapid detection of drug resistance-associated sequence variations in six genes of M. tuberculosis , viz. rpoB , rpsL , rrs, embB , katG , or inhA . The method utilizes polymerase chain reaction
Yisuo Sun, Shufen Li, and Lin Zhou contributed equally to this study. Y. Sun : W. CCG (viz. L511P) GAC > GTC (viz. D516V) TCG > CAG (viz. S522Q) TCG > TTG (viz. S522L) CAC > TAC (viz. H526Y)
GTTCTTCGGCACCAGCCAGC CCAGCTGAGCCAATTCATGG CGGCGCTTGTGGGTCAACCCC CGGCGCTTGTGGGTCAACCCC AACCCGCTGTCGGGGTTGACC
TCG > TTG (viz. S531L) TCG > TTT (viz. S531F) TCG > TGG (viz. S531W) TCG > CAG (viz. S531Q) CTG > CCG (viz. L533P) AAG > AGG (viz. K43R) AAG > CGG (viz. K43R) AAG > AGG (viz. K88R) 461C > T 513A > C 874G > A ATG > GTG (viz. M306V) ATG > CTG (viz. M306L) ATG > ATC (viz. M306I) CTG > GTG (viz. L402V) ATG > ATA (viz. M306I) AGC > ACC (viz. S315T) -15C > T
CCCACAAGCGCCGACTGT CCCACAAGCGCCGACTGT AGACCGCCGGGCCCCAGCGCC AGACCGCCGGGCCCCAGCGCC CGTGACAGACCGCCGGGCCCC GCGTGTACACCACCACTCCGA GCGTGTACACCACCACTCCGA CTGGTGCGCGGCGGCCGGGTGA TCCACCTACCGTCAATCCGAGA ACCGGCCAACTACGTGCCAGC TAGCCTTGCGGCCGTACTCCC CGGACGACGGCTACATCCTGGGC CGGACGACGGCTACATCCTGG GTCGGCGACTCGGGC TGGATGCCGTTCAACAACGGC GTCGGCGACTCGGGC ACCGGTAAGGACGCGATCACCA TCACCCCGACAACCTATC
rpsL
rrs
embB
katG inhA
In the preceding formulae, [number of drug resistant isolates without mutations] might be regarded as false negatives, and [number of drug susceptible isolates with mutations] might be regarded as false positives. Notably, however, because the presence or absence of mutation determined by DNA sequencing was in all instances identical to that determined by the OLE assay (see Results section), the false negatives and false positives were indicative of imperfect correlations between mutation and drug susceptibility, and not to any methodological error due to the OLE assay. Statistical analysis Data analysis was carried out using the software package VassarStats at http://www.vassarstats.net/. The lower and upper limits of the 95 % confidence interval (CI) for a proportion were calculated according to two methods (Newcombe 1998). Chi-square test with a two-by-two contingency table was performed for statistical significance, which was defined as P value TTG), and 85.7 % of the isolates with the S531L was RIF-resistant based
Appl Microbiol Biotechnol Table 3 Correlation of genotypes at mutational sites in drug resistance genes identified by DNA sequencing or OLE assay with drug susceptibility phenotypes
Gene
rpoB
rpsL
rrs
embB
katG
b
Lacking in prediction power for EMB susceptibility, and therefore removed from the analysis shown in Table 4
inhA
Na based on OLE assay
Drug susceptibility test Ra
Sa
% R (95 % CIa)
CTG > CCG (viz. L511P)
4
4
4
0
100.0 (39.6–100.0)
GAC > GTC (viz. D516V) TCG > CAG (viz. S522Q) TCG > TTG (viz. S522L) CAC > TAC (viz. H526Y) TCG > TTG (viz. S531L) TCG > TTT (viz. S531F) TCG > TGG (viz. S531W) TCG > CAG (viz. S531Q) CTG > CCG (viz. L533P) Total AAG > AGG (viz. K43R) AAG > CGG (viz. K43R) AAG > AGG (viz. K88R) Total 461C > T 513A > C 874G > A Total ATG > GTG (viz. M306V)
3 1 1 1 14 2 1 1 2 30 25 1 4 30 3 3 1 7 7
3 1 1 1 14 2 1 1 2 30 25 1 4 30 3 3 1 7 7
2 1 1 1 12 2 1 1 1 26 24 1 4 29 3 2 1 6 5
1 0 0 0 2 0 0 0 1 4 1 0 0 1 0 1 0 1 2
66.7 (12.5–98.2) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 85.7 (56.2–97.5) 100.0 (19.8–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 50.0 (2.7–97.3) 86.7 (68.4–95.6) 96.0 (77.7–99.8) 100.0 (5.5–100.0) 100.0 (39.6–100.0) 96.7 (81.0–99.8) 100.0 (31.0–100.0) 66.7 (12.5–98.2) 100.0 (5.5–100.0) 85.7 (42.0–99.3) 71.4 (30.3–94.9)
ATG > CTG (viz. M306L) ATG > ATC (viz. M306I) CTG > GTG (viz. L402V) ATG > ATA (viz. M306I) GAG > GCG (viz. E378A)b
1 1 1 3
1 1 1 3
1 1 1 1
0 0 0 2
100.0 (5.5–100.0) 100.0 (5.5–100.0) 100.0 (5.5–100.0) 33.3 (1.8–87.5)
3 1 2 19 22 22 8 8
N.A.b N.A.b N.A.b 19 22 22 8 8
0 0 0 9 21 21 5 5
3 1 2 10 1 1 3 3
0.0 (0.0–69.0) 0.0 (0.0–94.5) 0.0 (0.0–80.2) 47.4 (25.2–70.5) 95.5 (75.1–99.8) 95.5 (75.1–99.8) 62.5 (25.9–89.8) 95.5 (75.1–99.8)
b
a
N = total number of the strains displaying the mutation, CI = confidence interval, R = drug resistant, S = drug susceptible, N.A. = not applicable
Na based on sequencing
Mutation
ATG > GTG (viz. M396V) GGC > AGC (viz. G406S)b Total AGC > ACC (viz.S315T) Total −15C > T Total
on drug susceptibility test results. Drug resistance was observed in all four isolates with the L511P (CTG > CCG) mutation, two out of three isolates with the D516V (GAC > GTC), two isolates with the S531F (TCG > TTT), one isolate each with S522Q (TCG > CAG), S522L (TCG > TTG), H526Y (CAC>TAC), S531W (TCG > TGG), and S531Q (TCG > CAG), and one out of two isolates with L533P (CTG > CCG). RpsL and rrs Thirty isolates displayed three nonsynonymous mutations of rpsL, viz. K43R (AAG > AGG and AAG > CGG) and K88R (AAG > AGG). Twenty-four out of twenty-five isolates with the K43R (AAG > AGG) mutation were STR-resistant and one was STR-susceptible. STR-resistance was observed in the one isolate with K43R
(AAG > CGG) and the four isolates with K88R (AAG > AGG). For the rrs gene, seven isolates displayed three single-point mutations, viz. 461C > T, 513A > C and 874G > A. STR-resistance was observed in the 874G > A isolate, all three isolates with 461C > T, and two out of three isolates with 513A > C. EmbB Nineteen isolates displayed one or more nonsynonymous mutations. The most prevalent mutation was M306V (ATG > GTG), where 71.4 % of the mutants were EMB-resistant. EMB-resistance was observed in one isolate each with M306L (ATG > CTG), M306I (ATG > ATC) and L402V (CTG > GTG), and one out of three isolates with M306I (ATG > ATA). However, 100 % of the isolates with E378A (GAG > GCG), M396V (ATG > GTG), or G406S
Appl Microbiol Biotechnol
(GGC > AGC) was EMB-susceptible, which accordingly were not tested with the OLE assay. KatG and inhA Twenty-two isolates displayed katG mutations with S315T (AGC > ACC), 21 of which were INHresistant. For the inhA gene, 8 isolates displayed the −15C > T mutation, 5 of which were INH-resistant.
Analysis of mutational sites in MTB-drug resistance genes by OLE assay The OLE method as described in Methods employed two separate OLE reactions for each PCR-product DNA template. Each reaction contained a TAMRA-dNTP complementary to either the wild-type or mutant base at the target site. When the extension primer undergoes chain extension to enable incorporation of the fluorescent TAMRA-dNTP complementary to the target site nucleotide, the identity of the target site nucleotide is thereby revealed (Fig. 1). The method is similar to that reported previously (Yu et al. 2006) except for replacement of the fluorescence-labeled ddNTP employed in that study by fluorescence-labeled dNTP in the present study. When the OLE method was used to analyze a target site for the S531L (TCG > TTG) mutation of rpoB gene on a DNA template in Fig. 2, the nucleotide residue at the target was dCMP in the wild-type and dTMP in the mutant. Therefore, the wild-type genotype would enable the incorporation of TAMRA-dCTP into the extension primer, whereas the mutant genotype would enable the incorporation of TAMRA-dTTP into the extension primer instead. Accordingly, when DNA templates prepared from MTB isolates were tested for the TTG mutation, one group yielded significant incorporation of TAMRA-dTMP, but not TAMRA-dCMP (cluster of triangles at left upper corner of graph); another group yielded significant incorporation of TAMRA-dCMP but not TAMRA-dTMP (cluster of circles at right lower corner of graph) and corresponded to the wild-type genotype. The same two-cluster distinction was likewise observed for the other targets sites in Fig. 2, in each case providing a clear-cut indication of the mutant or wildtype genotype at the target site examined. Upon comparison between the genotype of each target site determined by OLE and the genotype determined by direct DNA sequencing of PCR amplicons, 100 % agreement between the two sets of determinations was obtained for all of the 121 clinical samples. These results fully validated the accuracy of the OLE method for the high-throughput genotyping of drug resistant MTB mutation sites. Performance of OLE assay with the selected markers Table 3 shows the correlations obtained between genotypes at mutational sites and drug susceptibility/resistance phenotype.
Because the genotypes revealed by DNA sequencing and those revealed by OLE assay were identical for all the isolates, the numbers of mutation (N) scored by DNA sequencing in column 3 were identical to those scored by OLE assay in column 4 for all the mutations. As shown in Table 4, the correlations obtained for the 121 clinical samples yielded sensitivity and specificity values of respectively 83.9 % (95 % CI, 65.5–93.9 %, P
