J Mol Neurosci DOI 10.1007/s12031-013-0147-9
A Novel Risk Haplotype of ALOX5AP Gene is Associated with Ischemic Stroke in Chinese Han Population Dongzhi Yang & Ying He & Manyu Li & Congcong Shi & Guoying Song & Qing Wang & Yujia Fan & Qingchuan Feng & Hong Zheng
Received: 26 August 2013 / Accepted: 9 October 2013 # Springer Science+Business Media New York 2013
Abstract Previous studies have implicated that two atrisk haplotypes (HapA and HapB) of gene-encoding 5-lipoxygenase-activating protein (ALOX5AP) were significantly associated with stroke. The aim of this study was to explore the association between haplotypes of ALOX5AP gene and risk for ischemic stroke (IS) in Chinese Han population. A total of 492 patients with IS and 490 matched control subjects were recruited. Six ALOX5AP SNPs (SG13S377, SG13S114, SG13S41, SG13S89, SG13S32 and SG13S35) were genotyped by SNaPshot minisequence technique. A common genetic variant SG13S114/AA in the ALOX5AP gene was associated with IS in this Chinese cohort (OR=2.514, 95 % CI=1.667~ 3.790). HapA (TGA) and HapB (AAAG) had no significant difference in the patients (36.3 and 18.5 %, respectively) and controls (37.6 and 16.3 %, respectively) (P =0.631 and P =0.375, respectively). But, the frequency of Hap (GAAG) was significantly higher in the patients than that in the controls after Bonferroni's adjustment (P = 0.006). To conclude, SG13S114/AA of the ALOX5AP gene was associated with an increased risk for IS. A novel risk haplotype, Hap (GAAG) was a genetic risk factor for IS in this Chinese population. Keywords ALOX5AP . Haplotype . Ischemic stroke . Polymorphism
D. Yang Department of Bioengineering, Zhengzhou University, Zhengzhou, 450052, China Y. He (*) : M. Li : C. Shi : G. Song : Q. Wang : Y. Fan : Q. Feng : H. Zheng (*) Department of Medical Genetics, Basic Medical College, Zhengzhou University, Zhengzhou, 450052, China e-mail:
[email protected] e-mail:
[email protected] Introduction Ischemic stroke (IS) is a complex multifactorial disorder, and the process of developing IS is generally attributed to atherosclerosis with arterial wall inflammation that ultimately leads to plaque rupture, fissure or erosion (Zintzaras et al. 2009). It has been reported that increased 5-lipoxygenaseactivating protein (ALOX5AP) activity could lead to the accumulation of leukotrienes in fatty deposits on the arterial wall. The subsequent breakdown of these deposits by the immune system may then lead to the development of atherosclerosis and an increased risk for IS (Quarta et al. 2009). In the initial study, Helgadottir et al. showed that a foursingle-nucleotide polymorphism (SNP) haplotype, HapA (SG13S25, SG13S114, SG13S89 and SG13S32), was strongly associated with a nearly twofold greater risk for myocardial infarction (MI) and stroke in an Icelandic population. In addition, another association of a different four-SNP haplotype, HapB (SG13S114, SG13S377, SG13S41 and SG13S35), with risk for MI was reported in a British population (Helgadottir et al. 2004). Several studies have tried to replicate this association in different populations. A study in an Italian population revealed an association between HapB and an increased risk for coronary artery disease (CAD). Haplotype analyses in this population additionally revealed a significant association between CAD and a new haplotype named HapC (Girelli et al. 2007). However, Zee et al. (2006) found no association of HapA or HapB with stroke in a US population. Lõhmussaar et al. (2005) indicated a lack of association of HapA with IS in a central European population. To date, a few studies on the association between the ALOX5AP gene polymorphism and the risk for stroke in Chinese Han population were available (Sun et al. 2011; Wang et al. 2011). However, the association results were still inconsistent and controversial. Therefore, the
J Mol Neurosci
aim of the present study is to determine the association between the haplotypes of ALOX5AP gene and IS in central Chinese Han population.
Materials and Methods Study Population A total of 492 patients with ischemic stroke (males/females= 290:202, mean age 56.7±8.3 years) were enrolled from Henan Provincial Hospital in central China, which is a highincidence region of IS. The IS was defined as a loss of global or focal cerebral function persisting for >24 h with corresponding infarction on brain imaging with a probable vascular cause (Saleheen et al. 2005). IS subtypes were classified based on the Trial of Org10172 in Acute Stroke Treatment (TOAST) classification (Adams et al. 1993). Brain imaging with computer tomography (CT) and/or magnetic resonance imaging (MRI) as well as ancillary diagnostic investigations and standardized blood tests were completed. Patients with arterial fibrillation, cerebral hemorrhage, peripheral vascular diseases or kidney diseases were excluded in this study. The control group consisted of 490 individuals (males/ females=268:222, mean age 56.2 ±8.9 years) who were selected from the same demographic area and were matched to cases on the basis of age (±5 years), gender and residency. All the controls were unrelated native Henan Han and without cerebrovascular and cardiovascular diseases, cancer, hepatic or renal diseases. Signed consent form was obtained from each participant. The study protocols were approved by the Ethics Committee on Human Research of Zhengzhou University. Genotyping of ALOX5AP Genomic Variants Genomic DNA was extracted from peripheral white blood cells using the phenol/chloroform method (Sangon, Shanghai, China). Six ALOX5AP SNPs (SG13S114, SG13S377, SG13S41, SG13S35, SG13S89 and SG13S32) were selected from which HapA and HapB are derived. Of the four HapA SNPs (SG13S25, SG13S114, SG13S89 and SG13S32), SG13S25 was not selected because this SNP was shown to be monomorphic in a large Chinese cohort. Thus, we selected three SNPs SG13S114, SG13S89 and SG13S32 from HapA for this study. The four HapB SNPs (SG13S114, SG13S377, SG13S41 and SG13S35) were all included in this study. Touchdown PCR amplifications were performed using the following six pairs of primers (Sangon, Shanghai, China). All primers, as listed in Table 1, were designed using the Primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3_www.cgi). All the samples were genotyped by SNaPshot minisequence technique.
Table 1 Primer sequences (5′–3′) used for PCR SNP
Primer sequence
Segment (bp)
SG13S377F SG13S377R SG13S114F SG13S114R SG13S41F SG13S41R SG13S35F SG13S35R SG13S89F SG13S89R SG13S32F SG13S32R
TGCACCACTATGCCCATCTAA AATGAAGCAAATGACCCATGC CCTCTGTCCCTCCATTGTCAC GAATGGCATTTTGGGGTATGA GTGTCCAAATCTCCCCTTCTT GGCTGAATTAGGTCCCTTCCA GTCTGATGGTCCAGGCTGAAG CCCAGGATCATCCCAGTTGTA AGATGCGTACCCCACTTTCCT GTGGAAACATGCCTGAAGGAG AGATTTTCAACCCTGCCGTCT TCTTCCCTACCCACTGGATCA
223 373 178 627 473 305
A 20 μl mixture was prepared for each reaction, including 1× HotStarTaq buffer, 2.8 mM Mg2+, 0.3 mM dNTP, 0.1 μM of SG13S144F/R, SG13S89F/R, SG13S32F/R and SG13S41F/R, 0.2 μM of SG13S35F/R, 0.3 μM of SG13S377F/R, 1 U HotStarTaq polymerase (Qiagen) and 1 μl template DNA. The cycling program was 95 °C for 15 min, 9 cycles of 94 °C for 20 s, 62–0.5 °C/cycle for 40 s, 72 °C for 1.5 min, 28 cycles of 94 °C for 20 s, 57 °C for 30 s, 72 °C for 1.5 min and 72 °C for 5 min. In order to eliminate the excess of primers and dNTPs, 2 U SAP (Promega, USA) and 1 U Exo I (EpiCentre, Palmerston North, New Zealand) were added into 8 μl PCR products. The mixture was incubated at 37 °C for 80 min, followed by incubation at 75 °C for 15 min, and then multiplex PCR SNaPshot reaction was performed. The extension primers were as follows: SG13S114SF: cccccccccccccccccccc CAAGCCTCT CTTTGCAATTCTA SG13S89SR: ccccccccccAGCATTAGCAATGCA TTATCACA SG13S32SF: cccccccccccccccccccCAACCGAGGAG GAATTGCT SG13S41SF: cccccccAGTCCCATTCTGAGGAA CTGAG SG13S35SF: CCTGGGATGTGGTCCTTTC SG13S377SR: ccccATCACAAAACTGTGGGAGGC The reaction mixture included 3 μl SNaPshot mix (Applied Biosystems, USA), 2 μl extension primer mix (0.1 μM for SG13S41SF and 0.4 μM for others) and 1 μl purified PCR product. The cycling program was 96 °C for 1 min, 28 cycles of 96 °C for 10 s, 52 °C for 5 s and 60 °C for 30 s. In order to purify the extension products, 1 U SAP (Promega) was added to the extension product and incubated at 37 °C for 60 min, followed by incubation at 75 °C for 15 min. Finally, a mixture of 9 μl HiDi formamide, 0.25 μl Liz120 size standard and 1 μl purified extension product was denatured at 95 ° for 5 min,
J Mol Neurosci
quenched on ice for 2 min at minimum and then loaded on ABI3730xl (ABI, USA). The GeneMapper4.0 (Applied Biosystems) was ran to analyse the results. Statistical Analysis The statistical tests were performed with SPSS 16.0 software package (SPSS Inc., USA). All the continuous variables were expressed as mean value±SD. The differences in the allele and genotype frequencies were calculated using the chi-square test. Testing for deviation of genotype distribution from Hardy– Weinberg equilibrium and haplotype-based case–control study was performed using the SHEsis software (http://analysis.biox.cn) (Shi and He 2005). In addition, logistic regression was carried out to adjust for confounding factors. Bonferroni's adjustment was used for multiple comparisons. The adjusted P value for significance was set at 0.05/6=0.008. Odds ratio with 95 % confidence intervals (95 % CI) was calculated to test the association between risk factors and IS.
Results Characteristics of the Subjects The characteristics of the study population were described in Table 2. The cases and controls appear well matched in age and sex. Compared with those of the control group, the percentages of hypertension, diabetes mellitus and smokers were higher in the IS group. In addition, the IS patients had significantly higher total cholesterol and total triglycerides than the control subjects. Association Analysis Between the ALOX5AP Polymorphisms and IS No significant deviation from the Hardy–Weinberg equilibrium test was found at all six SNPs in the IS group
Table 2 Characteristics of IS patients and control subjects Characteristics
IS patients (n =492)
Controls (n =490)
P value
Sex (females/males) Age (years) Smokers, n (%) Hypertension, n (%) Diabetes, n (%) Total triglyceride (mmol/l) Total cholesterol (mmol/l)
202/290 56.7±8.3 212 (43.09) 266 (54.06) 108 (21.95) 2.06±1.41 4.89±1.23
222/268 56.2±8.9 140 (28.57) 208 (42.45) 56 (11.43) 1.83±1.36 4.48±0.95
>0.05 >0.05