© 1992 Oxford University Press
Human Molecular Genetics, Vol. 1, No. 2 143
A polymorphic dinucleotide repeat in intron 2 of the human cystatin-C gene D.Hughes, J.Brown, J.Hardy and M.-C.Chartier-Harlin Alzheimer's Disease Research Group, St Mary's Hospital Medical School, London W2 1PG, UK
Primer Sequences:
TGACCAGCCACATCTGAAAGGG (A strand). CACATGCACACGTACCCTGC (T strand). Allele Frequency: Estimated from 60 chromosomes of unrelated individuals. Allele size 130 128 126 124 PIC value = 0.64.
Frequency 0.172 0.406 0.406 0.016
Mendelian Inheritance: Co-dominant segregation has been observed in one extended reference pedigree. Chromosomal Localisation: The cystatin-C gene has been assigned to chromosome 20 based on cell hybrid studies: Three diallelic RFLPs have previously been reported at this locus (3). Linkage analysis using this repeat marker with the AC repeat from the cystatin-C pseudogene (4) in a reference pedigree showed a recombinant and a maximum lod score of 3.18 at theta = 0.11. Other Comments: PCR was performed as we have described previously with an annealing temperature of 55°C (5). The cystatin-C gene is the site of the mutation leading to Hereditary Cystatin-C Amyloid Angiopathy (HCCAA) in Iceland (1,3). Acknowledgement: This work was supported by Research into Ageing. References: 1) Abrahamson,M. et al. (1989) Hum. Genet. 82, 223-226. 2) Weber,J.L. and May.P.E. (1989) Am. J. Hum. Genet. 44, 388-396. 3) Palsdottir.A. etal. (1990) Nucleic Acids Res. 18, 7471. 4) Polymeropoulos,M.H. etal. (1991) Nucleic Acids Res. 19, 1164. 5) Chartier-Harlin.M.C. et al. (1991) Nature 353, 844-846.
Downloaded from http://hmg.oxfordjournals.org/ at The University of British Colombia Library on June 21, 2015
Source/Description: The polymorphic (AC)n repeat is within intron 2 of the cystatin-C gene on human chromosome 20 (1). The polymorphism can be typed using amplification by PCR as described previously (2). The predicted length of the amplified sequence was 126bp.
Human Molecular Genetics, Vol. 1, No. 2 143
A polymorphic dinucleotide repeat in intron 2 of the human cystatin-C gene D.Hughes, J.Brown, J.Hardy and M.-C.Chartier-Harlin Alzheimer's Disease Research Group, St Mary's Hospital Medical School, London W2 1PG, UK
Primer Sequences:
TGACCAGCCACATCTGAAAGGG (A strand). CACATGCACACGTACCCTGC (T strand). Allele Frequency: Estimated from 60 chromosomes of unrelated individuals. Allele size 130 128 126 124 PIC value = 0.64.
Frequency 0.172 0.406 0.406 0.016
Mendelian Inheritance: Co-dominant segregation has been observed in one extended reference pedigree. Chromosomal Localisation: The cystatin-C gene has been assigned to chromosome 20 based on cell hybrid studies: Three diallelic RFLPs have previously been reported at this locus (3). Linkage analysis using this repeat marker with the AC repeat from the cystatin-C pseudogene (4) in a reference pedigree showed a recombinant and a maximum lod score of 3.18 at theta = 0.11. Other Comments: PCR was performed as we have described previously with an annealing temperature of 55°C (5). The cystatin-C gene is the site of the mutation leading to Hereditary Cystatin-C Amyloid Angiopathy (HCCAA) in Iceland (1,3). Acknowledgement: This work was supported by Research into Ageing. References: 1) Abrahamson,M. et al. (1989) Hum. Genet. 82, 223-226. 2) Weber,J.L. and May.P.E. (1989) Am. J. Hum. Genet. 44, 388-396. 3) Palsdottir.A. etal. (1990) Nucleic Acids Res. 18, 7471. 4) Polymeropoulos,M.H. etal. (1991) Nucleic Acids Res. 19, 1164. 5) Chartier-Harlin.M.C. et al. (1991) Nature 353, 844-846.
Downloaded from http://hmg.oxfordjournals.org/ at The University of British Colombia Library on June 21, 2015
Source/Description: The polymorphic (AC)n repeat is within intron 2 of the cystatin-C gene on human chromosome 20 (1). The polymorphism can be typed using amplification by PCR as described previously (2). The predicted length of the amplified sequence was 126bp.
