Indian Journal of Medical Microbiology, (2014) 32(2): 130-136
1
Original Article
A novel nested reverse‑transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping K Saha, R Firdaus, A Biswas, A Mukherjee, *PC Sadhukhan
Abstract Purpose: Rapid and specific detection of viral nucleic acid is increasingly important in the diagnosis of infectious diseases. The objective was to develop a rapid, efficient process of nucleic acid based detection of hepatitis C virus (HCV) infection for its diagnosis and treatment follow‑up. Materials and Methods: A two‑step nested reverse‑transcriptase polymerase chain reaction (RT‑PCR) has been standardised on a sample set of 125 individuals from different liver clinics in Kolkata. The method utilises a novel fast nested RT‑PCR for HCV detection and genotyping from HCV infected patient plasma with high processivity. Results: The overall time required from ribonucleic acid (RNA) isolation to nested PCR amplified product detection is reduced to 42% when compared with conventional nested RT‑PCR amplification. The method is sensitive as conventional PCR and detected all HCV RNA positive samples. Sequencing, phylogenetic analysis of the PCR amplified product by this method showed concordant genotypes with conventional PCR. Conclusion: Though being a two‑step process, this method is fast, cost‑efficient, reliable and feasible for regular HCV RNA screening and apt even in resource limited settings. This method could be translated to regular nucleic acid screening for other infectious diseases as regular PCR regimen. Key words: Bioinformatics, genotypes, hepatitis C virus, nested reverse‑transcriptase polymerase chain reaction, rapid ribonucleic acid detection
Introduction After the discovery of hepatitis C virus (HCV) in 1989, enzyme linked immunosorbent assay has been the standard for HCV detection. Simultaneously, with the vast application of polymerase chain reaction (PCR) in the diagnosis of infectious diseases including the diagnosis of HCV by PCR is increasing day by day. Estimates suggests that around 170 million globally[1,2] of them 10 million are from European countries,[3] 4 million in USA[4] and about 12 million people in India[5] are infected with HCV. HCV is a 9.5‑kb positive sense ribonucleic acid (RNA) virus of the family Flaviviridae and Hepacivirus genus[6] and is the major cause of chronic liver disease leading to cirrhosis of liver and hepatocellular carcinoma. The highly variable and heterogenous HCV genome has been divided *Corresponding author (email: ) Department of Virology, I.C.M.R. Virus Unit, Kolkata, West Bengal, India Received: 30‑04‑2013 Accepted: 28-10-2013 Access this article online Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.129782
into six genotypes[7] 1 to 6 with more than 70 subtypes. The HCV genome is divided into two parts structural and non‑structural, 5’ untranslated region (5’ UTR), core and envelope proteins E1 and E2, the non‑structural part comprises of P7, non‑structural 2, non‑structural 3, non‑structural 4A, 4B, non‑structural 5A, 5B (NS5B) and 3’ untranslated region respectively. Genotypes 1, 2 and 3 are distributed globally while others are limited to specific regions of the world. Genotype 4 is mostly restricted to the Middle East and Central Africa, genotype 5 in South Africa and genotype 6 in South East Asia.[8] The genotypes are very significant because they are associated with response to the treatment, severity and progression of the disease. Molecular detection methods are effective to detect the presence or absence of active infection and also help to record changes in the period of therapy and to monitor the period of treatment. For qualitative HCV RNA detection, commonly reverse transcriptase PCR (RT‑PCR) coupled with a nested PCR is the most sensitive and specific test practiced all over the world.[9,10] This method is specific, but with some limitations that the time required for the test to be completed is 5 h excluding RNA extraction. Real time PCR based HCV RNA detection and quantitation is faster, but has several limitations such as sophistication, expertise, expensive and chances of false positives. Here, we have developed a novel two‑step nested RT‑PCR based technique, which utilises a mutated version of Taq polymerase enzyme with high efficiency and specificity, which dramatically reduces the time for PCR
April-June 2014
131
Saha, et al.: Rapid HCV detection
cycles. The complete nested RT‑PCR could be done within a period of 2 h and 30 min rather than conventional nested RT‑PCR consuming more than 5 h. Materials and Methods Study population The study population comprised of patients visiting different Liver Clinics in Kolkata, India. A total of 125 HCV seroreactive samples were included for the study and from each subject 1 ml of whole blood was collected, the age range of the patients were from 5 to 75 years. Patients with other co‑infections such as hepatitis B virus (HBV) and human immunodeficiency virus (HIV) were not included in this study. This was an IARC Ethics Committee approved study and written consent had been obtained from the patients during the collection of blood samples. A total of 20 healthy blood donors were included in the study having no history of HCV, HIV, HBV or human papilloma virus infections at the time of entry. Thus, healthy controls were age matched subjects with currently not having any kind of diseases or illness and were collected from consenting individuals as well as from blood banks in Kolkata. Enzyme‑linked immunosorbent assay test for serological verification All the samples were again tested for the presence of HCV in the sera using Hepanostika HCV Ultra test Kit (Biomerix, Boxtel, Netherlands) using the manufacturers protocol. Those who were found to be reactive were included as seropositive/seroreactive. Extraction of HCV RNA from serum Viral RNA was extracted from 140 µl of plasma using QIAamp viral RNA mini kit (QIAGEN, Germany) according to the manufacturer’s protocol and eluted with 50 µl of elution buffer and stored at −70°C for further uses. Detection of HCV RNA by nested RT‑PCR Three different regions of HCV RNA genome namely 5’ UTR, core and NS5B were PCR amplified with genome specific primers by nested RT‑PCR method,[9‑11] the primer sequences for 5’ UTR, outer forward “ACTGTCTTCACGCAGAAAGCGTCTA GCCAT” outer reverse “CGAGACCTCCCGG GGCACTCGCAAGCACCC” inner forward “AC G C A G A A A G C G T C TA G C C AT G G C G T TA G T ” and inner reverse “TCCCGGGGCACTCGCAAGC ACCCTATCAGG” respectively, for core outer forward “ACTGCCTGATAGGGTGCTTGC” outer reverse “ATGTACCCCATGAGGTCGGC” followed by inner forward “AGGTCTCGTAGACCGTGCA” and inner reverse “CACGTTAGGGTATCGATGAC” respectively and for NS5B the primer sequences were forward primer
“TATGAYACCCGYTGCTTTGAC”, outer reverse “GAGGAGCAAGATGTTATCAGCTC” followed by inner reverse “GAATACCTGGTCATAGCCTCCG” respectively. Conventional nested RT‑PCR for the detection of HCV RNA was performed with normal ABI Taq polymerase.[11] For rapid amplification of HCV RNA, 1st round one‑step RT‑PCR was carried out in a total volume of 25 µl containing 4 µl of isolated RNA. The reaction mixture comprised of 2.5 µl of 10 × FasTaqTM assay buffer with 2 mM MgCl2 (Chromous Biotech, Bangalore, India), 0.8 mM dNTPs (Applied Biosystems, USA), 5 mM of dithiotheritol (Sigma‑Aldrich, USA), 0.8 pmole of forward and reverse primers, 0.05 U of avian myeloblastosis virus reverse transcriptase (AMV RT) (Promega, USA) and 0.75 U of the FasTaqTM polymerase enzyme (Chromous Biotech, Bangalore, India, Patent pending). The RT‑PCR conditions were 42°C for 30 min followed by 94°C for 2 min and 40 cycles of 94°C for 10 s, 55°C for 10 s and 72°C for 5 s respectively, and the final extension was carried out at 72°C for 5 min in an ABI 9700 thermal cycler. This was followed by the 2nd round nested PCR in a 25 µl total reaction volume containing 2 µl of 1st round RT‑PCR product with the inner set of primers excluding the AMV RT. The nested PCR cycle conditions were same, only the RT step was omitted. The PCR products were electrophoresed in 1.5% agarose gel stained with ethidium bromide and observed under gel documentation system (Bio‑Rad, USA), for HCV 5’ UTR, core and NS5B, bands were obtained at 256 bp, 405 bp and 389 bp respectively. Analytical sensitivity To further explore the sensitivity of the method we used HCV genotype 3a strain with a viral load of 2,763,000 I.U/ml as a standard with seven dilutions i.e. 101, 102, 103, 104, 105, 106 and 107 each having 2,763,000, 276,300, 27,630, 2763, 276.3, 27.63 and 2.763 IU/ml respectively. For further analytical specificity the same set of PCR was performed with five dengue RNA positive samples, belonging to the same Flavivirus group. Clinical performance The clinical sensitivity and specificity of the rapid nested RT‑PCR was further evaluated by comparing it with the gold standard[9‑11] test for HCV detection i.e. our conventional nested RT‑PCR method. Deoxyribonucleic analysis
acid sequencing
and
phylogenetic
The PCR amplified products obtained at 256 bp, 405bp and 389 bp in size were extracted from the agarose gel using Qiaquick PCR purification kit (Qiagen, Germany) following the manufacturer’s protocol. The PCR purified products were directly used for sequencing using Big Dye 3.1 Kit (ABI, USA) in an automated DNA sequencer 3130XL (ABI, Foster
www.ijmm.org
132
Indian Journal of Medical Microbiology
city, USA). The results were analysed in Bio‑edit software and the phylogenetic tree was computed using the Molecular Evolutionary Genetics Analysis (MEGA 5.0) software using the neighbour joining algorithm.
vol. 32, No. 2
Results
We had attempted to amplify all HCV genomic regions in one‑step RT‑PCR format to avoid the two‑step nested PCR process, but the FasTaqTM polymerase enzyme activity was not maintained after 30 min of RT reaction and 40 cycles of PCR reactions (data not shown) and hence sufficient PCR yield could not be visualised under gel documentation system.
Optimization of the PCR
HCV RNA positives
The rapid RT‑PCR was standardised using 0.7, 0.8, 0.9 and 1 pmol of each primer in a 25 µl reaction volume, which produces a 256 bp, 389 bp and 405 bp amplicons for 5’ UTR, core and NS5B respectively [Figure 1]. Of these five sets 0.8 pmol of the primers gave the optimum yield. A similar strategy was applied for dNTPs standardisation, where three sets of 0.5, 0.8, 1.0 µmol of dNTPs were used of which 0.8 µmol gave the optimum amplification (data not shown). PCR conditions were also standardised and those providing the highest amplification signal were selected and were kept same in all the cases in rapid PCR amplification method, whereas in conventional PCR, cycling conditions were different for different genomic regions.[9‑11] Nucleotides (0.8 mM) and MgCl2 (2 mM) concentration were optimised and maintained the same in all PCR amplifications (data not shown). In rapid RT‑PCR, a 30 min RT reaction gave optimum product and we maintained this time for all RT step rather than 1 h for conventional RT. Total time taken from RNA isolation to gel electrophoresis was approximately 3 h for fast nested RT‑PCR, whereas in conventional nested RT‑PCR, it took 5 h 50 min [Table 1]. We had optimised RT‑PCR cycling conditions to get maximum PCR yield rather than manufacturers recommendations, time for denaturation (5 s), annealing (10 s) and extension (1 s for 500 bp amplification).
Of the total 165 samples collected, 125 were HCV ELISA and were further processed for RNA detection, among them 88 (70.4%) samples were positive for all 5’ UTR, NS5B, core region of HCV genome by both the methods, conventional and rapid nested RT‑PCR method. Among the 88 samples 52 (59.09%) were genotype 3, 30 (34.09%) were genotype 1 and 7 (7.95%) were genotype 6 respectively.
Table 1: A time comparison between fast nested RT‑PCR and conventional nested RT‑PCR Steps Time in min (PCR) Fast Conventional RNA‑extraction 20 20 RT‑PCR 60 175 Nested‑PCR 27 115 Gel‑electrophoresis 40 40 Total 147~2 h 27 min 350~5 h 50 min
Sensitivity
Specificity The method described here for the detection and amplification of three HCV RNA genomic regions was confirmed to be very specific. The primers used for this study were designed from the most conserved regions of HCV genome and are from previous publications; hence all genotypes and subtypes could be validated by this method.[9‑11] For validation of broadness one representative strain of each subtype was analysed as positive controls. To further strengthen the result, the PCR amplified product from both the types of PCR i.e., fast and as well as conventional PCR amplified product was run on an agarose gel [Figure 2] and the band was excised and sequenced. Sequencing data confirmed the amplification of the expected product. The result shows no discrepancy among them, further validating our method [Figure 3].
For the evaluation of the sensitivity of the assay, three replicates of experiments were performed on 10 fold dilutions of genotype 3a RNA extract with a known titre of HCV. The lowest HCV RNA detection level was 27.63 IU/µl by this rapid nested RT‑PCR method [Figure 4]. Phylogenetic analysis
RT‑PCR: Reverse‑transcriptase polymerase chain reaction, RNA: Ribonucleic acid
Ten nested PCR amplified products were randomly selected for 5’ UTR, NS5B, core region and sequenced
Figure 1: Nearly 1.5% agarose gel showing polymerase chain reaction amplified 405 bp products of hepatitis C virus core gene in lanes L2L5, 256 bp 5’non-coding region products in lane L6-L9, 389 bp nonstructural 5B products in lane L10-L13 with DL showing the 100 bp deoxyribonucleic acid ladder and lane L1 with negative control
Figure 2: Nearly 1.5% agarose gel showing the polymerase chain reaction amplified products from both the conventional PCR lanes L3-L6 with L1, L2 representing negative and positive control respectively. Fast PCR products from lanes L9-L12 and L7, L8 with negative and positive controls with DL showing the 100 bp deoxyribonucleic acid ladder
www.ijmm.org
April-June 2014
Saha, et al.: Rapid HCV detection
133
Figure 3: Comparison of sequences between conventional and fast polymerase chain reaction methods with randomly selected four 5’non-coding region sequences (225 bp)
the study were found to be negative, including absence of amplification signal for other common RNA viruses like the five samples, which were dengue RNA positive indicating high clinical applicability of this method. Discussion Figure 4: Detection limit of fast reverse-transcriptase-nested polymerase chain reaction assay for the detection of hepatitis C virus (HCV) with DL being 100 bp deoxyribonucleic acid marker; L1, 2.763 IU/µl; L2, 27.63 IU/µl; L3, 276.3 IU/µl; L4, 2763 IU/µl; L5, 27,630 IU/µl; L6, 276,300 IU/µl; L7, 2,763,000 IU/µl of HCV standards and L8 showing negative control respectively
along with the reference sequences. The phylogenetic trees were constructed [Figure 5a‑c] and analysis shows seven out of seven were genotype 3b, two were genotype 1a, one genotype 1b respectively with both the types of PCR amplification. The evolutionary history was inferred using the Neighbour‑Joining method.[12] The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Evolutionary analyses were conducted in MEGA 5.0.[13,14] Clinical performances The clinical sensitivity of the fast nested RT‑PCR when compared to the reference method i.e. conventional nested RT‑PCR is 100% (88/88). All the control samples used in
Nucleic acid based detection of HCV infection is demanding as it gives the indication of active infection of this virus. Conventional nested RT‑PCR, real time PCR, transcription mediated amplification and branched DNA based assays are the most common methods for the detection and quantification of this RNA virus.[10,15] Real time PCR does not take long time for detection and quantification of viral particles but it needs sophisticated facilities and expertise.[15] Moreover, low viral load sample has a probability of showing false negatives or indeterminate results. In this circumstance, conventional PCR is more acceptable than real time PCR as we can see the specific PCR amplified product in the gel. Although conventional PCR does not need sophistication and expertise but it is time consuming. Thus, we need fast and specific RT‑PCR for rapid detection of viral nucleic acids in resource limited settings. This study depicts that HCV can be detected from plasma through this novel rapid nested RT‑PCR assay like conventional nested RT‑PCR. In laboratory conditions, manual method of RNA extraction (20 min) followed by
www.ijmm.org
134
Indian Journal of Medical Microbiology
a
vol. 32, No. 2
b
c
Figure 5: Phylogenetic analysis of (a) 5’ untranslated region (225 nt) sequences of 10 hepatitis C virus isolates, (b) core (375 nt) sequences of 10 HCV isolates, (c) non-structural 5B (355 nt) sequences of 10 HCV isolates. Sequences for each major reference subtype were selected from GeneBank database for analysis. The accession numbers of the reference sequences (with subtypes) are as follows: AF009606 (1a), D90208 (1b), AF169004 (2a), D10988 (2b), D17763 (3a), D49374 (3b), Y11604 (4a), Y13184 (5a) and D84265 (6h)
nested RT‑PCR and agarose gel electrophoresis (120 min) generally produces the specific result in less than 3 h. Thus this method employed is even faster than routine ELISA process employing Hepanostika HCV Ultra (Biomeriux, Boxtel, Netherlands) and could be performed by one single trained personal thus making it more suitable to resource limited settings. The primers used for the detection of HCV
were from published articles such that the region to be amplified falls in conserved part of the HCV genome and also to ensure optimal sensitivity. Our sequencing data and phylogenetic analysis confirmed the amplified products to be of the HCV 5’ UTR, core and NS5B regions, moreover the phylogenetic and
www.ijmm.org
April-June 2014
Saha, et al.: Rapid HCV detection
cluster analysis are an established method for molecular epidemiological study to provide rapid determination of the consensus sequence of a heterogenous population and evolutionary history of HCV.[16‑19] The 5’ UTR is the choice for qualitative and quantitative HCV RNA detection due to its high level of conservancy. However, due to the conservation level being high it is limited in its ability to discriminate between genotypes.[20‑22] Hence, most accurate method is to sequence a region, which is divergent enough allowing the discrimination between the types and subtypes.[23,24] Thus, according to the international guidelines here we had sequenced three most studied region i.e., 5’ UTR, core and NS5B.[25] To further strengthen our approach we had included reference sequences of all subtypes so as to make the process a universal one. The sequencing results confirmed them to their original genotypes thus validating our study. The only limitation of our study is that besides knowing the presence of HCV RNA and specific HCV genotype, determination of HCV viral kinetics during IFN treatment is needed. Since viral load cannot be measured using nested RT‑PCR, it is difficult to effectively monitor response to therapy during anti‑viral treatment of HCV infected patients. It is also very important to diagnose HCV infection during the acute phase in order to bring down the incidence of HCV infection particularly among high‑risk group population like haemodialysis patients. In view of the above, serum antibodies are insensitive in the acute phase because of the long serological window of 45‑68 days and hence HCV RNA is a more reliable marker than anti‑HCV antibodies for acute cases.[26] In our knowledge the process described here is the first such model which employs a fast nested RT‑PCR process that allows a sensitive, as well as a specific test for detection of HCV and its genotyping. Since, there is a reduction of 42% in time compared with gold standard process, the downstream application of the amplicons for sequencing can be done quickly hence reducing the overall time required for sequencing. Thus, genotyping could be done simultaneously from the amplicons produced from the fast PCR method. The only limitation of this method is that it is a two‑step PCR process and we are in process of finding out possible ways to make it a one‑step method. In conclusion, the method described here not only helps in diagnostic detection for clinicians but also becomes much useful in case of epidemiological surveillance and screening blood donors and would be apt for any resource limited setup. The authors conclude that the method described is fast, simple, sensitive and specific, which should enable early diagnosis of this Flavivirus and other similar infectious diseases. Acknowledgments The study was supported by Indian Council of Medical Research. The fellowships of students were from University Grants Commission, India and Department of Biotechnology, India.
135
References 1. Alter HJ, Seeff LB. Recovery, persistence, and sequelae in hepatitis C virus infection: A perspective on long‑term outcome. Semin Liver Dis 2000;20:17‑35. 2. McHutchison JG, Bacon BR. Hepatitis C: A 20‑year debt comes due. Am J Manag Care 2004;10:S20. 3. WHO. Hepatitis C – Global prevalence (update). Wkly Epidemiol Rec 1999;74:425‑7. 4. Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Ann Intern Med 2006;144:705‑14. 5. Mukhopadhyaya A. Hepatitis C in India. J Biosci 2008;33:465‑73. 6. Penin F, Dubuisson J, Rey FA, Moradpour D, Pawlotsky JM. Structural biology of hepatitis C virus. Hepatology 2004;39:5‑19. 7. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS‑5 region. J Gen Virol 1993;74:2391‑9. 8. Ramia S, Eid‑Fares J. Distribution of hepatitis C virus genotypes in the Middle East. Int J Infect Dis 2006;10:272‑7. 9. Bukh J, Purcell RH, Miller RH. Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proc Natl Acad Sci U S A 1992;89:187‑91. 10. Cantaloube JF, Laperche S, Gallian P, Bouchardeau F, de Lamballerie X, de Micco P. Analysis of the 5’ noncoding region versus the NS5b region in genotyping hepatitis C virus isolates from blood donors in France. J Clin Microbiol 2006;44:2051‑6. 11. Saha K, Firdaus R, Santra P, Pal J, Roy A, Bhattacharya MK, et al. Recent pattern of Co‑infection amongst HIV seropositive individuals in tertiary care hospital, Kolkata. Virol J 2011;8:116. 12. Saitou N, Nei M. The neighbor‑joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406‑25. 13. Nei M, Kumar S. Molecular Evolution and Phylogenetics. New York: Oxford University Press; 2000. 14. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731‑9. 15. Ito T, Yasui K, Mukaigawa J, Katsume A, Kohara M, Mitamura K. Acquisition of susceptibility to hepatitis C virus replication in HepG2 cells by fusion with primary human hepatocytes: Establishment of a quantitative assay for hepatitis C virus infectivity in a cell culture system. Hepatology 2001;34:566‑72. 16. Power JP, Lawlor E, Davidson F, Holmes EC, Yap PL, Simmonds P. Molecular epidemiology of an outbreak of infection with hepatitis C virus in recipients of anti‑D immunoglobulin. Lancet 1995;345:1211‑3. 17. Holmberg SD. Molecular epidemiology of health care‑associated transmission of hepatitis B and C viruses. Clin Liver Dis 2010;14:37‑48. 18. Pybus OG, Barnes E, Taggart R, Lemey P, Markov PV, Rasachak B, et al. Genetic history of hepatitis C virus in East Asia. J Virol 2009;83:1071‑82.
www.ijmm.org
136
Indian Journal of Medical Microbiology
19. Odeberg J, Yun Z, Sönnerborg A, Uhlén M, Lundeberg J. Dynamic analysis of heterogeneous hepatitis C virus populations by direct solid‑phase sequencing. J Clin Microbiol 1995;33:1870‑4. 20. Chinchai T, Labout J, Noppornpanth S, Theamboonlers A, Haagmans BL, Osterhaus AD, et al. Comparative study of different methods to genotype hepatitis C virus type 6 variants. J Virol Methods 2003;109:195‑201. 21. Mellor J, Walsh EA, Prescott LE, Jarvis LM, Davidson F, Yap PL, et al. Survey of type 6 group variants of hepatitis C virus in Southeast Asia by using a core‑based genotyping assay. J Clin Microbiol 1996;34:417‑23. 22. Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G. Second‑generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 1996;34:2259‑66. 23. Nolte FS. Hepatitis C virus genotyping: Clinical implications and methods. Mol Diagn 2001;6:265‑77.
vol. 32, No. 2
24. Pawlotsky JM. Use and interpretation of virological tests for hepatitis C. Hepatology 2002;36 Suppl 1:S65‑73. 25. Bukh J, Miller RH, Purcell RH. Genetic heterogeneity of hepatitis C virus: Quasispecies and genotypes. Semin Liver Dis 1995;15:41‑63. 26. Miedouge M, Saune K, Kamar N, Rieu M, Rostaing L, Izopet J. Analytical evaluation of HCV core antigen and interest for HCV screening in haemodialysis patients. J Clin Virol 2010;48:18‑21. How to cite this article: Saha K, Firdaus R, Biswas A, Mukherjee A, Sadhukhan PC. A novel nested reverse-transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping. Indian J Med Microbiol 2014;32:130-6. Source of Support: Indian Council of Medical Research intra mural research funding, Conflict of Interest: None declared.
Announcement
iPhone App A free application to browse and search the journal’s content is now available for iPhone/iPad. The application provides “Table of Contents” of the latest issues, which are stored on the device for future offline browsing. Internet connection is required to access the back issues and search facility. The application is Compatible with iPhone, iPod touch, and iPad and Requires iOS 3.1 or later. The application can be downloaded from http://itunes.apple.com/us/app/medknow-journals/ id458064375?ls=1&mt=8. For suggestions and comments do write back to us. www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
1
Original Article
A novel nested reverse‑transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping K Saha, R Firdaus, A Biswas, A Mukherjee, *PC Sadhukhan
Abstract Purpose: Rapid and specific detection of viral nucleic acid is increasingly important in the diagnosis of infectious diseases. The objective was to develop a rapid, efficient process of nucleic acid based detection of hepatitis C virus (HCV) infection for its diagnosis and treatment follow‑up. Materials and Methods: A two‑step nested reverse‑transcriptase polymerase chain reaction (RT‑PCR) has been standardised on a sample set of 125 individuals from different liver clinics in Kolkata. The method utilises a novel fast nested RT‑PCR for HCV detection and genotyping from HCV infected patient plasma with high processivity. Results: The overall time required from ribonucleic acid (RNA) isolation to nested PCR amplified product detection is reduced to 42% when compared with conventional nested RT‑PCR amplification. The method is sensitive as conventional PCR and detected all HCV RNA positive samples. Sequencing, phylogenetic analysis of the PCR amplified product by this method showed concordant genotypes with conventional PCR. Conclusion: Though being a two‑step process, this method is fast, cost‑efficient, reliable and feasible for regular HCV RNA screening and apt even in resource limited settings. This method could be translated to regular nucleic acid screening for other infectious diseases as regular PCR regimen. Key words: Bioinformatics, genotypes, hepatitis C virus, nested reverse‑transcriptase polymerase chain reaction, rapid ribonucleic acid detection
Introduction After the discovery of hepatitis C virus (HCV) in 1989, enzyme linked immunosorbent assay has been the standard for HCV detection. Simultaneously, with the vast application of polymerase chain reaction (PCR) in the diagnosis of infectious diseases including the diagnosis of HCV by PCR is increasing day by day. Estimates suggests that around 170 million globally[1,2] of them 10 million are from European countries,[3] 4 million in USA[4] and about 12 million people in India[5] are infected with HCV. HCV is a 9.5‑kb positive sense ribonucleic acid (RNA) virus of the family Flaviviridae and Hepacivirus genus[6] and is the major cause of chronic liver disease leading to cirrhosis of liver and hepatocellular carcinoma. The highly variable and heterogenous HCV genome has been divided *Corresponding author (email: ) Department of Virology, I.C.M.R. Virus Unit, Kolkata, West Bengal, India Received: 30‑04‑2013 Accepted: 28-10-2013 Access this article online Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.129782
into six genotypes[7] 1 to 6 with more than 70 subtypes. The HCV genome is divided into two parts structural and non‑structural, 5’ untranslated region (5’ UTR), core and envelope proteins E1 and E2, the non‑structural part comprises of P7, non‑structural 2, non‑structural 3, non‑structural 4A, 4B, non‑structural 5A, 5B (NS5B) and 3’ untranslated region respectively. Genotypes 1, 2 and 3 are distributed globally while others are limited to specific regions of the world. Genotype 4 is mostly restricted to the Middle East and Central Africa, genotype 5 in South Africa and genotype 6 in South East Asia.[8] The genotypes are very significant because they are associated with response to the treatment, severity and progression of the disease. Molecular detection methods are effective to detect the presence or absence of active infection and also help to record changes in the period of therapy and to monitor the period of treatment. For qualitative HCV RNA detection, commonly reverse transcriptase PCR (RT‑PCR) coupled with a nested PCR is the most sensitive and specific test practiced all over the world.[9,10] This method is specific, but with some limitations that the time required for the test to be completed is 5 h excluding RNA extraction. Real time PCR based HCV RNA detection and quantitation is faster, but has several limitations such as sophistication, expertise, expensive and chances of false positives. Here, we have developed a novel two‑step nested RT‑PCR based technique, which utilises a mutated version of Taq polymerase enzyme with high efficiency and specificity, which dramatically reduces the time for PCR
April-June 2014
131
Saha, et al.: Rapid HCV detection
cycles. The complete nested RT‑PCR could be done within a period of 2 h and 30 min rather than conventional nested RT‑PCR consuming more than 5 h. Materials and Methods Study population The study population comprised of patients visiting different Liver Clinics in Kolkata, India. A total of 125 HCV seroreactive samples were included for the study and from each subject 1 ml of whole blood was collected, the age range of the patients were from 5 to 75 years. Patients with other co‑infections such as hepatitis B virus (HBV) and human immunodeficiency virus (HIV) were not included in this study. This was an IARC Ethics Committee approved study and written consent had been obtained from the patients during the collection of blood samples. A total of 20 healthy blood donors were included in the study having no history of HCV, HIV, HBV or human papilloma virus infections at the time of entry. Thus, healthy controls were age matched subjects with currently not having any kind of diseases or illness and were collected from consenting individuals as well as from blood banks in Kolkata. Enzyme‑linked immunosorbent assay test for serological verification All the samples were again tested for the presence of HCV in the sera using Hepanostika HCV Ultra test Kit (Biomerix, Boxtel, Netherlands) using the manufacturers protocol. Those who were found to be reactive were included as seropositive/seroreactive. Extraction of HCV RNA from serum Viral RNA was extracted from 140 µl of plasma using QIAamp viral RNA mini kit (QIAGEN, Germany) according to the manufacturer’s protocol and eluted with 50 µl of elution buffer and stored at −70°C for further uses. Detection of HCV RNA by nested RT‑PCR Three different regions of HCV RNA genome namely 5’ UTR, core and NS5B were PCR amplified with genome specific primers by nested RT‑PCR method,[9‑11] the primer sequences for 5’ UTR, outer forward “ACTGTCTTCACGCAGAAAGCGTCTA GCCAT” outer reverse “CGAGACCTCCCGG GGCACTCGCAAGCACCC” inner forward “AC G C A G A A A G C G T C TA G C C AT G G C G T TA G T ” and inner reverse “TCCCGGGGCACTCGCAAGC ACCCTATCAGG” respectively, for core outer forward “ACTGCCTGATAGGGTGCTTGC” outer reverse “ATGTACCCCATGAGGTCGGC” followed by inner forward “AGGTCTCGTAGACCGTGCA” and inner reverse “CACGTTAGGGTATCGATGAC” respectively and for NS5B the primer sequences were forward primer
“TATGAYACCCGYTGCTTTGAC”, outer reverse “GAGGAGCAAGATGTTATCAGCTC” followed by inner reverse “GAATACCTGGTCATAGCCTCCG” respectively. Conventional nested RT‑PCR for the detection of HCV RNA was performed with normal ABI Taq polymerase.[11] For rapid amplification of HCV RNA, 1st round one‑step RT‑PCR was carried out in a total volume of 25 µl containing 4 µl of isolated RNA. The reaction mixture comprised of 2.5 µl of 10 × FasTaqTM assay buffer with 2 mM MgCl2 (Chromous Biotech, Bangalore, India), 0.8 mM dNTPs (Applied Biosystems, USA), 5 mM of dithiotheritol (Sigma‑Aldrich, USA), 0.8 pmole of forward and reverse primers, 0.05 U of avian myeloblastosis virus reverse transcriptase (AMV RT) (Promega, USA) and 0.75 U of the FasTaqTM polymerase enzyme (Chromous Biotech, Bangalore, India, Patent pending). The RT‑PCR conditions were 42°C for 30 min followed by 94°C for 2 min and 40 cycles of 94°C for 10 s, 55°C for 10 s and 72°C for 5 s respectively, and the final extension was carried out at 72°C for 5 min in an ABI 9700 thermal cycler. This was followed by the 2nd round nested PCR in a 25 µl total reaction volume containing 2 µl of 1st round RT‑PCR product with the inner set of primers excluding the AMV RT. The nested PCR cycle conditions were same, only the RT step was omitted. The PCR products were electrophoresed in 1.5% agarose gel stained with ethidium bromide and observed under gel documentation system (Bio‑Rad, USA), for HCV 5’ UTR, core and NS5B, bands were obtained at 256 bp, 405 bp and 389 bp respectively. Analytical sensitivity To further explore the sensitivity of the method we used HCV genotype 3a strain with a viral load of 2,763,000 I.U/ml as a standard with seven dilutions i.e. 101, 102, 103, 104, 105, 106 and 107 each having 2,763,000, 276,300, 27,630, 2763, 276.3, 27.63 and 2.763 IU/ml respectively. For further analytical specificity the same set of PCR was performed with five dengue RNA positive samples, belonging to the same Flavivirus group. Clinical performance The clinical sensitivity and specificity of the rapid nested RT‑PCR was further evaluated by comparing it with the gold standard[9‑11] test for HCV detection i.e. our conventional nested RT‑PCR method. Deoxyribonucleic analysis
acid sequencing
and
phylogenetic
The PCR amplified products obtained at 256 bp, 405bp and 389 bp in size were extracted from the agarose gel using Qiaquick PCR purification kit (Qiagen, Germany) following the manufacturer’s protocol. The PCR purified products were directly used for sequencing using Big Dye 3.1 Kit (ABI, USA) in an automated DNA sequencer 3130XL (ABI, Foster
www.ijmm.org
132
Indian Journal of Medical Microbiology
city, USA). The results were analysed in Bio‑edit software and the phylogenetic tree was computed using the Molecular Evolutionary Genetics Analysis (MEGA 5.0) software using the neighbour joining algorithm.
vol. 32, No. 2
Results
We had attempted to amplify all HCV genomic regions in one‑step RT‑PCR format to avoid the two‑step nested PCR process, but the FasTaqTM polymerase enzyme activity was not maintained after 30 min of RT reaction and 40 cycles of PCR reactions (data not shown) and hence sufficient PCR yield could not be visualised under gel documentation system.
Optimization of the PCR
HCV RNA positives
The rapid RT‑PCR was standardised using 0.7, 0.8, 0.9 and 1 pmol of each primer in a 25 µl reaction volume, which produces a 256 bp, 389 bp and 405 bp amplicons for 5’ UTR, core and NS5B respectively [Figure 1]. Of these five sets 0.8 pmol of the primers gave the optimum yield. A similar strategy was applied for dNTPs standardisation, where three sets of 0.5, 0.8, 1.0 µmol of dNTPs were used of which 0.8 µmol gave the optimum amplification (data not shown). PCR conditions were also standardised and those providing the highest amplification signal were selected and were kept same in all the cases in rapid PCR amplification method, whereas in conventional PCR, cycling conditions were different for different genomic regions.[9‑11] Nucleotides (0.8 mM) and MgCl2 (2 mM) concentration were optimised and maintained the same in all PCR amplifications (data not shown). In rapid RT‑PCR, a 30 min RT reaction gave optimum product and we maintained this time for all RT step rather than 1 h for conventional RT. Total time taken from RNA isolation to gel electrophoresis was approximately 3 h for fast nested RT‑PCR, whereas in conventional nested RT‑PCR, it took 5 h 50 min [Table 1]. We had optimised RT‑PCR cycling conditions to get maximum PCR yield rather than manufacturers recommendations, time for denaturation (5 s), annealing (10 s) and extension (1 s for 500 bp amplification).
Of the total 165 samples collected, 125 were HCV ELISA and were further processed for RNA detection, among them 88 (70.4%) samples were positive for all 5’ UTR, NS5B, core region of HCV genome by both the methods, conventional and rapid nested RT‑PCR method. Among the 88 samples 52 (59.09%) were genotype 3, 30 (34.09%) were genotype 1 and 7 (7.95%) were genotype 6 respectively.
Table 1: A time comparison between fast nested RT‑PCR and conventional nested RT‑PCR Steps Time in min (PCR) Fast Conventional RNA‑extraction 20 20 RT‑PCR 60 175 Nested‑PCR 27 115 Gel‑electrophoresis 40 40 Total 147~2 h 27 min 350~5 h 50 min
Sensitivity
Specificity The method described here for the detection and amplification of three HCV RNA genomic regions was confirmed to be very specific. The primers used for this study were designed from the most conserved regions of HCV genome and are from previous publications; hence all genotypes and subtypes could be validated by this method.[9‑11] For validation of broadness one representative strain of each subtype was analysed as positive controls. To further strengthen the result, the PCR amplified product from both the types of PCR i.e., fast and as well as conventional PCR amplified product was run on an agarose gel [Figure 2] and the band was excised and sequenced. Sequencing data confirmed the amplification of the expected product. The result shows no discrepancy among them, further validating our method [Figure 3].
For the evaluation of the sensitivity of the assay, three replicates of experiments were performed on 10 fold dilutions of genotype 3a RNA extract with a known titre of HCV. The lowest HCV RNA detection level was 27.63 IU/µl by this rapid nested RT‑PCR method [Figure 4]. Phylogenetic analysis
RT‑PCR: Reverse‑transcriptase polymerase chain reaction, RNA: Ribonucleic acid
Ten nested PCR amplified products were randomly selected for 5’ UTR, NS5B, core region and sequenced
Figure 1: Nearly 1.5% agarose gel showing polymerase chain reaction amplified 405 bp products of hepatitis C virus core gene in lanes L2L5, 256 bp 5’non-coding region products in lane L6-L9, 389 bp nonstructural 5B products in lane L10-L13 with DL showing the 100 bp deoxyribonucleic acid ladder and lane L1 with negative control
Figure 2: Nearly 1.5% agarose gel showing the polymerase chain reaction amplified products from both the conventional PCR lanes L3-L6 with L1, L2 representing negative and positive control respectively. Fast PCR products from lanes L9-L12 and L7, L8 with negative and positive controls with DL showing the 100 bp deoxyribonucleic acid ladder
www.ijmm.org
April-June 2014
Saha, et al.: Rapid HCV detection
133
Figure 3: Comparison of sequences between conventional and fast polymerase chain reaction methods with randomly selected four 5’non-coding region sequences (225 bp)
the study were found to be negative, including absence of amplification signal for other common RNA viruses like the five samples, which were dengue RNA positive indicating high clinical applicability of this method. Discussion Figure 4: Detection limit of fast reverse-transcriptase-nested polymerase chain reaction assay for the detection of hepatitis C virus (HCV) with DL being 100 bp deoxyribonucleic acid marker; L1, 2.763 IU/µl; L2, 27.63 IU/µl; L3, 276.3 IU/µl; L4, 2763 IU/µl; L5, 27,630 IU/µl; L6, 276,300 IU/µl; L7, 2,763,000 IU/µl of HCV standards and L8 showing negative control respectively
along with the reference sequences. The phylogenetic trees were constructed [Figure 5a‑c] and analysis shows seven out of seven were genotype 3b, two were genotype 1a, one genotype 1b respectively with both the types of PCR amplification. The evolutionary history was inferred using the Neighbour‑Joining method.[12] The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Evolutionary analyses were conducted in MEGA 5.0.[13,14] Clinical performances The clinical sensitivity of the fast nested RT‑PCR when compared to the reference method i.e. conventional nested RT‑PCR is 100% (88/88). All the control samples used in
Nucleic acid based detection of HCV infection is demanding as it gives the indication of active infection of this virus. Conventional nested RT‑PCR, real time PCR, transcription mediated amplification and branched DNA based assays are the most common methods for the detection and quantification of this RNA virus.[10,15] Real time PCR does not take long time for detection and quantification of viral particles but it needs sophisticated facilities and expertise.[15] Moreover, low viral load sample has a probability of showing false negatives or indeterminate results. In this circumstance, conventional PCR is more acceptable than real time PCR as we can see the specific PCR amplified product in the gel. Although conventional PCR does not need sophistication and expertise but it is time consuming. Thus, we need fast and specific RT‑PCR for rapid detection of viral nucleic acids in resource limited settings. This study depicts that HCV can be detected from plasma through this novel rapid nested RT‑PCR assay like conventional nested RT‑PCR. In laboratory conditions, manual method of RNA extraction (20 min) followed by
www.ijmm.org
134
Indian Journal of Medical Microbiology
a
vol. 32, No. 2
b
c
Figure 5: Phylogenetic analysis of (a) 5’ untranslated region (225 nt) sequences of 10 hepatitis C virus isolates, (b) core (375 nt) sequences of 10 HCV isolates, (c) non-structural 5B (355 nt) sequences of 10 HCV isolates. Sequences for each major reference subtype were selected from GeneBank database for analysis. The accession numbers of the reference sequences (with subtypes) are as follows: AF009606 (1a), D90208 (1b), AF169004 (2a), D10988 (2b), D17763 (3a), D49374 (3b), Y11604 (4a), Y13184 (5a) and D84265 (6h)
nested RT‑PCR and agarose gel electrophoresis (120 min) generally produces the specific result in less than 3 h. Thus this method employed is even faster than routine ELISA process employing Hepanostika HCV Ultra (Biomeriux, Boxtel, Netherlands) and could be performed by one single trained personal thus making it more suitable to resource limited settings. The primers used for the detection of HCV
were from published articles such that the region to be amplified falls in conserved part of the HCV genome and also to ensure optimal sensitivity. Our sequencing data and phylogenetic analysis confirmed the amplified products to be of the HCV 5’ UTR, core and NS5B regions, moreover the phylogenetic and
www.ijmm.org
April-June 2014
Saha, et al.: Rapid HCV detection
cluster analysis are an established method for molecular epidemiological study to provide rapid determination of the consensus sequence of a heterogenous population and evolutionary history of HCV.[16‑19] The 5’ UTR is the choice for qualitative and quantitative HCV RNA detection due to its high level of conservancy. However, due to the conservation level being high it is limited in its ability to discriminate between genotypes.[20‑22] Hence, most accurate method is to sequence a region, which is divergent enough allowing the discrimination between the types and subtypes.[23,24] Thus, according to the international guidelines here we had sequenced three most studied region i.e., 5’ UTR, core and NS5B.[25] To further strengthen our approach we had included reference sequences of all subtypes so as to make the process a universal one. The sequencing results confirmed them to their original genotypes thus validating our study. The only limitation of our study is that besides knowing the presence of HCV RNA and specific HCV genotype, determination of HCV viral kinetics during IFN treatment is needed. Since viral load cannot be measured using nested RT‑PCR, it is difficult to effectively monitor response to therapy during anti‑viral treatment of HCV infected patients. It is also very important to diagnose HCV infection during the acute phase in order to bring down the incidence of HCV infection particularly among high‑risk group population like haemodialysis patients. In view of the above, serum antibodies are insensitive in the acute phase because of the long serological window of 45‑68 days and hence HCV RNA is a more reliable marker than anti‑HCV antibodies for acute cases.[26] In our knowledge the process described here is the first such model which employs a fast nested RT‑PCR process that allows a sensitive, as well as a specific test for detection of HCV and its genotyping. Since, there is a reduction of 42% in time compared with gold standard process, the downstream application of the amplicons for sequencing can be done quickly hence reducing the overall time required for sequencing. Thus, genotyping could be done simultaneously from the amplicons produced from the fast PCR method. The only limitation of this method is that it is a two‑step PCR process and we are in process of finding out possible ways to make it a one‑step method. In conclusion, the method described here not only helps in diagnostic detection for clinicians but also becomes much useful in case of epidemiological surveillance and screening blood donors and would be apt for any resource limited setup. The authors conclude that the method described is fast, simple, sensitive and specific, which should enable early diagnosis of this Flavivirus and other similar infectious diseases. Acknowledgments The study was supported by Indian Council of Medical Research. The fellowships of students were from University Grants Commission, India and Department of Biotechnology, India.
135
References 1. Alter HJ, Seeff LB. Recovery, persistence, and sequelae in hepatitis C virus infection: A perspective on long‑term outcome. Semin Liver Dis 2000;20:17‑35. 2. McHutchison JG, Bacon BR. Hepatitis C: A 20‑year debt comes due. Am J Manag Care 2004;10:S20. 3. WHO. Hepatitis C – Global prevalence (update). Wkly Epidemiol Rec 1999;74:425‑7. 4. Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Ann Intern Med 2006;144:705‑14. 5. Mukhopadhyaya A. Hepatitis C in India. J Biosci 2008;33:465‑73. 6. Penin F, Dubuisson J, Rey FA, Moradpour D, Pawlotsky JM. Structural biology of hepatitis C virus. Hepatology 2004;39:5‑19. 7. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS‑5 region. J Gen Virol 1993;74:2391‑9. 8. Ramia S, Eid‑Fares J. Distribution of hepatitis C virus genotypes in the Middle East. Int J Infect Dis 2006;10:272‑7. 9. Bukh J, Purcell RH, Miller RH. Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proc Natl Acad Sci U S A 1992;89:187‑91. 10. Cantaloube JF, Laperche S, Gallian P, Bouchardeau F, de Lamballerie X, de Micco P. Analysis of the 5’ noncoding region versus the NS5b region in genotyping hepatitis C virus isolates from blood donors in France. J Clin Microbiol 2006;44:2051‑6. 11. Saha K, Firdaus R, Santra P, Pal J, Roy A, Bhattacharya MK, et al. Recent pattern of Co‑infection amongst HIV seropositive individuals in tertiary care hospital, Kolkata. Virol J 2011;8:116. 12. Saitou N, Nei M. The neighbor‑joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406‑25. 13. Nei M, Kumar S. Molecular Evolution and Phylogenetics. New York: Oxford University Press; 2000. 14. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731‑9. 15. Ito T, Yasui K, Mukaigawa J, Katsume A, Kohara M, Mitamura K. Acquisition of susceptibility to hepatitis C virus replication in HepG2 cells by fusion with primary human hepatocytes: Establishment of a quantitative assay for hepatitis C virus infectivity in a cell culture system. Hepatology 2001;34:566‑72. 16. Power JP, Lawlor E, Davidson F, Holmes EC, Yap PL, Simmonds P. Molecular epidemiology of an outbreak of infection with hepatitis C virus in recipients of anti‑D immunoglobulin. Lancet 1995;345:1211‑3. 17. Holmberg SD. Molecular epidemiology of health care‑associated transmission of hepatitis B and C viruses. Clin Liver Dis 2010;14:37‑48. 18. Pybus OG, Barnes E, Taggart R, Lemey P, Markov PV, Rasachak B, et al. Genetic history of hepatitis C virus in East Asia. J Virol 2009;83:1071‑82.
www.ijmm.org
136
Indian Journal of Medical Microbiology
19. Odeberg J, Yun Z, Sönnerborg A, Uhlén M, Lundeberg J. Dynamic analysis of heterogeneous hepatitis C virus populations by direct solid‑phase sequencing. J Clin Microbiol 1995;33:1870‑4. 20. Chinchai T, Labout J, Noppornpanth S, Theamboonlers A, Haagmans BL, Osterhaus AD, et al. Comparative study of different methods to genotype hepatitis C virus type 6 variants. J Virol Methods 2003;109:195‑201. 21. Mellor J, Walsh EA, Prescott LE, Jarvis LM, Davidson F, Yap PL, et al. Survey of type 6 group variants of hepatitis C virus in Southeast Asia by using a core‑based genotyping assay. J Clin Microbiol 1996;34:417‑23. 22. Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G. Second‑generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 1996;34:2259‑66. 23. Nolte FS. Hepatitis C virus genotyping: Clinical implications and methods. Mol Diagn 2001;6:265‑77.
vol. 32, No. 2
24. Pawlotsky JM. Use and interpretation of virological tests for hepatitis C. Hepatology 2002;36 Suppl 1:S65‑73. 25. Bukh J, Miller RH, Purcell RH. Genetic heterogeneity of hepatitis C virus: Quasispecies and genotypes. Semin Liver Dis 1995;15:41‑63. 26. Miedouge M, Saune K, Kamar N, Rieu M, Rostaing L, Izopet J. Analytical evaluation of HCV core antigen and interest for HCV screening in haemodialysis patients. J Clin Virol 2010;48:18‑21. How to cite this article: Saha K, Firdaus R, Biswas A, Mukherjee A, Sadhukhan PC. A novel nested reverse-transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping. Indian J Med Microbiol 2014;32:130-6. Source of Support: Indian Council of Medical Research intra mural research funding, Conflict of Interest: None declared.
Announcement
iPhone App A free application to browse and search the journal’s content is now available for iPhone/iPad. The application provides “Table of Contents” of the latest issues, which are stored on the device for future offline browsing. Internet connection is required to access the back issues and search facility. The application is Compatible with iPhone, iPod touch, and iPad and Requires iOS 3.1 or later. The application can be downloaded from http://itunes.apple.com/us/app/medknow-journals/ id458064375?ls=1&mt=8. For suggestions and comments do write back to us. www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
