MoLEcuLAR AND CELLULAR BIOLOGY, Nov. 1992, p. 4994-5003 0270-7306/92/114994-10$02.00/0 Copyright © 1992, American Society for Microbiology

Vol. 12, No. 11

A Novel Myoblast Enhancer Element Mediates MyoD Transcription STEPHEN J. TAPSCOTT,* ANDREW B. LASSAR,t AND HAROLD WEINTRAUB Fred Hutchinson Cancer Research Center, Howard Hughes Medical Institute Laboratory, 1124 Columbia Street, Seattle, Washington 98104 Received 14 January 1992/Returned for modification 2 June 1992/Accepted 3 August 1992

The MyoD gene can orchestrate the expression of the skeletal muscle differentiation program. We have identified the regions of the gene necessary to reproduce transcription specific to skeletal myoblasts and myotubes. A proximal regulatory region (PRR) contains a conserved TATA box, a CCAAT box, and a GC-rich region that includes a consensus SP1 binding site. The PRR is sufficient for high levels of skeletal muscle-specific activit in avian muscle cells. In murine cells the PRR alone has only low levels of activity and requires an additional distal regulatory region to achieve high levels of muscle-specific activity. The distal regulatory region differs from a conventional enhancer in that chromosomal integration appears necessary for productive interactions with the PRR. While the Moloney leukemia virus long terminal repeat can enhance transcription from the MyoD PRR in both transient and stable assays, the simian virus 40 enhancer cannot, suggesting that specific enhancer-promoter interactions are necessary for PRR function.

shown that Myf5 and myogenin expression precede MyoD in the somites. In the mouse limb bud Myf5 appears first and is followed by the near coincident expression of both MyoD and myogenin in the replicating myoblasts. While MyoD and myogenin RNA levels are high in myoblasts in situ, MyoD and myogenin RNA rapidly decline following fusion into myotubes, and MRF4 RNA levels rise. In contrast to the relatively late appearance of MyoD RNA in mouse studies, other species show an earlier expression of MyoD. In chickens, MyoD is expressed prior to muscle structural genes in the somites (9). In frogs, MyoD is a maternal gene product (14, 16, 32). Its zygotic expression is globally activated at the mid-blastula transition and stabilized in responsive cells by mesoderm induction, in particular by inducing growth factors (29). Finally, in Caenorhabditis elegans, a MyoD-related gene is expressed in early myogenic precursors (18). To begin to understand how MyoD is regulated during development and suppressed in nonmuscle cells or by oncogenes or bromodeoxyuridine, we have begun to study the cis-acting regulatory regions associated with the mouse MyoD gene. We have identified two important regions that regulate muscle-specific transcription: (i) a proximal regulatory region (PRR) adjacent to the transcription start site whose necessary elements include a GC-rich region that has a consensus SP1 binding site, a CCAAT box, and an ATAAATA sequence; and (ii) a distal regulatory region (DRR) that lies approximately -5 kb from the transcription start site. The DRR is unusual in that it requires stable integration into the chromosome for its action; the PRR is distinguished in that it seems to require specific interactions with elements in the DRR.

The myogenic regulatory protein MyoD belongs to the helix-loop-helix (HLH) family of proteins (for reviews, see references 25, 35, and 41). Some HLH proteins, such as the products of the E2A gene, are expressed in a wide variety of cell types, whereas other members have an expression pattern restricted to a specific cell type. MyoD is expressed only in skeletal myoblasts and muscle cells (8), along with three other related members of the myogenic HLH protein subfamily: Myf5 (6), myogenin (12, 43), and MRF4 (5, 23, 28). MyoD has been shown to be a transcriptional activator of many muscle structural genes interacting with a consensus binding sequence in the enhancer regions of these genes (19). Expression of the MyoD protein in a large number of primary cells and cell lines is sufficient to convert these cells to skeletal myoblasts (7, 42). Since MyoD is a master regulatory gene of myogenesis, understanding the regulation of MyoD transcription may help to understand the events leading to myogenic commitment and differentiation. Currently, very little is known about the regulation of MyoD transcription. Members of the myogenic HLH subfamily (MyoD, Myf5, myogenin, and MRF4) have been shown to positively regulate transcription of other myogenic HLH subfamily members and to positively autoregulate their own transcription (4, 23, 28, 36). In addition to. the positive regulation of MyoD transcription, both by itself and other myogenic HLH proteins, there is evidence to suggest that primary fibroblasts actively suppress MyoD transcription through loci that map to mouse chromosomes 4 and 8 (37). The importance of MyoD expression in regulating cell differentiation is suggested by the fact that many active oncogenes, as well as the thymidine analog bromodeoxyuridine (BrdU), block muscle differentiation through the suppression of MyoD transcription (21, 34), although many oncogenes also inhibit the activity of the MyoD protein. In situ studies in the developing mouse (2, 15, 26, 31) have

MATERIALS AND METHODS RNase protection assays. RNase protection assays were performed as previously described (34). Genomic sequence representing the 5' end of the MyoD gene was cloned into the Bluescribe vector (Stratagene), and T7 polymerasegenerated transcripts were made in the presence of [a-32PJCTP. The RNA probe corresponded to genomic po-

* Corresponding author.

t Present address: Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115. 4994

VOL. 12, 1992

sitions -592 to +95 relative to the major start site of transcription. Probe (105 cpm) was hybridized overnight at 65°C to 10 ,ug of total RNA in 20 ,ul of hybridization buffer (40 mM PIPES [1,4-piperazinediethanesulfonic acid; pH 6.4], 0.4 M NaCl, 1 mM EDTA, and 80% formamide). The next day 250 ,il of digestion buffer (10 mM Tris [pH 7.4], 300 mM NaCl, and 5 mM EDTA) with RNase A (5 pg/ml) and RNase Ti (40 U/ml) was added, and the samples were incubated at 30°C for 30 min. The samples were brought to 0.5% sodium dodecyl sulfate, and proteinase K (0.2 mg/ml) was added and incubated at 37°C for 15 min. Carrier transfer RNA was added, and the samples were extracted with phenol-chloroform and precipitated with ethanol. The protection products were separated by electrophoresis on an 8% acrylamide-7 M urea gel. Transfections and CAT assays. Regions of the MyoD gene were cloned into either the chloramphenicol acetyltransferase (CAT) reporter plasmid PT-CAT (gift of Richard Harland) or, in the case of the simian virus 40 (SV40) enhancer/ promoter constructs, into the Promega CAT vectors. Cells were grown in 6-cm tissue culture plates in either 15% bovine calf serum (Hyclone) for murine cell lines or 10% heat-inactivated horse serum with 2% chicken embryo extract for the chick muscle or fibroblast cultures. Chick muscle cultures were established from pectoral muscle of an 11-day embryo as previously described (10), and chick fibroblast cultures were established from the dermis of an 11-day embryo by trypsin dissociation and repeated subculture. Tertiary and quartenary cultures were used in these experiments. Transient transfections with CaPO4 precipitate were performed as previously described (8). Calcium phosphate transfections were performed approximately 36 h after plating by using 5 ,ug of plasmid per plate and letting the precipitate stand on the cells overnight in a 37°C, 5% CO2 incubator, at which time the cells were washed and refed. After an additional 12 h, the murine cells were switched to Dulbecco modified Eagle medium supplemented with 5 jig of insulin per ml and 10 pg of transferrin per ml (differentiation medium). Murine cells were harvested for CAT assays a total of 72 h following transfection, and avian cells were harvested a total of 96 h after transfection. Cells were rinsed with phosphate-buffered saline (PBS) and scraped into a total volume of 100 pl of PBS. CAT assays were performed by the method of Sleigh (33). Briefly, cells were freezethawed three times and heated to 65°C, and the supernatant was added to a cocktail containing 1.6 mM chloramphenicol, 150 mM Tris-HCl (pH 7.8), 90 p,M acetyl coenzyme A, and 1.0 pCi of [14C]acetyl coenzyme A (Amersham) per ml and incubated at 37°C for 1 h. The mixture was extracted once with 0.4 ml of cold ethyl acetate, and the organic phase was counted in a scintillation counter. Standard amounts of CAT were used to standardize assays. For stable transfections and transient transfections in murine cell lines, electroporation was used in addition to calcium phosphate precipitation. Data presented in this paper are derived from electroporated cells but do not differ from those derived from cells transfected by calcium phosphate. Approximately 5 x 106 cells were placed in a 0.4-cm Bio-Rad electroporation chamber in 0.8 ml of PBS (pH 7.4) with 1 ,ug of linearized pSV2neo or pSV2-Gpt and 20 ,g of linearized CAT reporter construct or genomic MyoD construct. Electroporation parameters were 300 V and 950 p,F. Cells were plated in a 15-cm dish and selected in 0.4 g of active geneticin (GIBCO) per ml. Each plate typically contained 300 to 1,000 colonies, which were pooled as poly-

MyoD TRANSCRIPTION

4995

clones for CAT assays or fixed and stained for myosin heavy chain by using the MF20 antibody, as described previously (8), to determine efficiency of MyoD genomic constructs to convert 1OT1/2 cells to muscle. Gel mobility binding assays. Nuclear extracts were performed as described by Lassar et al. (20). Each 15-cm plate of confluent cells was rinsed with Tris-buffered saline, and the cells were scraped off in 2.5 ml of lysis buffer (20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; pH 7.6], 20% glycerol, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 10 ,ug of leupeptin per ml, 10 ,ug of pepstatin per ml, 100 ,ug of aproteinin per ml), dounced 20 strokes with an A pestle on ice, and centrifuged for 10 min at 2,000 rpm. The nuclei were resuspended in nuclear extraction buffer (lysis buffer with 500 mM NaCl) at 5 x 107 cells per ml, rocked gently for 1 h at 4°C, and centrifuged at 12,000 rpm for 10 min, and the supernatant was stored at -80°C. Mobility shift assays utilized 3 tl of nuclear extract (protein concentrations ranged from 20 to 25 p,g/,ul for murine cells and 6 to 8 ,ug/pl for avian cells) added to 27 ,ul of a solution of 3% glycerol, 20 mM HEPES (pH 7.6), 1.5 mM MgCl2, 0.4 to 0.5 p,g of poly(dI-dC), and 0.2 ng of probe (10,000 to 60,000 cpm). After 20 min at room temperature, the samples were placed on ice for S min and loaded onto 5% acrylamide gels containing 50 mM Tris base, 50 mM boric acid, and 1 mM EDTA. Electrophoresis was done at 200 V for 5 h at 4°C. Double-stranded oligonucleotides used for probes and competition were as follows: GC, 5'CCAAGCTCCGCC CTACTACA3'; MC, 5'TACACTCCTATTGGCTTGAGG3'; M*C, 5'TACTAfLGIACCTATTGGCITGAGG3'; and MC*,

5'TACTACACTCCTAIUATITGAGG3'. RESULTS

The mouse MyoD gene. To isolate the MyoD gene, a mouse liver cosmid library made from the A/J strain mouse (a generous gift from Glen Evans) was screened with a MyoD cDNA. Seven cosmids that hybridized to the MyoD cDNA were isolated, and restriction analysis demonstrated that these represented five distinct, overlapping cosmids that encompassed approximately 60 kb. The cDNA hybridization was limited to a region of about 3 kb. Sequence from this region confirmed the identity of the gene as MyoD and demonstrated the presence of two introns (Fig. 1), the first of which begins after the HLH domain. In addition to the two introns, a short sequence within the 3' untranslated cDNA diverged from the genomic sequence. Restriction site and polymerase chain reaction analysis of genomic DNA (data not shown) demonstrated that this 17-nucleotide sequence represented a genetic polymorphism between the C3H strain from which the cDNA was cloned and the A/J strain from which the genomic library was cloned, rather than a short intron. RNase protection assays on myoblast and myotube total RNA were used to determine the site of transcription initiation. The major fraction of the RNA extended approximately 40 nucleotides 5' of the previously characterized cDNA, and a minor fraction extended an additional 20 nucleotides 5' (Fig. 2). Identical transcription initiation sites were also determined by using primer extension assays (data not shown). There was no apparent difference in the utilization of the two start sites in myoblasts or myotubes, nor was

TAPSCOTT ET AL.

4996

MOL. CELL. BIOL.

(1 276)

cgaATG

(1 674)

7=ArC

IH:II\ \

I

GccTCaggtGGTGGAAT GCgC CATGgtaa (2609) (829) (1 354) FIG. 1. Schematic representation of the MyoD gene. Boxes represent exons with shaded area corresponding to the basic helix-loop-helix domain. Sequences represent exon-intron boundaries with the numbers in parantheses representing the ordinal position of the first or last exonic nucleotide relative to the major start site of transcription. The 17-nucleotide polymorphism between the C3H and A/J strain mice is shown at the 3' end of the gene.

there a significant difference between azacytidine-derived myoblasts and the C2 myoblast cell line. A PRR confers muscle-specific activity in chick muscle. Portions of the MyoD gene extending up to 7 kb 5' to the point of translation initiation were cloned upstream of the bacterial reporter CAT gene. These constructs were transfected into mouse muscle cell lines (incruding both the 1 OT1/2

F3

LTR-MD

G D G D G D

160

.IW

.-

.MWIL

147

'I

4-

Minor Start Site

4- Major

Start Site

123 110

90

LTR Start Site

FIG. 2. RNase protection of RNA with a probe overlapping the region of transcription initiation of the MyoD gene. No fragments are protected from 1OT1/2 cell RNA, which is consistent with the absence of MyoD transcription in these cells. The F3 myoblast cell line shows two protected fragments in both high-serum growth conditions (G) and low-serum differentiation conditions (D). The fragments are approximately 20 nucleotides apart and represent the minor (larger fragment) and major (smaller fragment) start sites of transcription. Expression of the MyoD protein in 1OT1/2 cells by stable transfection with an LTR-driven cDNA (LTR-MD) is capable of activating the transcription of the endogenous MyoD gene, as previously reported (36).

C2C12 cell line [1] and the F3 cell line [8], a myoblast cell line derived from 1OT1/2 cells following treatment with azacytidine). These transient assays in the mouse muscle cell lines did not reliably demonstrate activity above background levels (data not shown) (see Table 3). Other investigators have shown that various muscle cell lines differ in their ability to support transcription from transfected muscle genes; therefore, we also assayed the MyoD-CAT constructs in transient assays in the L6, H9C2, and BC3H muscle lines, as well as the RD human rhabdomyosarcoma cell line with similar negative results (data not shown). In distinct contrast to transfections into the above myoblast lines, transfection of the constructs into primary chick muscle cells demonstrated that the region between -275 and -50 conferred high levels of activity (Fig. 3B, line 1). Additional upstream sequence of up to 7 kb did not enhance this level of activity (data not shown). This activity was specific to muscle cells in that the constructs were inactive in chick dermal fibroblasts (Fig. 3B, line 1). RNase protection assays demonstrated that the MyoD-CAT constructs faithfully replicated the transcription start sites of the mouse MyoD gene when expressed in chick muscle cells (data not shown). Since transient transfection assays in the avian system showed muscle-specific transcription and used the appropriate murine MyoD transcription start sites, we used transient transfections into primary chick muscle cells to initially map the important proximal regulatory regions of the mouse MyoD gene. We have subsequently been able to demonstrate that the major conclusions derived from the avian system can be confirmed in murine muscle cells when enhancer-containing constructs are assayed as stable integrants in chromosomal DNA (see below). The sequence of the 275-bp region that confers activity in chick muscle cells contains several interesting motifs (Fig. 3A). Additional deletions were made in the 275-bp region, and these were again assayed for activity in primary chick muscle cultures and chick fibroblasts (Fig. 3B). It is of interest that a region containing two MyoD binding sites can be deleted without any measurable loss of activity, even though these sites can support MyoD-dependent transcriptional activation when cloned into a reporter construct containing either the thymidine kinase or muscle creatine kinase minimal promoter region driving CAT (data not shown). In fact, a region of only 40 nucleotides in addition to the region of transcriptional initiation was both necessary and sufficient for nearly full activity compared with the larger constructs. This 40-nucleotide region contains a GCrich region with a consensus SP1 site (17), a CCAAT box (11, 38), and a six of seven match for an M-CAT binding

MyoD TRANSCRIPTION

VOL. 12, 1992

A

MYOD B CACXGCGTATGCiX -275 TAGACACTGGAGAGGS11 ATAGc4CU(

Probe:

CF c

Z

Nuclear Extract: CF

CM

CMNA

CF

A -21 5 GCCAGrCCCCrGcCCXTTC1TAGCTAG=(ACAGAGTCGCGGAGG

-9 5

4997

a

S F.1 GGccTAATAGGCrA

-35 cXCT TT _ Aoc -3 5

CGC

B

CM

CF

100

1

100

1

-275

-160

ml

-50 -80 2r-9

-10

110 -

MmCZ

0Q M

0.5

4

EUl

-120 -ZO

-160

4

-M

-3300MCK

6

0.2

9

ND

85

ND

160

ND

160

2

FIG. 3. The PRR. (A) Nucleotide sequence of the mouse MyoD gene between -275 and +20 relative to the major transcriptional start site. T, ATAAATA element; S, GC-rich regions containing consensus sequence for SP1 binding site; C, CCAAT sequence; M, close match to M-CAT binding sequence; AP2, consensus AP2 binding site; A, potential MyoD binding site within context of larger palindromes; B, near direct repeat of A, but with additional nucleotide disrupting potential MyoD binding site; MYOD, potential MyoD binding site containing core consensus sequence CANNTG without surrounding direct repeat of A or B. (B) Regions of the PRR between -275 and -10 relative to the major start site were cloned upstream of the CAT reporter gene and transfected in transient assays into either primary chick muscle cultures (CM) or tertiary chick dermal fibroblast cultures (CF). Parallel cultures transfected with a CAT construct driven by the Moloney sarcoma virus LTR were used to normalize the CAT assay values for transfection efficiency. The value in the chick muscle cultures was set to 100. All numbers are an average of three to nine transfections. Line 9 represents transfection with a CAT construct driven by the regulatory regions of the muscle creatine kinase (MCK) gene as a control for relative level of activity between MyoD and another characterized muscle-specific gene. 2, consensus AP2 site.

the CCAAT box disrupting either resulted in less than 10% wild-type activity. Gel retardation assays show a tissue-specific CCAAT binding factor(s) in avian cells. In order to identify tissue-specific factors that interact with the proxNmal regulatory region, double-strand synthetic oligonucleotides were used in gel retardation assays with nuclear extracts from cultured chick muscle or chick dermal fibroblasts (Fig. 4). An oligonucleotide containing the upstream GC-rich region containing the consensus SP1 site interacted with nuclear proteins in both

sequence (22). Both the GC-rich region and were necessary for activity, since deletions

dermal fibroblasts and skeletal muscle cells. In contrast to

1

2

3

4

FIG. 4. Gel retardation assays demonstrating a muscle-specific factor binding to an oligonucleotide containing M-CAT and CCAAT sequence from the MyoD PRR. An oligonucleotide containing the GC-rich region (GC) with a consensus SP1 binding site was used as a probe in lanes 1 and 2, and an oligonucleotide containing the potential M-CAT and CCAAT sites (MC) was used as a probe in lanes 3 and 4. Nuclear extracts were from tertiary chick dermal fibroblasts (CF) and primary chick muscle cultures (CM). For all lanes, 0.2 ng of probe and 500 ng of poly(dI-dC) were used.

the results with the GC-rich site as a probe, only nuclear extracts from skeletal muscle, and not from dermal fibroblasts, contained a factor(s) that interacted with an oligonucleotide (MC) containing the M-CAT and CCAAT sequence (Fig. 4, lanes 3 and 4). Gel retardation assays with probes containing mutations disrupting either the M-CAT site (M*C) or the CCAAT site (MC*) (Fig. 5, lanes 4 and 5) demonstrate that the factor(s) is interacting with the CCAAT sequence and not the potential M-CAT site. While we have not tested the functional significance of mutations in the potential M-CAT binding site in the MyoD PRR, the absence of a factor binding to this site in gel retardation assays (MC* probe [Fig. 5, lanes 5, 11, and 14]) suggests that it does not contain sufficient homology to the M-CAT site to bind the M-CAT binding factor that is present in both C2C12 and F3 cells (20). In addition to being present in chick skeletal muscle cells, the CCAAT binding factor(s) is also present in the mouse myoblast cell lines C2C12 (Fig. 5, lanes 6 to 11) and F3 (data not shown) and in the mouse fibroblast cell lines 1OT1/2 and NIH 3T3 (Fig. 5, lanes 12 to 14, and data not shown). The factor binding to the GC-rich region is present in all the tested murine cell lines as well (data not shown). We cannot

4998

TAPSCOTT ET AL.

MOL. CELL. BIOL. Chick Muscle

Nuclear Extract: Probe: Competitor:

MC

1

MC MC

2

MC

GC

3

C2C1 2 Myoblasts

M*C MC*

4

MC -

-

5

6

MC MC

7

MC

C2C 12 Myotubes

1 OT1 12 Cells

M*C MC*

MC

M*C

S_

.;,*w

lo

12

13

MC

MC*

GC

8

9

10

11

..

...

14

FIG. 5. Mutations of the MC oligonucleotide demonstrate that the CCAAT site is necessary for binding of the factor present in chick muscle. Nuclear extracts were from cultured cells as indicated. The oligonucleotides contained both the potential M-CAT and CCAAT sites (MC) or a similar oligonucleotide with mutations introduced into either the M-CAT (M*C) or CCAAT (MC*) site or the GC-rich region (GC) containing the consensus SP1 binding site. For all lanes, 0.2 ng of probe was used and 20 ng of competitor was used as indicated. All binding reactions contained 400 ng of poly(dI-dC).

determine from these assays whether the retarded species of identical mobility in different murine cell types represent binding of the same protein complex; however, the results suggest that the while the CCAAT binding factor shows a tissue-restricted pattern in avian tissues, it is apparently expressed in both myoblast and fibroblast murine cell lines. A DRR cooperates with the PRR to confer activity in mouse myoblasts and myotubes. MyoD RNA and protein are expressed in replicating C2C12 myoblasts as well as in myotubes, and as demonstrated above, these cells express the GC-rich and CCAAT binding factors associated with the PRR of the MyoD gene, yet the 270-bp PRR was inactive in both transient (data not shown) and stable assays in C2C12 myoblasts and myotubes (Table 1). In contrast, stable integrants of the MyoD-CAT constructs demonstrated high levels of activity in C2C12 myoblasts, but not in 1OT1/2 fibroblasts, that was dependent on an element between -7 and -4 kb (Table 1). As with the results from primary chick muscle cultures, deletion of the CCAAT binding sequence in the PRR resulted in a significant decrease in the activity of a DRR-containing MyoD-CAT construct in mouse myoblasts and myotubes (Fig. 6), indicating that, in this context, the same PRR elements were necessary in the murine and avian systems.

Analysis of additional deletion mutations mapped the

location of the DRR to between approximately -5.39 and -4.67 kb (Fig. 7). This 720-nucleotide region increases expression mediated by the PRR more than 100-fold in myoblasts and an additional severalfold in myotubes. This region contains three consensus MyoD binding sites and an AT-rich region that has a close match to a MEF2 site (13) and numerous close matches to binding sites for homeobox

TABLE 1. Polyclones transfected with MyoD-CAT constructsa Activity (103 cpm)

Expression vector

-0.27 kb MyoD-CAT -4 kb MyoD-CAT -7 kb MyoD-CAT

C2C12

myoblasts

1OT1/2 cells

GM

DM

GM

DM

0.5 1.0 288

0.6 5.6 861

0.3 0.3 0.6

0.3 0.3 0.6

a C2C12 myoblasts or 10T1/2 cells were electroporated with the indicated constructs and an SV2-neo plasmid. Cells were selected in G418 and assayed as polyclones consisting of 300 to 1,000 clones in either growth medium (GM) or differentiation medium (DM). Numbers represent thousands of counts per minute per unit of protein with an assay background of about 0.5.

VOL. 12, 1992

MyoD TRANSCRIPTION

4999

CAT Activity (cpm/unit protein)

-7000

-4000 -275

OE E) SI [~I

Myoblasts

Mtubes

160

523

3

16

.I-64

568 FIG. 6. Stable polyclones of C2C12 myoblasts transfected with MyoD-CAT constructs containing the DRR and either the full 275-bp PRR or deletion mutations of the PRR, as diagrammed. Numbers represent thousands of counts with background of less than 1,000.

proteins (Fig. 8). Further analysis of this myoblast/myotube enhancer region is in progress. The MyoD DRR shows muscle-specific activity only when integrated. The transient assays in primary chick muscle cells indicated that the PRR contained elements that conferred expression in skeletal muscle cells but not in fibroblasts. Since the PRR conferred cell-type-specific expression, it was possible that the DRR, which is necessary for expression in mouse skeletal muscle cells, was acting as a constitutive enhancer and that the cell type specificity was entirely dependent on the PRR. To test this, we constructed chimeric CAT expression vectors containing the DRR or PRR from MyoD and the enhancer or promoter region from SV40. When stable transfectant polyclones of either C2C12 muscle cells or 1OT1/2 cells were analyzed for CAT activity, the MyoD DRR was comparable to the SV40 enhancer in enhancing transcription from the SV40 promoter in myoblasts and myotubes, but it was at least 20- to 30-fold less active than the SV40 enhancer in 1OT1/2 cells (Table 2). While the MyoD DRR is capable of cooperating with the SV40 promoter when integrated in skeletal muscle cells, the DRR is relatively inactive in transient assays (Table 3). Therefore, by this assay, the restriction of activity to skeletal muscle appears to be mediated, at least in part, through the integrated DRR element. In addition, the results with chick myoblasts show that the PRR can also contribute to tissue specificity. -70,00

-5390 -51,10

While the DRR from MyoD could enhance transcription from the SV40 promoter, the SV40 enhancer was unable to enhance transcription from the MyoD PRR in either C2C12 or 1OT1/2 cells (Table 2). The inability of the SV40 enhancer to cooperate with the MyoD PRR in promoting transcription is surprising and indicates that the SV40 enhancer cannot interact with the factors necessary for PRR activity. Whether these factors are the same as those previously demonstrated to interact with the CCAAT site or the GCrich region remains to be determined. In contrast to the results with the SV40 enhancer, constructs containing the long terminal repeats (LTR) from the Moloney leukemia virus (MLV) as an enhancer for the MyoD PRR are active in both C2C12 myoblasts and 1OT1/2 cells, in both stable and transient assays (Tables 2 and 3). This result indicates that the PRR is capable of functioning in 1OT1/2 cells in the context of the appropriate constitutive enhancer and that the MyoD DRR requires an additional muscle-specific factor not present in 1OT1/2 cells, which might be MyoD itself. The ability of the MLV LTR to cooperate with the MyoD PRR in transient assays confirms that the DRR, and not the PRR, requires integration. MyoD-CAT constructs are activated in 1OT1/2 cells by MyoD. Although the MyoD-CAT constructs are active in myoblasts and myotubes, stable integrants of these constructs in 1OT1/2 cells were relatively inactive (Tables 1 and 2), in a manner similar to the inactivity of the endogenous -3850

+95

Acfnvrry 100

3

-e~l TOOr

4

1-111,

100

-58|70

-4670

-270

Ist

100

100

5

4

6

100

7

8

_t01,

100 100

9

r-l

1

10 11

4

12

13

rFIl,J-1,

11 1

IA 14

FIG. 7. Deletion mutations of the DRR. Deletions in the DRR were made in the MyoD-CAT constructs as shown diagramatically and stably transfected into C2C12 myoblasts. The activity of the 7-kb MyoD-CAT construct (line 1) was set at 100, and the approximate relative activities of mutants are shown. For most constructs, the numbers are based on at least three separate experiments.

5000

MOL. CELL. BIOL.

TAPSCOTT ET AL. -5390

MYOD GATCTACACTTGGTGGCAGGTAGTTTCAGGCTTTCTGGGAAGCAAAACTGGCAGAGAACA

-5330

GAGCAGGATCCTTGAGTTGGGAAAGGAAAGTCTAGGGCCAGAGACGAACCTGGGGCTGGT

-5270

MYOD CCTGTTCCACCTGTCTCCCGTGGTTTCATCCTCCAGTCCTTCAGCCCCCTAGACCCAAGC

-5210

-5150

MYOD GGTGCCTGAGGCTTGGGGCAGGTGCTAGTTGGATCCGGTTTCCAGAGGCTATATATATAT

-5090

AAAGGCTGCTGTTTCCCCATGGTGCAACACCCCAGAGGCCTAGCCAGACCAACATTCCTG

-5030

CCCAAAAGCCAGCTCTCCATTTATAGCACCTTGGAAGACTAGCCAAGGGAGCTGAAATGC

-4970

AAGGCCTGGAAAGGACAGGGGGAAATCAAAGGGCCACCTATGGCGGCAGGAGAACTGAGC

-4910

CTCAGGATGAGCTGTGTGCTTCTCCAGGTCAGTGGGCCTACAGCCTAAGAGGCCCTGCAT

-4850

TGAGGGGACAATGCCTCAGCCCAGAGCCAATGGCACGCTCCAGAAGGGGTGGCTGGGGGA

-4790

A-T RICH REGION AGTTTTAGTGACCATAAAATAAAAAGCAAGGTTGCAATCACTTAGACTCAGCATAAAATT

-4730

TATTTCGGTTTTTGTTATTTGTGTGCTTGCTTTGCTTTGCTTTGTTTGCTCGGG

FIG. 8. Sequence of the DRR with consensus binding motifs identified. The region sufficient for DRR activity is between -5390 and -4670 and contains three potential MyoD binding sites and an AT-rich region that has numerous close matches to homeobox protein binding sites as well as close matches to the site for the muscle factor MEF2. This region also contains a close match to the T box of the Drosophila matrix attachment site.

1OT1/2 MyoD gene. The endogenous 1OT1/2 MyoD gene can be activated either by treatment with 5-azacytidine or by forced expression of a transfected MyoD cDNA (36). To determine whether the 7-kb MyoD-CAT construct was posTABLE 2. Activities of integrated chimeric enhancer/promoter constructse Activity (103 cpm/U of protein) Expt (enhancer,

C2C12

1OT1/2

promoter)

myoblasts

fibroblasts

Expt l None, SV40 SV40, SV40 MyoD, SV40 MyoD, MyoD Expt 2 None, SV40 SV40, SV40 SV40, MyoD

Expt 3 MyoD, MyoD MLV, MyoD

GM

DM

GM

DM

1 112 196 102

1 143 756 399

1 31 1 2

1 20 1 2

itively regulated by MyoD expression in a similar fashion, a polyclone of 1OT1/2 cells that had been transfected with the 7-kb MyoD-CAT construct was converted to myoblasts either by treatment with azacytidine or infection with a MyoD-expressing retrovirus. In both cases, the 7-kb MyoDCAT construct was activated coincident with the activation of muscle differentiation and the endogenous MyoD gene, whereas MyoD-CAT constructs lacking the DRR were not significantly activated in muscle cells. These experiments demonstrate that MyoD interacts with the DRR in 1OT1/2 cells, either directly through the MyoD binding sites or indirectly through the activation of another trans-acting factor and that this interaction permits an amplification of the signal from the PRR. TABLE 3. Activities of chimeric enhancer/promoter constructs in transient assays' ACtivity (103

1 62 1

46 83

1 111 1 98 74

1 16 1 1 23

1 28 1 1 22

a 1OT1/2 cells and C2C12 myoblast polyclones transfected with chimeric enhancer/promoter CAT constructs. SV40 constructs were made in the Promega CAT plasmids. MLV is the NheI-to-XbaI fragment containing the MLV LTR. MyoD promoter extends from -275 to +95. Cells were selected in G418 and assayed as polyclones consisting of 300 to 1,000 clones in either growth medium (GM) or differentiation medium (DM). Numbers represent thousands of counts per minute with background of about 1,000 counts.

Enhancer

None

SV40 MyoD MyoD SV40 MLV

cpm/plate)

Promoter

SV40 SV40 SV40 MyoD MyoD MyoD

GM

DM

1 54 1 1 1 ND

2 59 1 1 1 9

a Transient transfections into C2C12 myoblasts with CAT reporter constructs driven by the indicated combination of enhancer and promoter. Numbers represent thousands of counts per minute with background at 1,000. Constructs and abbreviations are as described for Table 2. The numbers represent two independent transfections. ND, not determined.

MyoD TRANSCRIPTION

VOL. 12, 1992

MyoD genomic constructs convert 10TV2 cells to muscle. The experiments above demonstrate that the DRR and PRR elements together confer myoblast-specific activity on a reporter construct and that they are sufficient for expression in murine myoblasts and myotubes. While the MyoD-CAT constructs have low activity in 10T1/2 cells, the activity of the MLV LTR/MyoD-PRR CAT construct demonstrates that the PRR is capable of mediating transcription in 10T1/2 cells. Since the DRR is necessary to confer autoregulation, the inactivity of the MyoD-CAT constructs in 1OT1/2 cells, prior to the activation of the endogenous gene, might be due to the absence of signal amplification normally provided by the MyoD gene product, i.e., autoregulation, because the transcribed product was the CAT gene instead of MyoD. If this were the case, then transfection of 10T1/2 cells with MyoD genomic fragments that contained both the DRR and PRR driving the MyoD coding region might be sufficient to convert them to myoblasts. To test the above hypothesis, 10T1/2 cells were cotransfected with a selectable marker and MyoD genomic fragments that contained either -7 kb (containing both DRR and PRR) or -0.6 kb (containing PRR) 5' to the start site and included the entire coding region with the presumptive poly(A) site. A control vector was also made to test the functional integrity of the coding region and poly(A) site of the genomic constructs by cloning the Moloney sarcoma virus LTR and promoter upstream of the MyoD coding region. Clones of stable transfectants were selected and switched to differentiation medium to score for myogenesis. The frequency of colonies containing muscle cells, as determined by immunohistochemical localization of myosin heavy chain, was similar in the genomic transfected cells and the LTR MyoD cells (10 to 40% of the colonies) (data not shown). Whereas the colonies transfected with genomic clones containing the PRR without the DRR usually contained only a few scattered muscle cells, colonies transfected with DRR- and PRR-containing constructs displayed good myotube formation throughout the colony (data not shown). This suggests that the PRR has a low level of activity in 10T1/2 cells and the DRR enhances that level of activity, possibly mediated through interaction with MyoD. DISCUSSION We have identified two tissue-specific regulatory regions upstream of the mouse MyoD gene. One, proximal to the transcriptional start site (PRR), contains two consensus binding sites that are necessary for activity: a GC-rich region with a consensus SP1 site and a region containing a CCAAT sequence. In murine muscle cell lines, the PRR is silent unless a second element, the DRR, is also present. The DRR is active when mouse myoblasts are grown in serum; hence, it is a myoblast-specific response element. The DRR requires integration into the chromosome for activity; the PRR requires specific elements in the DRR for its activity. The PRR. In primary chick cell cultures the PRR shows tissue-specific expression in transient assays. This could be attributable to the tissue-specific expression of a factor that binds the CCAAT-containing region of the PRR. In contrast to primary chick cells, the PRR has a relatively low amount of activity in mouse muscle cell lines, despite the fact that both muscle cell lines and fibroblast cell lines contain the factors that are apparently essential for PRR activity-the CCAAT and GC-rich binding factors. A potential explanation for the inactivity in mouse tissues would be that additional promoter factors are highly abundant in avian

5001

cells, while in mouse cells an enhancer is needed to focus similar factors, present at a much lower concentration, to the promoter. Alternatively, the DRR may be instrumental in removing a negative regulatory factor present in mouse, but not chick, muscle cells. The DRR. The DRR is necessary in addition to the PRR for muscle-specific activity in mouse muscle cell lines. Overlapping deletions of the 5' region of the MyoD gene map a necessary region of the DRR between -5.39 and -4.67 kb. Additional attempts to further restrict the size of the DRR showed that each half of the 720-bp region was necessary, suggesting that several elements must cooperate for activity. While numerous binding motifs for known transcriptional activator proteins exist outside the minimal essential DRR region, the minimal DRR itself is relatively devoid of recognizable consensus binding motifs with the exception of MyoD binding sites. Further analysis of this region will be needed to identify the binding sites of factors that mediate transcription in replicating myoblasts. An unusual feature of the DRR is the requirement for integration to achieve enhancer activity. This requirement for integration is also true for the hemoglobin locus control region (LCR) (24). In neither case is there an understanding of the role integration plays in regulating the activity of these regions. Both the LCR and the DRR contain enhancerlike activity, while another element, the A element from the lysozyme gene (3), gives copy number-dependent expression (reflecting its ability to prevent negative effects from surrounding chromatin) but lacks enhancer activity. We have not yet tested whether the DRR confers copy numberdependent expression and, if so, whether this activity is separable from its enhancement activity. We do not believe that the integration site is significantly affecting the activity of the DRR in myoblasts, since the assays of expression used pools of 300 to 1,000 clones and a random sampling of individual clones demonstrated that approximately 50% showed activity. Another curious feature of the DRR is that it is required for PRR activity in mouse muscle but not in chick muscle. This is similar to the MCK enhancer, which is necessary for full activity of the MCK promoter in mouse cells but confers only modest enhancement in transient assays in chick cells (44). As suggested above, the differences in PRR activity among muscle cell types may have to do with a varying abundance of unidentified proximal activation or repressing factors, but a real understanding of the phenomenon will have to await identification of the factors involved. The PRR activity is dependent on specific enhancer elements. An unexpected activity of the PRR is its failure to support enhancement by the SV40 enhancer, despite full activity with the DRR and MLV LTR. Specific pairwise interactions between proximal elements and enhancers have been previously described (39) and may represent the ability of each element to interact with specific trans-acting factors that form a bridge between the two elements. Our data suggest that the integrated MyoD DRR interacts with a muscle-specific factor(s) that is necessary for the function of the PRR and that the SV40 enhancer is unable to recognize this PRR factor or enforce a substitute factor. In contrast, the MLV LTR is able to cooperate with the PRR in both transient and stable assays, demonstrating again that it is the DRR element that requires integration and permitting analysis of PRR function in non-muscle cell types. Further analysis of this interaction is clearly in order; in particular, one wonders whether such specificity reflects more fundamental differences between the DRR-PRR interaction than

5002

TAPSCOTT ET AL.

that usually seen with enhancer and promoter combinations. Whether this may be mediated by the unusual TATA box sequence remains to be determined. The sequence of the ATAAATA element, which presumably represents the TATA box for the MyoD gene, is conserved in the mouse and Xenopus (30) gene, suggesting that this element may confer some transcriptional specificity, as has been demonstrated for the myoglobin and chicken cardiac actin TATAA element (27, 40). Given the very low levels of activity of the PRR, either alone or in conjunction with the SV40 enhancer, it seems reasonable to speculate that a negative factor may suppress the PRR activity and that the DRR is necessary, in part, to relieve that negative regulation. This might explain why the SV40 enhancer, which has been shown to cooperate with an SP1 binding site, cannot activate transcription through the PRR. Activity of MyoD constructs in 10T1/2 cells. There is reason to anticipate that the MyoD gene should be able to activate myogenesis in 10T1/2 cells. Thayer and Weintraub (37) showed that when human chromosome 11, which contains the human MyoD gene, is transferred to 1OT1/2 cells by microcell fusion the MyoD locus is activated. One interpretation of this datum is that the 1OT1/2 endogenous gene is inactive because of methylation, whereas the gene from the human chromosome is not methylated and, therefore, can respond to regulatory factors present in the 1OT1/2 cells. The conversion of 1OT1/2 cells to muscle following transfection with MyoD genomic constructs is consistent with the notion that the endogenous gene is controlled in cis. The PRR shows a low level of activity in 1OT1/2 cells; the DRR enhances this level of transcription in genomic constructs whose product is MyoD but not in constructs whose expressed product is CAT. Since the DRR-containing vectors are responsive to MyoD and core binding sites for MyoD are present in the DRR, we conclude that the low level of transcriptional activity of the PRR in 1OT1/2 cells is enhanced by positive feedback of MyoD through the DRR. The generation of muscle in cells transfected with the fragments containing the PRR, but lacking the DRR, may reflect activation of the endogenous MyoD gene. In conclusion, an analysis of the control elements associated with the MyoD gene has uncovered several unusual, yet not unprecedented, features: (i) tissue-specific elements associated with both the DRR and PRR, (ii) a PRR that responds only to specific upstream elements, and (iii) a DRR that functions only when integrated. While none of these individual qualities is unique to the MyoD gene, the combination is unusual and may reflect a general mechanism to achieve rigorous developmental regulation of genes that control differentiation programs, such as MyoD. We anticipate that analysis of these constructs in transgenic mice will yield insight into the relative contribution of these different regions to the developmental expression of MyoD. ACKNOWLEDGMENTS We thank Vicki Akins for excellent technical assistance in per-

forming CAT assays and Audrey Huang for help in constructing some of the CAT expression vectors. S.J.T. is a McDonnell Fellow in Molecular Medicine in Cancer Research. H.W. is a Howard Hughes Investigator and is supported by NIH funding. A.B.L. is a Lucille Markey Scholar, and this work was supported in part by the Lucille P. Markey Charitable Trust.

MOL. CELL. BIOL.

REFERENCES 1. Blau, H. M., C.-P. Chiu, and C. Webster. 1983. Cytoplasmic activation of human nuclear genes in stable heterokaryons. Cell 32:1171-1180. 2. Bober, E., G. Lyons, T. Braun, G. Cossu, M. Bucidngham, and H. H. Arnold. 1991. The muscle regulatory gene myf-6 has a biphasic pattern of expression during early mouse development. J. Cell Biol. 113:1255-1256. 3. Bonifer, C., A. Hecht, H. Saueressig, D. M. Winter, and A. E. Sippel. 1991. Dynamic chromatin: the regulatory domain organization of eukaryotic gene loci. J. Cell. Biochem. 47:99-108. 4. Braun, T., E. Bober, G. Guschhausen-Denker, S. Kohtz, K. H. Grzeschik, H. H. Arnold, and S. Kotz. 1989. Differential expression of myogenic determination genes in muscle cells: possible autoactivation by the Myf gene products. EMBO J. 8:36173625. 5. Braun, T., E. Bober, B. Winter, N. Rosenthal, and H. H. Arnold. 1990. Myf-6, a new member of the human gene family of myogenic determination factors: evidence for a gene cluster on chromosome 12. EMBO J. 9:821-831. 6. Braun, T., G. Buschhausen-Denker, E. Bober, E. Tannich, and H. H. Arnold. 1989. A novel human muscle factor related to but distinct from MyoDl induces myogenic conversion in 1OT1/2 fibroblasts. EMBO J. 8:701-709. 7. Choi, J., M. L. Costa, C. S. Mermelstein, C. Chagas, S. Holtzer, and H. Holtzer. 1990. MyoD converts primary dermal fibroblasts, chondroblasts, smooth muscle and retinal pigment epithelial cells into striated, mononucleated myoblasts and multinucleated myotubes. Proc. Natl. Acad. Sci. USA 87:7988-7992. 8. Davis, R. L., H. Weintraub, and A. B. Lassar. 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987-1000. 9. de la Brouse, F. C., and C. P. Emerson, Jr. 1990. Localized expression of a myogenic regulatory gene, qmfl, in the somitic dermatome of avian embryos. Genes Dev. 4:567-581. 10. Dienstman, S. R., and H. Holtzer. 1977. Skeletal myogenesis: control of proliferation in a normal cell lineage. Exp. Cell Res.

107:355-364. 11. Dorn, A., J. Bollekens, A. Staub, C. Benoist, and D. Mathis. 1987. A multiplicity of CCAAT box-binding proteins. Cell 50:863-872. 12. Edmondson, D. G., and E. N. Olson. 1989. A gene with homology to the myc similarity region of MyoDl is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev. 3:628640. 13. Gossett, L. A., D. J. Kelvin, E. A. Sternberg, and E. N. Olson. 1989. A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol. Cell. Biol. 9:5022-5033. 14. Harvey, R. P. 1990. The Xenopus MyoD gene: an unlocalized mRNA predates lineage restricted expression in the early embryo. Development 108:669-690. 15. Hinterberger, T. J., D. A. Sassoon, S. J. Rhodes, and S. F. Konieczny. 1991. Expression of the muscle regulatory factor MRF4 during somite and skeletal myofiber development. Dev. Biol. 147:144-156. 16. Hopwood, N. D., A. Pluck, and J. B. Gurdon. 1990. MyoD expression in the forming somites is an early response to mesoderm induction in Xenopus embryos. EMBO J. 8:34093417. 17. Jones, N. C., P. W. Rigby, and E. B. Ziff. 1988. trans-acting protein factors and the regulation of eukaryotic transcription: lessons from studies on DNA tumor viruses. Genes Dev. 2:267-281. 18. Krause, M., A. Fire, S. Harrison, J. Preiss, and H. Weintraub. 1990. CeMyoD accumulation defines the body wall muscle cell fate during C. elegans embryogenesis. Cell 63:907-919. 19. Lassar, A. B., J. N. Buskin, D. Lockshon, R L. Davis, S. Apone, S. D. Hauschka, and H. Weintraub. 1989. MyoD is a sequencespecific DNA binding protein requiring a region of myc homology to bind to the muscle creatinine kinase enhancer. Cell 58:823-831. 20. Lassar, A. B., R. L. Davis, W. E. Wright, T. Kadesch, C. Murre,

VOL. 12, 1992

21.

22.

23. 24. 25.

26.

27.

28. 29.

30. 31.

32.

33.

A. Voronova, D. Baltimore, and H. Weintraub. 1991. Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 66:305-315. Lassar, A. B., M. J. Thayer, R. W. OvereUl, and H. Weintraub. 1989. Transformation by activated ras or fos prevents myogenesis by inhibiting expression of MyoDl. Cell 58:659-667. Mar, J. H., and C. P. Ordahl. 1988. A conserved CATTCCT motif is required for skeletal muscle-specific activity of the cardiac troponin T gene promoter. Proc. Natl. Acad. Sci. USA 85:6404-408. Miner, H. H., and B. Wold. 1990. Herculin, a fourth member of the MyoD family of myogenic regulatory genes. Proc. Natl. Acad. Sci. USA 87:1089-1093. Moon, A. M., and T. J. Ley. 1991. Functional properties of the beta globin locus control region in K562 erythroleukemia cells. Blood 77:2272-2284. Olson, E. N. 1990. MyoD family: a paradigm for development. Genes Dev. 4:1454-1461. Ott, M. 0., E. Bober, G. Lyons, H. H. Arnold, and M. Buckingham. 1991. Early expression of the myogenic regulatory gene, myf-5, in precursor cells of skeletal muscle in the mouse embryo. Development 111:1097-1107. Quitschke, W. W., L. Deponti-Zilli, Z. Y. Lin, and B. M. Patterson. 1989. Identification of two nuclear factor-binding domains on the chicken cardiac actin promoter: implications for regulation of the gene. Mol. Cell. Biol. 9:3218-3230. Rhodes, S. J., and S. F. Konieczny. 1989. Identification of MRF4: a new member of the muscle regulatory factor gene family. Genes Dev. 3:2050-2061. Rupp, R A. W., and H. Weintraub. 1991. Ubiquitous MyoD transcription at the midblastula transition precedes inductiondependent MyoD expression in presumptive mesoderm of X. laevis. Cell 65:927-937. Rupp, R. A. W., and H. Weintraub. Unpublished data. Sassoon, D., G. Lyons, W. Wright, V. Lin, A. Lassar, H. Weintraub, and M. Buckingham. 1989. Expression of two myogenic regulatory factors: myogenin and MyoD during mouse embryogenesis. Nature (London) 314:303-307. Scales, J. B., E. N. Olson, and M. Perry. 1990. Two distinct Xenopus genes with homology to MyoDl are expressed before somite formation in early embryogenesis. Mol. Cell. Biol. 10:1516-1524. Sleigh, M. J. 1986. A nonchromatographic assay for expression

MyoD TRANSCRIPTION

34.

35. 36.

37.

38.

39.

40.

41.

42.

43. 44.

5003

of the chloramphenicol acetyltransferase gene in eucaryotic cells. Anal. Biochem. 156:251-256. Tapscott, S. J., R L. Davis, A. B. Lassar, and H. Weintraub. 1989. 5-Bromo-2'deoxyuridine blocks myogenesis by extinguishing expression of MyoDl. Science 245:532-536. Tapscott, S. J., and H. Weintraub. 1991. MyoD and the regulation of myogenesis by helix-loop-helix proteins. J. Clin. Invest. 87:1133-1138. Thayer, M. J., S. J. Tapscott, R L. Davis, W. E. Wright, A. B. Lassar, and H. Weintraub. 1989. Positive autoregulation of the myogenic determination gene MyoDl. Cell 58:242-248. Thayer, M. J., and H. Weintraub. 1990. Activation and repression of myogenesis in somatic cell hybrids: evidence for transnegative regulation of MyoD in primary fibroblasts. Cell 63:2332. Umek, R. M., A. D. Friedman, and S. L. McKnight. 1991. CCAAT-enhancer binding protein: a component of a differentiation switch. Science 251:288-292. Wang, W., and J. K Gralla. 1991. Differential ability of proximal and remote element pairs to cooperate in activating RNA polymerase II transcription. Mol. Cell. Biol. 11:4561-4571. Wefald, F. C., B. H. Devlin, and R. S. WiBlams. 1990. Functional heterogeneity of mammalian TATA-box sequences revealed by interaction with a cell-specific enhancer. Nature (London) 344:260-262. Weintraub, H., R. Davis, S. Tapscott, M. Thayer, M. Krause, R. Benezra, T. K. Blackwell, D. Turner, R. Rupp, S. Hollenberg, Y. Zhuang, and A. Lassar. 1991. The myoD gene family: nodal point during specification of the muscle cell lineage. Science 251:761-766. Weintraub, H., S. J. Tapscott, R. L. Davis, M. J. Thayer, M. L Adam, A. B. Lassar, and A. D. Miller. 1989. Activation of muscle specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc. Natl. Acad. Sci. USA 86:5434-5438. Wright, W. E., D. A. Sassoon, and V. KL Un. 1989. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56:607-617. Yi, T.-M., K Walsh, and P. Schimmel. 1991. Rabbit muscle creatine kinase: genomic cloning, sequencing, and analysis of upstream sequences important for expression in myocytes. Nucleic Acids Res. 19:3027-3033.