Accepted Manuscript A novel sgRNA selection system for CRISPR-Cas9 in mammalian cells Haiwei Zhang, Xixi Zhang, Cunxian Fan, Qun Xie, Chengxian Xu, Qun Zhao, Yongbo Liu, Xiaoxia Wu, Haibing Zhang PII:

S0006-291X(16)30230-3

DOI:

10.1016/j.bbrc.2016.02.041

Reference:

YBBRC 35344

To appear in:

Biochemical and Biophysical Research Communications

Received Date: 26 January 2016 Accepted Date: 11 February 2016

Please cite this article as: H. Zhang, X. Zhang, C. Fan, Q. Xie, C. Xu, Qun Zhao, Y. Liu, X. Wu, H. Zhang, A novel sgRNA selection system for CRISPR-Cas9 in mammalian cells, Biochemical and Biophysical Research Communications (2016), doi: 10.1016/j.bbrc.2016.02.041. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Title: A novel sgRNA selection system for CRISPR-Cas9 in mammalian cells Haiwei Zhang1, Xixi Zhang1, Cunxian Fan1, Qun Xie1,2, Chengxian Xu1，Qun Zhao1, Yongbo Liu1, Xiaoxia Wu1, Haibing Zhang1

Affiliations: 1

Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences,

Shanghai Institutes for Biological Sciences, Graduate School of the Chinese Academy of Sciences, Chinese Academy of Sciences, Shanghai 200031, China. 2

Department of Anesthesiology, Changhai Hospital, Second Military Medical University, Shanghai 200433, China. Corresponding authors: Haibing Zhang, [email protected]

ACCEPTED MANUSCRIPT Abstract CRISPR-Cas9 mediated genome editing system has been developed as a powerful tool for elucidating the function of genes through genetic engineering in multiple cells and organisms. This system takes advantage of a single guide RNA (sgRNA) to direct the Cas9 endonuclease to a specific DNA site to generate mutant alleles. Since the targeting efficiency of sgRNAs to distinct DNA loci can vary widely, there remains a need for a rapid, simple and efficient sgRNA selection method to overcome this limitation of the CRISPR-Cas9 system. Here we report a novel system to select sgRNA with high efficacy for DNA sequence modification by a luciferase assay. Using this sgRNAs selection system, we further demonstrated successful examples of one sgRNA for generating one gene knockout cell lines where the targeted genes are shown to be functionally defective. This system provides a potential application to optimize the sgRNAs in different species and to generate a powerful CRISPR-Cas9 genome-wide screening system with minimum amounts of sgRNAs.

Keywords: CRISPR/Cas9, sgRNA selection, gene knockout, necroptosis, cell death

ACCEPTED MANUSCRIPT 1. Introduction The type II bacterial clustered, regularly interspaced, palindromic repeats-associated (CRISPR-Cas9) system has been engineered as a powerful genome editing tool consisting of the Cas9 nuclease and a single guide RNA (sgRNA) [1,2,3,4]. The Cas9 protein can be guided to a target genomic DNA sequence by an engineered sgRNA through base-pair complementarities, where it functions as an endonuclease to modify the genome. In general the target site must include a 5′-NGG-3′ protospacer-adjacent motif (PAM) and a 20-nucleotide sequence complementary to the sgRNA to mediate Cas9 cleavage. Double-stranded DNA breaks generated by Cas9 at targeting loci are repaired by nonhomologous end-joining (NHEJ) or homology-directed repair (HDR). CRISPR-Cas9 genome editing has been applied to site-specific genome modification in a variety of organisms [5,6,7,8,9,10]. Since Cas9 has no DNA recognition specificity, the target specificity of Cas9 nuclease is determined by a 20-base pair sequence at the 5’-end of the sgRNA [11,12,13,14]. The loss of function allele is produced by the introduction of indel mutations in the coding region to generate frame shifts. Although the simple guided programmable rule of sgRNA and the high occurrence of PAM in genomes allowed Cas9-sgRNA to readily target almost all genetic loci for genome modifications, the efficacy of different sgRNAs vary widely and high proportions of sgRNAs may not work for reasons yet unknown [15,16]. To effectively knock out a particular gene, two or more sgRNAs are designed to target different loci of this gene [17,18]. In practice, the knock out efficiency of individual sgRNAs designed by software cannot be ensured. Moreover, for some proteins without antibodies available, the knockout verification procedures through cell cloning and sequencing could be costly and laborious. In this study, we designed and established a sgRNA selection system to improve the efficiency of the current CRISPR/Cas9 system. To test this system, we found that the selected sgRNAs using our sgRNA selection system exhibited much higher genome modification activity than that other sgRNA. We further demonstrated that the sgRNA selected by our sgRNA selection system also showed the same effective in CRIPSR-Cas9 lentivirus system. Collectively, our sgRNA selection system provides a

ACCEPTED MANUSCRIPT significant improvement for the current CRISPR/Cas9 system (Fig. 1).

2. Materials and methods 2.1. Reagents and antibody The regents and compounds used were hTNF-α (Biosource), mTNF-α (R&D), zVAD (Cayman), Smac mimetic (Sigma), Nec-1 (Enzo), Staurosporine (Selleck), puromycin (Sigma). The following antibody were used: anti-FLAG (Sigma), anti-HA (CST), anti-β actin (Sigma), anti-human Caspase3 (CST), anti-RIP1 (BD Pharmingen), anti-MLKL (Proteintech), anti-pMLKL (Abcam), anti-mouse RIP3 (ProSci).

2.2. Construction of vectors mCherry-T2A-pac were cloned using Gibson assemble methods into pmcherry-C1 (Clontech) to construct the MP plasmid. pX330 (Addgene) were linearized with Not I (Fermentas), CMV- mcherry-T2A-pac (MP) were amplified and cloned into pX330 to construct the pX330-MP plasmid. The design of sgRNAs was based on recommendation on the Zhang laboratory website (http://crispr.mit.edu/). To construct the sgRNA expression plasmid, complementary oligonucleotides encoding gRNAs were annealed and cloned into Bbs I (Fermentas) sites in pX330-MP or BsmB I (Fermentas) sites in lentiCRISPRv2 (Addgene).

2.3. Mammalian cell culture and transfection HT29 cells, HEK 293T cells and L929 cells were maintained in high glucose Dulbecco’s Modified Eagle’s Medium (Invitrogen) supplemented with 10% FBS (Invitrogen) and 100 units penicillin/streptomycin (Invitrogen). Cells were maintained at 37℃ and 5% CO₂ in a humidified incubator and tested for mycoplasma yearly. HEK 293T cells were transfected in 12-wells plates seeded with 100,000 cells per wells. 1 μg of pX330-MP-gRNA construct were delivered to each well with lipofectamine 2000 according to manufacturer’s instructions. Cells were grown 24 hours after transfection before being treated with 2 μg/ml puromycin. 4 days later, cells were harvested for WB assay.

ACCEPTED MANUSCRIPT

2.4. Lentivirus production Lentiviral particles were generated by transfection HEK 293T cells with lentiCRISPRv2-gRNA construct psPAX2 and pMD2.G (Addgene) at a ratio of 4:3:1, respectively. Viral supernatants were collected 48-72 hours following transfection and concentrated using the centrifugal filter (Merck Millipore) according to the manufacturer’s protocol.

2.5. Lentiviral transduction L929 cells and HT29 cells were seeded at ~40% confluency, cells were transduced with lentivirus via spinfection in 12-wells plates. 24 hours after spinfection, cells were detached with TrypLE (Invitrogen) and replated at low density and selection agent were added 3 hours after plating. L929 cells and HT29 cells were treated with 5 μg/ml puromycin (Sigma). Media were refreshed next day and cells were passaged every other day. 4 days later, cells were harvested for WB assay.

2.6. Cell survival assay Cell survival analysis was performed using the Cell Titer-Glo Luminescent Cell Viability Assay kit (Promega) following manufactory instruction. In brief, 20 μl of Cell Titer-Glo reagent was added to the cell culture medium. Cells were place on shaker for 10 min and were then incubated at room temperature for an additional 10 min. luminescent reading was carried on Glomax luminometer (Promega).

2.7. Luciferase reporter assay HEK 293T were transfected with target gene genome mimic luciferase reporter construct together with lentiCRISPRv2-gRNA or pX330-MP-gRNA construct. 24 hours later, cells were treated with 2 μg/ml puromycin. Cells were harvested after 48 hours culture in puromycin selection medium using Duo-Glo Luciferase Assay System (Promega) following manufactory instruction.

ACCEPTED MANUSCRIPT 3. Results 3.1. Transfection method for gene knockout using all-in-one system To establish an effective CRISPR/Cas9 system, we engineered the pX330 vector originally developed by the Feng Zhang’s lab [1] to a novel vector pX330-MP, which contain a sgRNA expression cassette, a Cas9 nuclease expression cassette and a cleavable mCherry-T2A-Puro (MP) to allow selection of the transfected cells (Fig. S1). As an initial test, we individually transfected HEK293T cells with plasmids pX330, pX330-MP or the mixture of MP/ pX330. After 24 hours, the transfection efficiencies are indicated by the fractions of red fluorescencent cells in individual experiments. After 2 days treatment with puromycin, all cells showed red fluorescene signals (Fig. S2A) and expressed the proteins as expected (Fig. S2B). To test the functionality of pX330-MP, we designed two sgRNAs targeting human caspase 3 gene (Fig. 2A), which is required for staurosporine (Sta) induced apoptosis [19]. The constructed pX330-MP containing sgRNAs were transfected into HEK293T cells and the genome editing efficiencies were verified using Western-Blots. The results indicated that the caspase 3 expression targeted by gRNA-2 was almost diminished while the gRNA-1 had little effect (Fig. 2B). Consistently, the cells targeted by gRNA-2 were much more resistant to the apoptosis induced by staurosporine than those transfected with pX330-MP without sgRNA or naive cells (Fig. 2B and 2C). To further validate the different efficacies of various sgRNAs targeting to the same gene, we next tested two sgRNAs targeting RIP1 gene which mediated necroptosis. After 4 days treatment with puromycin, the efficiency of two sgRNAs targeting RIP1, as determined by Western-Blots, varied widely (Fig. S4B). Although these results demonstrated the usefulness of the pX330-MP as the all-in-one vector in generating gene knock out cell lines, the differential efficacy of various sgRNAs remains a challenge for CRISPR/Cas9 applications.

3.2. Create a sgRNA selection system for sgRNA efficiency measure To create a sgRNA selection system, a genomic fragment containing the target DNA sequence was fused in frame with an eGFP and a firefly luciferase (FLuc) fragments to

ACCEPTED MANUSCRIPT make a green fluorescent protein reporter plasmid pCAG-target-eGFP-Fluc (Fig. 3A). When HEK293T cells are co-transfected with plasmid pCAG-target-eGFP-Fluc and pX330-MP, the sgRNA can direct the Cas9 nuclease to the target sequence site to make DNA modifications, which lead to reductions of the fused eGFP and FLuc protein as visualized for the green fluorescence (Fig. 3B and Fig. S3) and quantified by luciferase activity assay, respectively (Fig. 3C). Ordered to verify the applicability of our system for sgRNA selection, we co-transfected the pX330-MP-sgRNAs of mouse RIP1 (Fig. 4A) and pCAG-eGFP-FLuc containing the target mouse RIP1 sequence into HEK293T cells. Taking advantage of this dual fluorescence assay system, the eGFP fluorescence knockdown was examined 72hr after transfection under microscope and luciferase assay revealed that the gRNA2 has higher efficiency in genome modification than that of gRNA1 (Fig. 4B). Further fluorescence intensity assay also showed that a significantly lower expression of eGFP in gRNA2 expressing cells compared to gRNA1 or no sgRNA (Fig. 4C).

3.3. Selected high-efficiency sgRNA mediate gene knockout in lentivirus system To verify if the sgRNA selected through our selection system could be efficiently used in the lentiCRISPR system [20], we first determined the effects of lentiCRISPR with gRNA2 of RIP1 in mouse L929 cells. After transduction at a low multiplicity of infection (MOI) followed by selection with puromycin for 4 days, RIP1 expression level in the cells transduced with sgRNA2 of lentiCRISPR is significantly reduced comparing to that of eGFP (Fig. 4D). The RIP1 knock out effect was further validated by the cell viability assay after the necroptosis induction in L929 cells. As shown in Figure 4E, The RIP1 knock out cells appeared to be significantly resistant to the necroptosis induced by TNF-α/ z-VAD [21] and similar to the cells co-incubated with Nec-1, an inhibitor of RIP1 kinase [22]. The effect was further confirmed by using the same process and successfully generated RIP1 knockout cells in the human cell line HT29 (Fig. S5A). Necroptosis progression is blocked in the RIP1 knockout HT29 cells when they were treated with TNF-α/ Smac/ z-VAD (Fig. S5B). Furthermore, T357 and S358 of MLKL are known to be phosphorylated during necroptosis [23] and there

ACCEPTED MANUSCRIPT modifications are significantly reduced in the RIP1 knockout HT 29 cells (Fig. S5C). Overall, these data suggested that the sgRNA selected by our system is compatible with the lentiCRISPR utilization. 4. Discussion In summary, genetic modification based on CRISPR-Cas9 system relies on the efficacy of sgRNAs to direct the Cas9 nuclease to a specific site, and we provided a simple and efficient strategy for sgRNA selection. The first application of our system is to determine the effectiveness of a sgRNA using transfection method in HEK293T cells before the lentiCRISPR application. The sgRNAs selected by our system were further proved to be effective in generating knockout cell lines via the lentiCRISPR vector system. This gRNA selection system could especially be helpful to reduce time and cost for the experiments where the CRISPR system would be applied into animal embryos. The second, we could minimize the amount of sgRNAs in genome-scale sgRNA libraries, which consist of 6 or more sgRNAs targeting each gene to ensure effective coverage of these libraries [20,24]. Our sgRNA selection system could also be adapted to other species, since we have demonstrated that sgRNAs selected by this system can be applied in mouse and human cells. As the simple and rapid luciferase assay allows our sgRNA selection system to be applied to such a broad range of applications, we believed that our report provides substantial contributions to researchers interested in improving editing capability and efficacy of Cas9/CRISPR application.

References

[1] L. Cong, F.A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P.D. Hsu, X. Wu, W. Jiang, L.A. Marraffini, F. Zhang, Multiplex genome engineering using CRISPR/Cas systems, Science 339 (2013) 819-823. [2] P. Mali, L. Yang, K.M. Esvelt, J. Aach, M. Guell, J.E. DiCarlo, J.E. Norville, G.M. Church, RNA-guided human genome engineering via Cas9, Science 339 (2013) 823-826. [3] P. Horvath, R. Barrangou, CRISPR/Cas, the immune system of bacteria and archaea, Science 327 (2010) 167-170.

ACCEPTED MANUSCRIPT [4] S.W. Cho, S. Kim, J.M. Kim, J.S. Kim, Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease, Nat Biotechnol 31 (2013) 230-232. [5] H. Yin, W. Xue, S. Chen, R.L. Bogorad, E. Benedetti, M. Grompe, V. Koteliansky, P.A. Sharp, T. Jacks, D.G. Anderson, Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype, Nat Biotechnol 32 (2014) 551-553. [6] H. Zhang, J. Zhang, P. Wei, B. Zhang, F. Gou, Z. Feng, Y. Mao, L. Yang, H. Zhang, N. Xu, J.K. Zhu, The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation, Plant Biotechnol J 12 (2014) 797-807. [7] F. Gonzalez, Z. Zhu, Z.D. Shi, K. Lelli, N. Verma, Q.V. Li, D. Huangfu, An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells, Cell Stem Cell 15 (2014) 215-226. [8] J.E. Garneau, M.E. Dupuis, M. Villion, D.A. Romero, R. Barrangou, P. Boyaval, C. Fremaux, P. Horvath, A.H. Magadan, S. Moineau, The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA, Nature 468 (2010) 67-71. [9] J.C. Wagner, R.J. Platt, S.J. Goldfless, F. Zhang, J.C. Niles, Efficient CRISPR-Cas9-mediated genome editing in Plasmodium falciparum, Nat Methods 11 (2014) 915-918. [10] W.Y. Hwang, Y. Fu, D. Reyon, M.L. Maeder, S.Q. Tsai, J.D. Sander, R.T. Peterson, J.R. Yeh, J.K. Joung, Efficient genome editing in zebrafish using a CRISPR-Cas system, Nat Biotechnol 31 (2013) 227-229. [11] F.J. Mojica, C. Diez-Villasenor, J. Garcia-Martinez, C. Almendros, Short motif sequences determine the targets of the prokaryotic CRISPR defence system, Microbiology 155 (2009) 733-740. [12] S.A. Shah, S. Erdmann, F.J. Mojica, R.A. Garrett, Protospacer recognition motifs: mixed identities and functional diversity, RNA Biol 10 (2013) 891-899. [13] M. Jinek, K. Chylinski, I. Fonfara, M. Hauer, J.A. Doudna, E. Charpentier, A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity, Science 337 (2012) 816-821. [14] S.H. Sternberg, S. Redding, M. Jinek, E.C. Greene, J.A. Doudna, DNA interrogation by the CRISPR RNA-guided endonuclease Cas9, Nature 507 (2014) 62-67. [15] M. Jinek, A. East, A. Cheng, S. Lin, E. Ma, J. Doudna, RNA-programmed genome editing in human cells, Elife 2 (2013) e00471. [16] J.S. Lee, T.B. Kallehauge, L.E. Pedersen, H.F. Kildegaard, Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway, Sci Rep 5 (2015) 8572. [17] Y. Zhou, S. Zhu, C. Cai, P. Yuan, C. Li, Y. Huang, W. Wei, High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells, Nature 509 (2014) 487-491. [18] O. Shalem, N.E. Sanjana, E. Hartenian, X. Shi, D.A. Scott, T.S. Mikkelsen, D. Heckl, B.L. Ebert, D.E. Root, J.G. Doench, F. Zhang, Genome-scale CRISPR-Cas9 knockout screening in human cells, Science 343 (2014) 84-87.

ACCEPTED MANUSCRIPT [19] U.K. Wiegand, S. Corbach, A.R. Prescott, J. Savill, B.A. Spruce, The trigger to cell death determines the efficiency with which dying cells are cleared by neighbours, Cell Death Differ 8 (2001) 734-746. [20] N.E. Sanjana, O. Shalem, F. Zhang, Improved vectors and genome-wide libraries for CRISPR screening, Nat Methods 11 (2014) 783-784. [21] D.W. Zhang, J. Shao, J. Lin, N. Zhang, B.J. Lu, S.C. Lin, M.Q. Dong, J. Han, RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis, Science 325 (2009) 332-336. [22] A. Degterev, J.L. Maki, J. Yuan, Activity and specificity of necrostatin-1, small-molecule inhibitor of RIP1 kinase, Cell Death Differ 20 (2013) 366. [23] H. Wang, L. Sun, L. Su, J. Rizo, L. Liu, L.F. Wang, F.S. Wang, X. Wang, Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3, Mol Cell 54 (2014) 133-146. [24] H. Ma, Y. Dang, Y. Wu, G. Jia, E. Anaya, J. Zhang, S. Abraham, J.G. Choi, G. Shi, L. Qi, N. Manjunath, H. Wu, A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death, Cell Rep 12 (2015) 673-683.

End notes Supplementary information includes 4 figures Acknowledgement We thank Dr. Yu Sun for insightful discussions and critical reading of the manuscript, and Dr. Qiurong Ding for advice and technical assistance. This study was supported by Thousand Young Talents Program of the Chinese government. Author information The authors declare no competing financial interests. Correspondence and requests for materials should be addressed to H.Z ([email protected]).

Figure legends Figure 1. Overview of the CRISPR/Cas9 transfection and lentiviral method to generate gene knockout cells. Generally, it takes long time to perform a genome

ACCEPTED MANUSCRIPT modification using CRISPR/Cas9 when the sgRNA efficiency cannot be defined as the black line shows. In this study, we generate a sgRNA selection system and measure the sgRNA activity before we apply it to generate gene knockout cells. To take advantage of this sgRNA selection system, we can select a high efficiency sgRNA to generate a gene knock out cells within 2-3 weeks without single cell clone culture as the red line show. T7 endonuclease I (T7E1).

Figure 2. Two gRNAs have different efficacies for knocking out Caspase 3 gene in HEK293T cells using the all-in-one transfection system. (A) Illustration of the two gRNA target sites in the genomic Casp3 locus. The 20nt target sequences corresponding to each target sites are shown in red. The neighboring NGG protospacer adjacent motif (PAM)s are shown in blue. (B) WB analysis of Casp3 expression in puromycin resistant HEK293T cells. HEK293T cells transfected with empty vector (EV) or two different sgRNA (g1, g2) were treated with 2μg/ml puromycin for 4 days. Caspase 3 protein levels were analyzed by western blot from the 20ug cell lysates loaded for each sample. Anti-β actin was used as a loading control. (C) Cell viability assay after the apoptosis induction. Naive, no gRNA pX330-MP (EV) transfected and g2-pX330-MP transfected HEK293T cells were treated with DMSO or 1μM Staurosporine (Sta) for 24 hours. Cell survival rate was determined by measuring ATP levels using Cell Titer-glo kit. Data are represented as mean ± standard deviation of duplicates.

ACCEPTED MANUSCRIPT Figure 3. The sgRNA selection system is based on the CRISPR-Cas9 knock out effect leading to the reduction of the fused GFP flourescence and luciferase activity. (A) Schematic presentation of the genome mimic reporter for the sgRNA selection. The reporter has a genomic DNA fragment of the target gene containing the start condon ATG, the eGFP fragment and the luciferase fragment. All three fragments are fused in frame and driven by the CMV promoter. Effective gRNA binding would lead to the recruitment of the endonuclease Cas9. Frame shift mutations created by the enzyme would eventually lead to defective expressions of the eGFP protein and the Luciferase protein. (B) The activity of gRNA mediated target gene (TG) mimic genome modify can measured by the fluorescence intensity for the functional eGFP protein level. Scale bar, 50 μm. (C) The functional luciferase production measured by Luciferase activity was determined from cell lysates. Relative light unit (RLU). Data are represented as mean ± standard deviation of duplicates.

Figure 4. In the mimic reporter system, gRNA1 is more effective than gRNA2 for knocking out mouse RIP1 gene in the HEK293T cells, in lentivirus system gRNA1 is effective for knocking out mouse RIP1 gene in the mouse L929 cells.

(A)

Illustration of the two gRNA target sites in the mouse genomic RIP1 locus. The 20nt target sequences corresponding to each target site are shown with underline. The neighboring NGG protospacer adjacent motif (PAM)s are shown in red. (B) The gmRIP1-2 showed lower relative light unit (RLU) than that of gmRIP1-1 in Luciferase activity assay. Data are represented as mean ± standard deviation of duplicates. (C).

ACCEPTED MANUSCRIPT gmRIP1-2 showed lower fluorescence intensity for the functional eGFP protein level than that of gmRIP1-1. Scale bar, 50 μm. (D) RIP1 expression levels were significantly reduced after the infections with the gRIP1 lentivirus. L929 cells were infected lentivirus with different MOI (4, 2, 1, 0.5) and then treated with puromycin for 4 days. 40μg Cell lysates were subjected to WB analysis of RIP1, RIP3 and β actin levels. Cells infected with gGFP lentivirus with the same MOIs and naive cell (N) were used as negative controls. (E) RIP1 knock out mediated by gRNA1 lentivirus is resistant to necrosis cell death induced by TZ treatment. L929 cells infected with gGFP or gRIP1 were treated with DMSO (Ctrl), mTNF-α (20 ng/ml) / z-VAD (20 μM)/ Necrostatin-1 (30 μM) for 16 hours. Cell viability was determined by measuring ATP levels using Cell Titer-glo kit. Data are represented as mean ± standard deviation of duplicates.

Figure S1. Overview of the all-in-one transfection system for gene knockout in mammalian cells. (A) In a transfection experiment, the transfection efficiency is directly indicated by the red flourescence from mCherry and the non-transfected naive cells will be eliminated by the subsequent puromycin treatment. Ultimately the resistant cells will be tested for the knock out efficiency on the gene of interest (GI). (B) A schematic map shows the construction of the all-in-one CRISPR-Cas9 plasmid to express gRNA, hSpCas9, mcherry and puromycin resistant proteins simultaneously. The T2A peptide can mediate the cleavage between the mCherry protein and the puromycin resistant protein.

ACCEPTED MANUSCRIPT

Figure S2. The all-in-one plasmid can be effectively used for the transfection of HEK293T cells. (A) Microscopy of the transfected cells. 24 hours after 1μg plasmid DNA transfection, bright signals (BL) shown the cellular proliferation, red signals (RL) indicate the transfection efficiency. Then 2μg/ml puromycin treated the cells for 2 days can killed all the naive cells. Scale bar, 50 μm. (B) WB analysis of plasmids expression in HEK293T cells. The transfected cells were processed for WB 24 hours post-transfection. Anti-flag indicate the hSpCas9 protein level. Anti-HA show the puromycin resistance protein pac (~25 KDa) fusion with mCherry with T2A peptide and cleaved into two parts. Anti-β actin was used as a loading control. The asterisk denotes non-specific bands. Figure S3. Time course of gGFP mediated CRISPR-Cas9 knock out effect leading to the reduction of the GFP fluorescence. HEK293T cells transfected with 1μg pEGFP plasmid combined with 0.5/1.0/1.5μg gGFP-pX330-MP or 1.5μg pX330-MP without sgRNA (EV). 24 hours after transfection 2μg/ml puromycin treated cells for 24hr (48hr AT) or 48hr (72hr AT) the activity of gGFP mediated GFP modify can measured by the fluorescence intensity for the functional eGFP protein level. After transfection (AT). Scale bar, 50 μm. Figure S4. Using all-in-one transfection system, human RIP1 gene can be effectively knocked out in HEK293T cells. (A) Illustration of two gRNA target genomic sites in RIP1 locus. The 20nt target sequence corresponding to each target site is indicated in red, along with the neighboring NGG protospacer adjacent motif (PAM) in blue. (B)

ACCEPTED MANUSCRIPT WB analysis of RIP1 expression in HEK293T cells after transfection sgRNA using all-in-one plasmid. HEK293T cells transfected with no sgRNA plasmid (EV) or two different sgRNA (g1 and g2) using pX330-MP. 24 hours after transfection 2μg/ml puromycin treated cells for 4 days. 20ug cell lysates loaded for WB analysis the RIP1 protein level. Anti-β actin was used as a loading control.

Figure S5. Using the lentiCRISPRv2 system, gRNA1 is effective for knocking out human RIP1 gene in the human HT29 cells. (A) RIP1 expression level was deduced by gRIP1 lentivirus. HT29 cells were infected with lentivirus, treated with puromycin for 4 days. 40μg Cell lysates were subjected to WB analysis of RIP1 and β actin levels, gGFP was used as negative control. (B) Effects of RIP1 deficiency on necrosis cell death induced by TSZ treatment. HT29 cells infected with gGFP or gRIP1 were treated with DMSO (Ctrl), TNF-α (20 ng/ml)/ Smac mimetic (100 nM)/ z-VAD (20 μM)/ Necrostatin-1 (30 μM) for 24 hours. Cell viability was determined by measuring ATP levels using Cell Titer-glo kit. Data are represented as mean ± standard deviation of duplicates. (C) Knocking down of RIP1 expression blocks MLKL phosphorylation. HT29-gGFP/ HT29-gRIP1 cells were treated with the TSZ for 8 hours or 12 hours. The aliquots of whole-cell extracts were analyzed by WB using antibodies as indicated (upper panel).

ACCEPTED MANUSCRIPT

Figure 1 Plasmid construction

0

Gene function assay

100

9

8

4

Single cell clone

T7E1 assay

Cell transfection

days

Plasmid Cell transfection Positive cells selection Gene function assay and sub-culture construction and assay Transfection method

0

4

Lentivirus producing

Plasmid construction

0

12 days

6 Cell infection and selection

15

8

4

Cell infection and selection

Plasmid Cell transfection Lentivirus construction and assay producing

Single cell clone

T7E1 assay

Gene function assay

120

16 Gene function assay

non-efficacy sgRNA efficacy sgRNA Lentivirus infection method

0

4

6

10

16

days

days

ACCEPTED MANUSCRIPT

Figure 2

hCasp3

CCATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCAT Exon1 TAAAAATTTGGAACCGTGAGTATTTAAATTGAATTCTTTA

g1

AAAGATCATACATGGAAGCGAATCAATGGACTCTGGAATAT CCCTGGACAACAGTTATAAAATGGATTATCCTGAGATGGGTT TATGTATAATAATTAATAA

g2

Exon2

B Anti-Casp3 Anti-βactin

Naive EV g1 g2 C

Cell survival %

A

110%

Naive

EV

90% 70% 50% 30%

Ctrl

Sta

g2

ACCEPTED MANUSCRIPT

Figure 3

A




Cas9 GFP

ATG-NNNNNN-

CMV

Luciferase

efficiency sgRNA

weak sgRNA

frame shift

inframe

Luc

GFP

B

0.5ug

1.0ug

GFP

1.5ug

Luc

C 120%

RLU

EV

EV

90% 60% 30%

gGFP 0%

0.5µg

1µg

1.5µg

gGFP

ACCEPTED MANUSCRIPT

Figure 4 gGFP

A

B

mRIP1 exon AAAATGCAACCAGACATGTCCTTGGACAATA TTAAGATGGCATCCAGTGACCTGCTGGAGAA g1 GACAGACCTAGACAGCGGAGGCTTCGGGAA g2 GGTGTCCTTGTGTTACCACAGAAGCCATGG

N

D

Anti-RIP3

Anti-βactin

40%

E

0% EV

gmRIP1-1

gmRIP1-1

gmRIP1-2

gmRIP1-2

120%

Cell survival %

RLU

moi 4 moi 2 moi 1 moi 0.5

Anti-RIP1 lo exp

80%

EV

N

Anti-RIP1 hi exp

120%

C

moi 4 moi 2 moi 1 moi 0.5

gRIP1

80% 40% 0%

ACCEPTED MANUSCRIPT

Figure S1

A

transfection

1 day

naive cell

B

+Puro proliferation

+Puro

4 days

2 days

Cas9+& sgRNA+& Puro+

Cas9+& sgRNA+& Puro+& GI KO

T2A CMV

sgRNA

NLS CBh

U6

sgRNA U6

Puro

mcherry

MP NLS

hSpCas9

NLS CBh

SVpA

bGHpA

pX330 T2A

NLS hSpCas9

bGHpA

SVpA

Puro

mcherry

CMV

pX330-MP

ACCEPTED MANUSCRIPT

Figure S2

MP

A

pX330

MP+pX330

pX330-MP

Naive

B MP

-Puro Anti-flag hSpCas9

BL

+Puro Anti-HA Puro

-Puro RL

Anti-βactin

+Puro

ACCEPTED MANUSCRIPT

Figure S3

1.5ug

0.5ug

1ug

48hr AT

72hr AT

No gRNA

gGFP

1.5ug

ACCEPTED MANUSCRIPT

Figure S4

A hRIP1 exon ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCA GTGACTTCCTGGAGAGTGCAGAACTGGACAGCGGAGGCTTTG g2 GGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGACTCATGAT g1 CATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGT

B

EV

g1

g2

Anti-RIP1

Anti-βactin

ACCEPTED MANUSCRIPT

Figure S5

A

gGFP

gRIP1

Anti-RIP1

C

gGFP TSZ

Anti-βactin

pMLKL hi exp

B 120%

Cell survival %

gGFP

gRIP1

pMLKL lo exp

80%

MLKL 40%

β-actin

0%

Ctrl

TSZ

TSZN

Oh

8h

gRIP1 12h

Oh

8h

12h