A polymorphic dinucleotide repeat in intron 2 of the human cystatin-C gene D.Hughes, J.Brown, J.Hardy and M.-C.Chartier-Harlin Alzheimer's Disease Research Group, St Mary's Hospital Medical School, London W2 1PG, UK
Primer Sequences:
TGACCAGCCACATCTGAAAGGG (A strand). CACATGCACACGTACCCTGC (T strand). Allele Frequency: Estimated from 60 chromosomes of unrelated individuals. Allele size 130 128 126 124 PIC value = 0.64.
Frequency 0.172 0.406 0.406 0.016
Mendelian Inheritance: Co-dominant segregation has been observed in one extended reference pedigree. Chromosomal Localisation: The cystatin-C gene has been assigned to chromosome 20 based on cell hybrid studies: Three diallelic RFLPs have previously been reported at this locus (3). Linkage analysis using this repeat marker with the AC repeat from the cystatin-C pseudogene (4) in a reference pedigree showed a recombinant and a maximum lod score of 3.18 at theta = 0.11. Other Comments: PCR was performed as we have described previously with an annealing temperature of 55°C (5). The cystatin-C gene is the site of the mutation leading to Hereditary Cystatin-C Amyloid Angiopathy (HCCAA) in Iceland (1,3). Acknowledgement: This work was supported by Research into Ageing. References: 1) Abrahamson,M. et al. (1989) Hum. Genet. 82, 223-226. 2) Weber,J.L. and May.P.E. (1989) Am. J. Hum. Genet. 44, 388-396. 3) Palsdottir.A. etal. (1990) Nucleic Acids Res. 18, 7471. 4) Polymeropoulos,M.H. etal. (1991) Nucleic Acids Res. 19, 1164. 5) Chartier-Harlin.M.C. et al. (1991) Nature 353, 844-846.
Downloaded from http://hmg.oxfordjournals.org/ at The University of British Colombia Library on June 21, 2015
Source/Description: The polymorphic (AC)n repeat is within intron 2 of the cystatin-C gene on human chromosome 20 (1). The polymorphism can be typed using amplification by PCR as described previously (2). The predicted length of the amplified sequence was 126bp.