The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
Contents lists available at ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
Short communication
A novel centrosome and microtubules associated subcellular localization of Nogo-A: Implications for neuronal development Yajing Mi a,c,∗∗,1 , Xingchun Gao a,1 , Yue Ma b,c , Jie Gao c , Zhen Wang b , Weilin Jin a,b,c,∗ a
Institute of Basic Medicine Science, Xi’an Medical University, Xi’an 710021, China Institute of Nano Biomedicine and Engineering, Department of Instrument Science and Engineering, Key Laboratory for Thin Film and Microfabrication Technology of Ministry of Education, School of Electronic Information and Electronic Engineering, Shanghai Jiao Tong University, Shanghai 200240, China c School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China b
a r t i c l e
i n f o
Article history: Received 13 May 2014 Received in revised form 7 August 2014 Accepted 25 September 2014 Available online 5 October 2014 Keywords: Nogo-A Centrosome Microtubules Neuro2A Neuronal development
a b s t r a c t Oligodendrocyte-derived neurite-outgrowth inhibitor Nogo-A and its restriction mechanism are wellknown. Recently, Nogo-A is reported to be abundantly expressed in neurons, however, the concrete link between neuronal Nogo-A and neuronal development is poorly understood. In the present study, we used Neuro2A and COS7 cell lines to clarify that Nogo-A largely distributed in the centrosome and microtubules-rich regions. When endogenous Nogo-A was down-regulated with RNA interference, the percentage of cell differentiation and the total neurite length of Neuro2A exposed to valproic acid (VPA) decreased sharply. Furthermore, in primary neurons, acetylated ␣-tubulin decreased at the tips of neurites where endogenous Nogo-A was still highly expressed. In HEK293FT cell lines, Nogo-A overexpression could redistribute acetylated ␣-tubulin but not change the level of ␣-tubulin. Together, our data discovered that centrosome- and microtubules-localized Nogo-A positively regulates neuronal differentiation and neurite outgrowth of Neuro2A cell lines, implicating the essential roles of subcellular Nogo-A in neuronal development. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Nogo-A has been investigated as one of the most potent myelinassociated neurite inhibitors in the adult central nervous system (CNS). nogo gene generates three isoforms, Nogo-A, -B, and C, which share a 66-amino acid residue extracellular domain (Nogo-66). The mechanism for neurite outgrowth inhibition is well illustrated, the Nogo-66 domain of Nogo-A upon oligodendrocyte binds to a receptor complex containing NgR, P75/TROY and LINGO1 of neurons, activates the small Rho GTPase RhoA and ROCK, and
Abbreviations: CNS, central nervous system; DRG, dorsal root ganglia; MTOC, microtubule organizing center; SD, Sprague-Dawley; UD, undifferentiated; VPA, valproic acid. ∗ Corresponding author at: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, 800 Dong Chuan Road, Shanghai 200240, China. Tel.: +86 21 34206886; fax: +86 21 34206886. ∗∗ Corresponding author at: Institute of Basic Medicine Science, Xi’an Medical University, 1 Xin Wang Road, Xi’an 710021, China. Tel.: +86 29 86177603; fax: +86 29 86177603. E-mail addresses: [email protected] (Y. Mi), [email protected], [email protected] (W. Jin). 1 These authors contributed equally to this paper. http://dx.doi.org/10.1016/j.biocel.2014.09.024 1357-2725/© 2014 Elsevier Ltd. All rights reserved.
then leads to growth cone collapse and neurite inhibition (Schwab and Strittmatter, 2014). Recently, accumulating data demonstrate that Nogo-A is also expressed in neurons (Hunt et al., 2003; Jin et al., 2003; Liu et al., 2002). And increasing evidence has uncovered the potential roles of neuronal Nogo-A. In the developing forebrain cortex, neuronal Nogo-A is pivotal in tangential migrations of neural precursors and interneurons (Mingorance-Le Meur et al., 2007). Cultured dorsal root ganglia (DRG) neurons from Nogo-A KO mice suggest that neuronal Nogo-A regulates neurite fasciculation, branching and extension (Petrinovic et al., 2010). And neuronal Nogo-A restricts synaptic plasticity (Delekate et al., 2011). However, the mechanism of neuronal Nogo-A regulating neurite outgrowth is poorly understood. Microtubules are important components of neuronal cytoskeleton and exert essential functions such as cell shaping, division, motility and transportation (Poulain and Sobel, 2010). Previous research indicates the co-localization between Nogo-A and ␣tubulin in cultured neurons (Mingorance-Le Meur et al., 2007), and some data further shows that Nogo-A is an interactor of ␣tubulin in rat brain (Taketomi et al., 2002). Thus neuronal Nogo-A might regulate neurite outgrowth via influencing microtubules activity.
2
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
Neuro2A is a mouse neural crest-derived cell lines, and valproic acid (VPA)-induced neuronal differentiation model of Neuro2A is used extensively (Chen et al., 2011; Dai et al., 2014; Ma et al., 2013). In this study, we demonstrated that Nogo-A abundantly distributed in centrosome- and microtubule-rich regions using Neuro2A and COS7L cells. Down-regulation of Nogo-A resulted in a decrease of differentiation rate and inhibition of neurite outgrowth. And this positive function might depend on regulating the redistribution of acetylated ␣-tubulin. 2. Materials and methods 2.1. Antibodies Several Nogo-A-specific antibodies were used in the study. A home-made polyclonal antibody A620 recognizing 620–1004 aa of Nogo-A was used (Mi et al., 2012). Another two antibodies A201 (Prosci, 201–250 aa) and H300 (Santa Cruz, 700–1000 aa) were purchased commercially. ␥-tubulin, ␣-tubulin and acetylated ␣tubulin antibodies were purchased from Santa Cruz.
2.2. Animals and primary neuron culture All animal procedures were approved by Animal Care Committee at Shanghai Jiao Tong University. Embryonic (E) 16–18 day Sprague-Dawley (SD) rats were obtained from Shanghai Slac Laboratory Animal Company. Neurons from most layers of cortex start to generate and develop since E16-18 of rat (Gaillard and Roger, 2000), and only a few of glia cells just begin to form. Thus, the neuron culture from E16-18 is nearly pure and often used to study neuronal growth and development (Mi et al., 2012). Briefly, cerebral cortex was removed aseptically, then digested and dispersed into single cells, after centrifugation, neurons were resuspended in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS), then seeded at 1 × 104 /cm2 on cover glass placed in 24-well plate coated with poly-l-lysine and incubated in humidified atmosphere with 5% CO2 at 37 ◦ C. 2 h later, the whole medium was replaced with Neurobasal medium containing 2% B27 supplement (Invitrogen).
2.3. Cell culture, transfection, and VPA-induced differentiation HEK293FT (Invitrogen), COS7L (Invitrogen) and Neuro2A (Institute of Biochemistry and Cell Biology, SIBS, CAS, Shanghai, China) were maintained in DMEM supplemented with 10% FBS. HEK293FT and COS7L cells were transfected with pcDNA 3.1+-Nogo-A using Lipofectamine 2000 reagent (Invitrogen). Neuro2A cells were cotransfected with pEGFP-N1 and shRNAs for Nogo-A using FuGENE HD reagent (Roche). To induce neuronal differentiation, Neuro2A cells (at about 20% confluence) were transferred to serum-free optiMEM (Invitrogen) containing 1 mM VPA (Sigma) and allowed to extend neurites (Ma et al., 2013).
2.5. Immunocytochemistry Cells on glass coverslips were fixed with 4% paraformaldehyde and then permeabilized with ice-cold methanol. After being blocked by 10% normal donkey serum, cells were incubated with primary antibody at room temperature for 1 h. The following primary antibodies were used, A620 (1:1000), H300 (1:400), A201 (1:800), ␥-tubulin (1:200), ␣-tubulin (1:200) and acetylated ␣tubulin (1:200). Then, they were rinsed and incubated for 1 h at room temperature with Alexa Fluor-labeled secondary antibodies (Molecular Probes 1:800). After been washed, the coverslips were mounted with glycerine/PBS containing DAPI for nuclei staining. 2.6. Subcellular fractionation of 293FT cell lines Subcellular fractionation was performed on 293FT using the ProteoExtract® Subcellular Proteome Extraction kit (Calbiochem). This sequential extraction method relies on the different solubility of proteins in certain subcellular compartments to yield four fractions enriched in cytosolic (F1), membrane and membrane organelle-localized (F2), soluble and DNA-associated nuclear (F3), and cytoskeletal (F4) proteins. Equivalent amounts of proteins were resolved by SDS-PAGE, and western blot was performed as described below. 2.7. Western blot The procedure was previously described (Dai et al., 2014). Subcellular extracts were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes (Roche). The membranes were treated with 1% blocking solution in TBS, followed by incubation with primary antibodies and then POD-labeled secondary antibodies (Roche). The immunolabeled proteins were detected by BM Chemiluminescence Western Blotting kit (Roche). The primary antibodies were used as the follows: A620 (1:25,000), acetylated ␣-tubulin (1:2000), ␣-tubulin (1:2000), -actin (Abmart, 1:1000), GAPDH-HRP (KangCheng, China, 1:5000). 2.8. Differentiation assay and statistical analysis Neuro2A cells with any neurite longer than two cell bodies were considered to be differentiated (Chen et al., 2011; Dai et al., 2014; Ma et al., 2013). Each group: undifferentiated group, VPA-induced groups transfected with pSuper, pSuper-Nogo-A and pSuper-panNogo respectively, was analyzed by counting about 150–200 cells. Assessment of neurite outgrowth was performed by counting about 50–70 cells per condition. The total neurite length was quantified using Image Pro-Plus software. In each analysis, the data represent mean ± S.D. of at least three experiments. For comparison, statistical significance was tested by one-way ANOVA, and probability values of less than 5% were considered significant. 3. Results
2.4. RNA interference
3.1. Nogo-A distributes in cell body and neurites of Neuro2A cells
According to the targeting sequences of rat Nogo-A, two pairs of shRNA were synthesized. Oligonucleotides encoding shRNAs were cloned into the pSuper vector to generate pSuper-NogoA (against Nogo-A) and pSuper-panNogo (against Nogo-A/B/C). The target sequences are shown as following, pSuper-Nogo-A, GAGGATTTCCCATCTGTCCT; pSuper-panNogo, TTTGCAGTGTTGATGTGG. The efficacy of knocking down endogenous Nogo-A was confirmed in our previous works (Mi et al., 2012).
Before we used Neuro2A as a cell differentiation model to examine the potential functions of Nogo-A, we selected two antibodies against Nogo-A (A620 and H300) to detect its expression in Neuro2A cells. A620 and H300 antibodies were used to stain UD and VPA-induced Neuro2A with DAPI respectively. Either in UD or VPA groups, Nogo-A was found to localize in cytoplasm, and in VPA group Nogo-A could be also detected in all neurites of differentiated Neuro2A cells (Fig. 1A and B). Focusing on these differentiated cells,
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
3
Fig. 1. Nogo-A was expressed in cytoplasm and nuclear of Neuro2A cells. Neuro2A with non-treatment (UD) or treatment by 1 mM VPA for 24 h (VPA) were fixed and immunostained with A620 (A) or H300 (B) antibodies. Arrows indicated the terminals of differentiated Neuro2A. Bar = 10 m.
Nogo-A massively aggregated in the terminus of neurites (Fig. 1A and B lower panels, white arrows). 3.2. Cytoplasmic Nogo-A mainly localizes in centrosome- and microtubules-rich regions To investigate the subcellular distribution of cytoplasmic NogoA, UD and VPA-induced Neuro2A were double-stained with another anti-Nogo-A (A201, specially recognizes N-terminus 201–250 residues of Nogo-A) and anti-␥-tubulin antibodies (a well-known marker for centrosome). From confocal images, we found that in most Neuro2A cells of UD group, one or two granular ␥-tubulin immunities could be seen in one polar side and petrinuclear of cells (Fig. 2A upper panels, arrows), which indicating the centrosome (also named as microtubule organizing center, MTOC).
Meanwhile, Nogo-A accumulatively distributed in ␥-tubulin immunitive regions. Merge images further indicated that Nogo-A was expressed in centrosome and the surrounding regions (Fig. 2A upper panels, arrows). In VPA group, Nogo-A also could be detected in centrosome-related area of differentiated Neuro2A cells (Fig. 2A lower panels, arrows). COS7L was a good cell model for studying cellular skeleton, we transfected COS7L with pcDNA 3.1+-Nogo-A plasmid. 24 h later, cells were fixed and immunostained with A620 and anti-␣-tubulin antibodies. Confocal images revealed that overexpressed cytoplasmic Nogo-A distributed in a well-defined filamentous pattern which was very like the ␣-tubulin array, but the two molecules did not completely colocalize (Fig. 2B). Thus, these data told us that cytoplasmic Nogo-A primarily distributed in centrosome- and microtubules-rich regions.
4
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
Fig. 2. Nogo-A localized in centrosome- and microtubules-rich regions. (A) Neuro2A with non-treatment (UD) or treatment by 1 mM VPA for 24 h (VPA) were fixed and immunostained with A201 and anti-␥-tubulin antibodies. Arrows represented the localization in centrosomes. (B) COS7L overexpressed with Nogo-A was double-stained with A620 and anti-␣-tubulin antibodies. Bar = 20 m.
3.3. Knockdown of endogenous Nogo-A inhibits neuronal differentiation of Neuro2A cells To assess whether endogenously expressed Nogo-A is involved in the regulation of VPA-induced neuronal differentiation of Neuro2A cells, we examined the effects of Nogo-A depletion from Neuro2A cells by pSuper mediated shRNA knockdown method. Two shRNA plasmids against only Nogo-A (named as pSuperNogo-A) or both Nogo-A/B/C (named as pSuper-panNogo) were constructed respectively. Their knockdown efficiency was confirmed with western blot in our previous works (Mi et al., 2012). Next, we investigated whether transfection of pSuper-Nogo-A or pSuper-panNogo could affect neuronal differentiation. In the absence of VPA, Neuro2A cells transfected with pSuper-Nogo-A or pSuper-panNogo did not induce visible neuron-like differentiation (data not shown). After 24 h of VPA induction, the control group of Neuro2A cells stretched long neuron-like neurites (Fig. 3A, arrows), but cells transfected with Nogo-A shRNAs exhibited shorter or none branches, which seemed no response to VPA (Fig. 3A). Cells with any neurite process longer than two cell bodies were counted as differentiated cells. The differentiation rate of the Nogo-A knockdown group was 18.40 ± 1.85% and 17.43 ± 1.07%, compared to control group which was 33.97 ± 0.91% (Fig. 3B). Similarly, in the differentiated cells, the total length of all neurites also decreased in Nogo-A knockdown group, which was
68.00 ± 3.24 m and 70.00 ± 3.70 m compared to control group which was 98.00 ± 3.58 m (Fig. 3C).
3.4. Neuronal Nogo-A maybe regulate neurites outgrowth via redistributing acetylated ˛-tubulin To explore the potential mechanism of neuronal Nogo-A regulating cell differentiation and neurite outgrowth, we performed immunostaining with A620 and anti-acetylated ␣-tubulin antibodies on primary cortical neurons. Confocal images showed that Nogo-A distributed in neurites and soma of neurons in which acetylated ␣-tubulin was also highly expressed. Notably in details, Nogo-A was still rich in the terminal tips of all neurites, where acetylated ␣-tubulin was nearly unseen (Fig. 4A, arrows). Next, we wanted to ask whether Nogo-A could indeed affect the local acetylated ␣-tubulin. We examined acetylation level of ␣-tubulin in 293FT cell lines transfected with pcDNA 3.1+-NogoA. 48 h after tranfection, the four subcellular fractions including F1–F4 were immublotted with anti-acetylated ␣-tubulin or ␣tubulin antibodies. As shown in Fig. 4, exogenous Nogo-A mainly distributed in F2, which represented membrane components of cell and organelle, and Nogo-A could redistribute acetylated ␣-tubulin from cytoplasm (F1) to nuclei (F3), meanwhile ␣-tubulin was not affected (Fig. 4B).
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
5
Fig. 3. Nogo-A knockdown restricted cell differentiation and neurite outgrowth of Neuro2A. (A) Neuro2A co-transfected with pEGFP-N1 and three shRNAs (pSuper was control, pSuper-Nogo-A and pSuper-panNogo were two shRNAs against Nogo-A) were induced by VPA for 24 h. Fluorescence images showed the transfected cells and the typical morphology of undifferentiated (UD) and differentiated (VPA, arrows) Neuro2A. Bar = 20 m. Differentiation rate (B) and the total length of all neurites of differentiated cells (C) were statistically analyzed. n = 3, one-way ANOVA, ***P < 0.001.
In all, these data implied that centrosome- and microtubuleslocalized Nogo-A maybe positively regulate neuronal differentiation and neurite outgrowth through regulating subcellular level of acetylated ␣-tubulin. 4. Discussion In mature neurons, acetylated ␣-tubulin is rich in the proximal site of the axon and related to dynamics of ␣-tubulin (Fukushima
et al., 2009; Sirajuddin et al., 2014). Consistently, we also noticed this in cultured neurons, and considered that Nogo-A could redistribute local acetylated ␣-tubulin, which maybe partially explain the potent mechanism of Nogo-A promoting cell differentiation. There are two deacetylases for ␣-tubulin, HDAC6 and Sirt2. One study found that Nogo-A could interact with Sirt2 using High through Affinity Capture-MS experiment (Ewing et al., 2007). Another research suggested that acetylation of RTN-1C led to a significant decrease in HDAC6 activity (Fazi et al., 2009). Since
Fig. 4. Nogo-A influenced subcellular distribution of acetylated ␣-tubulin. (A) Primary neurons were fixed and double-stained with A620 and anti-acetylated ␣-tubulin. Arrows represented the distal tips of neurites. Bar = 20 m. (B) Subcellular constituents of 293FT transfected with mock or pcDNA 3.1+-Nogo-A plasmids were subjected to western blot with A620, anti-acetylated ␣-tubulin or ␣-tubulin antibodies. -actin and GAPDH were chosen as a loading control.
6
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
both Nogo-A (also named as RTN-4A) and RTN-1C are members of reticulon family, which share a reticulon homology domain and the conserved KRH motif (Fazi et al., 2009). Therefore, Nogo-A maybe down-regulate acetylated ␣-tubulin via interaction with the deacetylases, and we have proceeded to do some experiments to check this possibility. Besides acetylation, there are tyrosination/detyrosination, polyglutamylation, and polyglycylation, which maybe regulate the interactions of microtubules with microtubule associated proteins and motor proteins, and exert an essential role in neuronal network formation (Janke and Bulinski, 2011; Sirajuddin et al., 2014). However, that whether Nogo-A is involved in these events has not been studied yet. Centrosome activity is very essential to maintain microtubules in a particular equilibrium and control their dynamics (Sakakibara et al., 2013), and we found that Nogo-A highly distributed around centrosome. Thus, except redistributing acetylated ␣-tubulin, Nogo-A maybe influence dynamics of ␣-tubulin through the interaction with centrosome. To check this possibility, we performed microtubule aster formation assay (Tarapore et al., 2012) through overexpressing Nogo-A in COS7L cells. Unfortunately, there was no significant difference compared to control group (data not shown), and the roles of Nogo-A in centrosome need to be further studied. Notably, this location was specially checked with the antibody A201 (Fig. 2A), but not with A620 and A300 (Fig. 1). Thus, there might be a binding domain between amino-Nogo-A 201–250 aa and centrosome, however this possibility should be investigated in future examinations. Primary neuron is the best cell model to study Nogo-A in neuronal development, for that Nogo-A has a concomitant expression pattern in the maturing process (Kumari and Thakur, 2014; Mi et al., 2012). However, the function and mechanism studies on primary neuron culture are hard to perform. Some other studies from knockout mice suggest that neuronal Nogo-A is involved in early neuron migration, neurite formation and synaptic maturation (Enkel et al., 2014; Mingorance-Le Meur et al., 2007; Petrinovic et al., 2013). Consistent with our findings, a recent study has found that cultured dopaminergic neurons from Nogo-A knockout mice exhibited decreased numbers of neurites and branches (Kurowska et al., 2014). In conclusion, we used VPA induced-Neuro2A neuronal differentiation model to find that, intracellular Nogo-A promoted neuronal differentiation and neurite growth. And this function might depend on regulating the redistribution of acetylated ␣-tubulin. However, the precise relationship among Nogo-A, acetylated ␣-tubulin and MTOC should be further studied. Conflict of interest None declared. Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 31400913, 31171033 and 81272801) National Key Basic Research Program of China (“973” Project) (2010CB933900), Natural Science Basic Research Plan in Shaanxi Province of China (No. 2013JQ3017), Scientific Research Program
Funded by Shaanxi Provincial Education Department (Program No. 14JK1617), Scientific Research Program Funded by Shaanxi Provincial Health Department (No. 2014D21) and Doctor Start-up Fund of Xi’an Medical University (No. 2012DOC04). References Chen K, Mi YJ, Ma Y, Fu HL, Jin WL. The mental retardation associated protein, srGAP3 negatively regulates VPA-induced neuronal differentiation of Neuro2A cells. Cell Mol Neurobiol 2011;31:675–86. Dai YK, Ma Y, Chen K, Mi YJ, Fu HL, Cui DX, et al. A link between the nuclearlocalized srGAP3 and the SWI/SNF chromatin remodeler Brg1. Mol Cell Neurosci 2014;60C:10–25. Delekate A, Zagrebelsky M, Kramer S, Schwab ME, Korte M. NogoA restricts synaptic plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A 2011;108:2569–74. Enkel T, Berger SM, Schonig K, Tews B, Bartsch D. Reduced expression of nogo-a leads to motivational deficits in rats. Front Behav Neurosci 2014;8:10. Ewing RM, Chu P, Elisma F, Li H, Taylor P, Climie S, et al. Large-scale mapping of human protein–protein interactions by mass spectrometry. Mol Syst Biol 2007;3:89. Fazi B, Melino S, De Rubeis S, Bagni C, Paci M, Piacentini M, et al. Acetylation of RTN-1C regulates the induction of ER stress by the inhibition of HDAC activity in neuroectodermal tumors. Oncogene 2009;28:3814–24. Fukushima N, Furuta D, Hidaka Y, Moriyama R, Tsujiuchi T. Post-translational modifications of tubulin in the nervous system. J Neurochem 2009;109: 683–93. Gaillard A, Roger M. Early commitment of embryonic neocortical cells to develop area-specific thalamic connections. Cereb Cortex 2000;10:443–53. Hunt D, Coffin RS, Prinjha RK, Campbell G, Anderson PN. Nogo-A expression in the intact and injured nervous system. Mol Cell Neurosci 2003;24: 1083–102. Janke C, Bulinski JC. Post-translational regulation of the microtubule cytoskeleton: mechanisms and functions. Nat Rev Mol Cell Biol 2011;12:773–86. Jin WL, Liu YY, Liu HL, Yang H, Wang Y, Jiao XY, et al. Intraneuronal localization of Nogo-A in the rat. J Comp Neurol 2003;458:1–10. Kumari A, Thakur MK. Age-dependent decline of Nogo-A protein in the mouse cerebrum. Cell Mol Neurobiol 2014;34:1131–41. Kurowska Z, Brundin P, Schwab ME, Li JY. Intracellular Nogo-A facilitates initiation of neurite formation in mouse midbrain neurons in vitro. Neuroscience 2014;256:456–66. Liu H, Ng CE, Tang BL. Nogo-A expression in mouse central nervous system neurons. Neurosci Lett 2002;328:257–60. Ma Y, Mi YJ, Dai YK, Fu HL, Cui DX, Jin WL. The inverse F-BAR domain protein srGAP2 acts through srGAP3 to modulate neuronal differentiation and neurite outgrowth of mouse neuroblastoma cells. PLOS ONE 2013;8:e57865. Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, et al. Amino-Nogo-A antagonizes reactive oxygen species generation and protects immature primary cortical neurons from oxidative toxicity. Cell Death Differ 2012;19:1175–86. Mingorance-Le Meur A, Zheng B, Soriano E, del Rio JA. Involvement of the myelin-associated inhibitor Nogo-A in early cortical development and neuronal maturation. Cereb Cortex 2007;17:2375–86. Petrinovic MM, Duncan CS, Bourikas D, Weinman O, Montani L, Schroeter A, et al. Neuronal Nogo-A regulates neurite fasciculation, branching and extension in the developing nervous system. Development 2010;137:2539–50. Petrinovic MM, Hourez R, Aloy EM, Dewarrat G, Gall D, Weinmann O, et al. Neuronal Nogo-A negatively regulates dendritic morphology and synaptic transmission in the cerebellum. Proc Natl Acad Sci U S A 2013;110:1083–8. Poulain FE, Sobel A. The microtubule network and neuronal morphogenesis: dynamic and coordinated orchestration through multiple players. Mol Cell Neurosci 2010;43:15–32. Sakakibara A, Ando R, Sapir T, Tanaka T. Microtubule dynamics in neuronal morphogenesis. Open Biol 2013;3:130061. Schwab ME, Strittmatter SM. Nogo limits neural plasticity and recovery from injury. Curr Opin Neurobiol 2014;27C:53–60. Sirajuddin M, Rice LM, Vale RD. Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Nat Cell Biol 2014;16:335–44. Taketomi M, Kinoshita N, Kimura K, Kitada M, Noda T, Asou H, et al. Nogo-A expression in mature oligodendrocytes of rat spinal cord in association with specific molecules. Neurosci Lett 2002;332:37–40. Tarapore P, Hanashiro K, Fukasawa K. Analysis of centrosome localization of BRCA1 and its activity in suppressing centrosomal aster formation. Cell Cycle 2012;11:2931–46.
Contents lists available at ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
Short communication
A novel centrosome and microtubules associated subcellular localization of Nogo-A: Implications for neuronal development Yajing Mi a,c,∗∗,1 , Xingchun Gao a,1 , Yue Ma b,c , Jie Gao c , Zhen Wang b , Weilin Jin a,b,c,∗ a
Institute of Basic Medicine Science, Xi’an Medical University, Xi’an 710021, China Institute of Nano Biomedicine and Engineering, Department of Instrument Science and Engineering, Key Laboratory for Thin Film and Microfabrication Technology of Ministry of Education, School of Electronic Information and Electronic Engineering, Shanghai Jiao Tong University, Shanghai 200240, China c School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China b
a r t i c l e
i n f o
Article history: Received 13 May 2014 Received in revised form 7 August 2014 Accepted 25 September 2014 Available online 5 October 2014 Keywords: Nogo-A Centrosome Microtubules Neuro2A Neuronal development
a b s t r a c t Oligodendrocyte-derived neurite-outgrowth inhibitor Nogo-A and its restriction mechanism are wellknown. Recently, Nogo-A is reported to be abundantly expressed in neurons, however, the concrete link between neuronal Nogo-A and neuronal development is poorly understood. In the present study, we used Neuro2A and COS7 cell lines to clarify that Nogo-A largely distributed in the centrosome and microtubules-rich regions. When endogenous Nogo-A was down-regulated with RNA interference, the percentage of cell differentiation and the total neurite length of Neuro2A exposed to valproic acid (VPA) decreased sharply. Furthermore, in primary neurons, acetylated ␣-tubulin decreased at the tips of neurites where endogenous Nogo-A was still highly expressed. In HEK293FT cell lines, Nogo-A overexpression could redistribute acetylated ␣-tubulin but not change the level of ␣-tubulin. Together, our data discovered that centrosome- and microtubules-localized Nogo-A positively regulates neuronal differentiation and neurite outgrowth of Neuro2A cell lines, implicating the essential roles of subcellular Nogo-A in neuronal development. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Nogo-A has been investigated as one of the most potent myelinassociated neurite inhibitors in the adult central nervous system (CNS). nogo gene generates three isoforms, Nogo-A, -B, and C, which share a 66-amino acid residue extracellular domain (Nogo-66). The mechanism for neurite outgrowth inhibition is well illustrated, the Nogo-66 domain of Nogo-A upon oligodendrocyte binds to a receptor complex containing NgR, P75/TROY and LINGO1 of neurons, activates the small Rho GTPase RhoA and ROCK, and
Abbreviations: CNS, central nervous system; DRG, dorsal root ganglia; MTOC, microtubule organizing center; SD, Sprague-Dawley; UD, undifferentiated; VPA, valproic acid. ∗ Corresponding author at: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, 800 Dong Chuan Road, Shanghai 200240, China. Tel.: +86 21 34206886; fax: +86 21 34206886. ∗∗ Corresponding author at: Institute of Basic Medicine Science, Xi’an Medical University, 1 Xin Wang Road, Xi’an 710021, China. Tel.: +86 29 86177603; fax: +86 29 86177603. E-mail addresses: [email protected] (Y. Mi), [email protected], [email protected] (W. Jin). 1 These authors contributed equally to this paper. http://dx.doi.org/10.1016/j.biocel.2014.09.024 1357-2725/© 2014 Elsevier Ltd. All rights reserved.
then leads to growth cone collapse and neurite inhibition (Schwab and Strittmatter, 2014). Recently, accumulating data demonstrate that Nogo-A is also expressed in neurons (Hunt et al., 2003; Jin et al., 2003; Liu et al., 2002). And increasing evidence has uncovered the potential roles of neuronal Nogo-A. In the developing forebrain cortex, neuronal Nogo-A is pivotal in tangential migrations of neural precursors and interneurons (Mingorance-Le Meur et al., 2007). Cultured dorsal root ganglia (DRG) neurons from Nogo-A KO mice suggest that neuronal Nogo-A regulates neurite fasciculation, branching and extension (Petrinovic et al., 2010). And neuronal Nogo-A restricts synaptic plasticity (Delekate et al., 2011). However, the mechanism of neuronal Nogo-A regulating neurite outgrowth is poorly understood. Microtubules are important components of neuronal cytoskeleton and exert essential functions such as cell shaping, division, motility and transportation (Poulain and Sobel, 2010). Previous research indicates the co-localization between Nogo-A and ␣tubulin in cultured neurons (Mingorance-Le Meur et al., 2007), and some data further shows that Nogo-A is an interactor of ␣tubulin in rat brain (Taketomi et al., 2002). Thus neuronal Nogo-A might regulate neurite outgrowth via influencing microtubules activity.
2
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
Neuro2A is a mouse neural crest-derived cell lines, and valproic acid (VPA)-induced neuronal differentiation model of Neuro2A is used extensively (Chen et al., 2011; Dai et al., 2014; Ma et al., 2013). In this study, we demonstrated that Nogo-A abundantly distributed in centrosome- and microtubule-rich regions using Neuro2A and COS7L cells. Down-regulation of Nogo-A resulted in a decrease of differentiation rate and inhibition of neurite outgrowth. And this positive function might depend on regulating the redistribution of acetylated ␣-tubulin. 2. Materials and methods 2.1. Antibodies Several Nogo-A-specific antibodies were used in the study. A home-made polyclonal antibody A620 recognizing 620–1004 aa of Nogo-A was used (Mi et al., 2012). Another two antibodies A201 (Prosci, 201–250 aa) and H300 (Santa Cruz, 700–1000 aa) were purchased commercially. ␥-tubulin, ␣-tubulin and acetylated ␣tubulin antibodies were purchased from Santa Cruz.
2.2. Animals and primary neuron culture All animal procedures were approved by Animal Care Committee at Shanghai Jiao Tong University. Embryonic (E) 16–18 day Sprague-Dawley (SD) rats were obtained from Shanghai Slac Laboratory Animal Company. Neurons from most layers of cortex start to generate and develop since E16-18 of rat (Gaillard and Roger, 2000), and only a few of glia cells just begin to form. Thus, the neuron culture from E16-18 is nearly pure and often used to study neuronal growth and development (Mi et al., 2012). Briefly, cerebral cortex was removed aseptically, then digested and dispersed into single cells, after centrifugation, neurons were resuspended in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS), then seeded at 1 × 104 /cm2 on cover glass placed in 24-well plate coated with poly-l-lysine and incubated in humidified atmosphere with 5% CO2 at 37 ◦ C. 2 h later, the whole medium was replaced with Neurobasal medium containing 2% B27 supplement (Invitrogen).
2.3. Cell culture, transfection, and VPA-induced differentiation HEK293FT (Invitrogen), COS7L (Invitrogen) and Neuro2A (Institute of Biochemistry and Cell Biology, SIBS, CAS, Shanghai, China) were maintained in DMEM supplemented with 10% FBS. HEK293FT and COS7L cells were transfected with pcDNA 3.1+-Nogo-A using Lipofectamine 2000 reagent (Invitrogen). Neuro2A cells were cotransfected with pEGFP-N1 and shRNAs for Nogo-A using FuGENE HD reagent (Roche). To induce neuronal differentiation, Neuro2A cells (at about 20% confluence) were transferred to serum-free optiMEM (Invitrogen) containing 1 mM VPA (Sigma) and allowed to extend neurites (Ma et al., 2013).
2.5. Immunocytochemistry Cells on glass coverslips were fixed with 4% paraformaldehyde and then permeabilized with ice-cold methanol. After being blocked by 10% normal donkey serum, cells were incubated with primary antibody at room temperature for 1 h. The following primary antibodies were used, A620 (1:1000), H300 (1:400), A201 (1:800), ␥-tubulin (1:200), ␣-tubulin (1:200) and acetylated ␣tubulin (1:200). Then, they were rinsed and incubated for 1 h at room temperature with Alexa Fluor-labeled secondary antibodies (Molecular Probes 1:800). After been washed, the coverslips were mounted with glycerine/PBS containing DAPI for nuclei staining. 2.6. Subcellular fractionation of 293FT cell lines Subcellular fractionation was performed on 293FT using the ProteoExtract® Subcellular Proteome Extraction kit (Calbiochem). This sequential extraction method relies on the different solubility of proteins in certain subcellular compartments to yield four fractions enriched in cytosolic (F1), membrane and membrane organelle-localized (F2), soluble and DNA-associated nuclear (F3), and cytoskeletal (F4) proteins. Equivalent amounts of proteins were resolved by SDS-PAGE, and western blot was performed as described below. 2.7. Western blot The procedure was previously described (Dai et al., 2014). Subcellular extracts were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes (Roche). The membranes were treated with 1% blocking solution in TBS, followed by incubation with primary antibodies and then POD-labeled secondary antibodies (Roche). The immunolabeled proteins were detected by BM Chemiluminescence Western Blotting kit (Roche). The primary antibodies were used as the follows: A620 (1:25,000), acetylated ␣-tubulin (1:2000), ␣-tubulin (1:2000), -actin (Abmart, 1:1000), GAPDH-HRP (KangCheng, China, 1:5000). 2.8. Differentiation assay and statistical analysis Neuro2A cells with any neurite longer than two cell bodies were considered to be differentiated (Chen et al., 2011; Dai et al., 2014; Ma et al., 2013). Each group: undifferentiated group, VPA-induced groups transfected with pSuper, pSuper-Nogo-A and pSuper-panNogo respectively, was analyzed by counting about 150–200 cells. Assessment of neurite outgrowth was performed by counting about 50–70 cells per condition. The total neurite length was quantified using Image Pro-Plus software. In each analysis, the data represent mean ± S.D. of at least three experiments. For comparison, statistical significance was tested by one-way ANOVA, and probability values of less than 5% were considered significant. 3. Results
2.4. RNA interference
3.1. Nogo-A distributes in cell body and neurites of Neuro2A cells
According to the targeting sequences of rat Nogo-A, two pairs of shRNA were synthesized. Oligonucleotides encoding shRNAs were cloned into the pSuper vector to generate pSuper-NogoA (against Nogo-A) and pSuper-panNogo (against Nogo-A/B/C). The target sequences are shown as following, pSuper-Nogo-A, GAGGATTTCCCATCTGTCCT; pSuper-panNogo, TTTGCAGTGTTGATGTGG. The efficacy of knocking down endogenous Nogo-A was confirmed in our previous works (Mi et al., 2012).
Before we used Neuro2A as a cell differentiation model to examine the potential functions of Nogo-A, we selected two antibodies against Nogo-A (A620 and H300) to detect its expression in Neuro2A cells. A620 and H300 antibodies were used to stain UD and VPA-induced Neuro2A with DAPI respectively. Either in UD or VPA groups, Nogo-A was found to localize in cytoplasm, and in VPA group Nogo-A could be also detected in all neurites of differentiated Neuro2A cells (Fig. 1A and B). Focusing on these differentiated cells,
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
3
Fig. 1. Nogo-A was expressed in cytoplasm and nuclear of Neuro2A cells. Neuro2A with non-treatment (UD) or treatment by 1 mM VPA for 24 h (VPA) were fixed and immunostained with A620 (A) or H300 (B) antibodies. Arrows indicated the terminals of differentiated Neuro2A. Bar = 10 m.
Nogo-A massively aggregated in the terminus of neurites (Fig. 1A and B lower panels, white arrows). 3.2. Cytoplasmic Nogo-A mainly localizes in centrosome- and microtubules-rich regions To investigate the subcellular distribution of cytoplasmic NogoA, UD and VPA-induced Neuro2A were double-stained with another anti-Nogo-A (A201, specially recognizes N-terminus 201–250 residues of Nogo-A) and anti-␥-tubulin antibodies (a well-known marker for centrosome). From confocal images, we found that in most Neuro2A cells of UD group, one or two granular ␥-tubulin immunities could be seen in one polar side and petrinuclear of cells (Fig. 2A upper panels, arrows), which indicating the centrosome (also named as microtubule organizing center, MTOC).
Meanwhile, Nogo-A accumulatively distributed in ␥-tubulin immunitive regions. Merge images further indicated that Nogo-A was expressed in centrosome and the surrounding regions (Fig. 2A upper panels, arrows). In VPA group, Nogo-A also could be detected in centrosome-related area of differentiated Neuro2A cells (Fig. 2A lower panels, arrows). COS7L was a good cell model for studying cellular skeleton, we transfected COS7L with pcDNA 3.1+-Nogo-A plasmid. 24 h later, cells were fixed and immunostained with A620 and anti-␣-tubulin antibodies. Confocal images revealed that overexpressed cytoplasmic Nogo-A distributed in a well-defined filamentous pattern which was very like the ␣-tubulin array, but the two molecules did not completely colocalize (Fig. 2B). Thus, these data told us that cytoplasmic Nogo-A primarily distributed in centrosome- and microtubules-rich regions.
4
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
Fig. 2. Nogo-A localized in centrosome- and microtubules-rich regions. (A) Neuro2A with non-treatment (UD) or treatment by 1 mM VPA for 24 h (VPA) were fixed and immunostained with A201 and anti-␥-tubulin antibodies. Arrows represented the localization in centrosomes. (B) COS7L overexpressed with Nogo-A was double-stained with A620 and anti-␣-tubulin antibodies. Bar = 20 m.
3.3. Knockdown of endogenous Nogo-A inhibits neuronal differentiation of Neuro2A cells To assess whether endogenously expressed Nogo-A is involved in the regulation of VPA-induced neuronal differentiation of Neuro2A cells, we examined the effects of Nogo-A depletion from Neuro2A cells by pSuper mediated shRNA knockdown method. Two shRNA plasmids against only Nogo-A (named as pSuperNogo-A) or both Nogo-A/B/C (named as pSuper-panNogo) were constructed respectively. Their knockdown efficiency was confirmed with western blot in our previous works (Mi et al., 2012). Next, we investigated whether transfection of pSuper-Nogo-A or pSuper-panNogo could affect neuronal differentiation. In the absence of VPA, Neuro2A cells transfected with pSuper-Nogo-A or pSuper-panNogo did not induce visible neuron-like differentiation (data not shown). After 24 h of VPA induction, the control group of Neuro2A cells stretched long neuron-like neurites (Fig. 3A, arrows), but cells transfected with Nogo-A shRNAs exhibited shorter or none branches, which seemed no response to VPA (Fig. 3A). Cells with any neurite process longer than two cell bodies were counted as differentiated cells. The differentiation rate of the Nogo-A knockdown group was 18.40 ± 1.85% and 17.43 ± 1.07%, compared to control group which was 33.97 ± 0.91% (Fig. 3B). Similarly, in the differentiated cells, the total length of all neurites also decreased in Nogo-A knockdown group, which was
68.00 ± 3.24 m and 70.00 ± 3.70 m compared to control group which was 98.00 ± 3.58 m (Fig. 3C).
3.4. Neuronal Nogo-A maybe regulate neurites outgrowth via redistributing acetylated ˛-tubulin To explore the potential mechanism of neuronal Nogo-A regulating cell differentiation and neurite outgrowth, we performed immunostaining with A620 and anti-acetylated ␣-tubulin antibodies on primary cortical neurons. Confocal images showed that Nogo-A distributed in neurites and soma of neurons in which acetylated ␣-tubulin was also highly expressed. Notably in details, Nogo-A was still rich in the terminal tips of all neurites, where acetylated ␣-tubulin was nearly unseen (Fig. 4A, arrows). Next, we wanted to ask whether Nogo-A could indeed affect the local acetylated ␣-tubulin. We examined acetylation level of ␣-tubulin in 293FT cell lines transfected with pcDNA 3.1+-NogoA. 48 h after tranfection, the four subcellular fractions including F1–F4 were immublotted with anti-acetylated ␣-tubulin or ␣tubulin antibodies. As shown in Fig. 4, exogenous Nogo-A mainly distributed in F2, which represented membrane components of cell and organelle, and Nogo-A could redistribute acetylated ␣-tubulin from cytoplasm (F1) to nuclei (F3), meanwhile ␣-tubulin was not affected (Fig. 4B).
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
5
Fig. 3. Nogo-A knockdown restricted cell differentiation and neurite outgrowth of Neuro2A. (A) Neuro2A co-transfected with pEGFP-N1 and three shRNAs (pSuper was control, pSuper-Nogo-A and pSuper-panNogo were two shRNAs against Nogo-A) were induced by VPA for 24 h. Fluorescence images showed the transfected cells and the typical morphology of undifferentiated (UD) and differentiated (VPA, arrows) Neuro2A. Bar = 20 m. Differentiation rate (B) and the total length of all neurites of differentiated cells (C) were statistically analyzed. n = 3, one-way ANOVA, ***P < 0.001.
In all, these data implied that centrosome- and microtubuleslocalized Nogo-A maybe positively regulate neuronal differentiation and neurite outgrowth through regulating subcellular level of acetylated ␣-tubulin. 4. Discussion In mature neurons, acetylated ␣-tubulin is rich in the proximal site of the axon and related to dynamics of ␣-tubulin (Fukushima
et al., 2009; Sirajuddin et al., 2014). Consistently, we also noticed this in cultured neurons, and considered that Nogo-A could redistribute local acetylated ␣-tubulin, which maybe partially explain the potent mechanism of Nogo-A promoting cell differentiation. There are two deacetylases for ␣-tubulin, HDAC6 and Sirt2. One study found that Nogo-A could interact with Sirt2 using High through Affinity Capture-MS experiment (Ewing et al., 2007). Another research suggested that acetylation of RTN-1C led to a significant decrease in HDAC6 activity (Fazi et al., 2009). Since
Fig. 4. Nogo-A influenced subcellular distribution of acetylated ␣-tubulin. (A) Primary neurons were fixed and double-stained with A620 and anti-acetylated ␣-tubulin. Arrows represented the distal tips of neurites. Bar = 20 m. (B) Subcellular constituents of 293FT transfected with mock or pcDNA 3.1+-Nogo-A plasmids were subjected to western blot with A620, anti-acetylated ␣-tubulin or ␣-tubulin antibodies. -actin and GAPDH were chosen as a loading control.
6
Y. Mi et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 1–6
both Nogo-A (also named as RTN-4A) and RTN-1C are members of reticulon family, which share a reticulon homology domain and the conserved KRH motif (Fazi et al., 2009). Therefore, Nogo-A maybe down-regulate acetylated ␣-tubulin via interaction with the deacetylases, and we have proceeded to do some experiments to check this possibility. Besides acetylation, there are tyrosination/detyrosination, polyglutamylation, and polyglycylation, which maybe regulate the interactions of microtubules with microtubule associated proteins and motor proteins, and exert an essential role in neuronal network formation (Janke and Bulinski, 2011; Sirajuddin et al., 2014). However, that whether Nogo-A is involved in these events has not been studied yet. Centrosome activity is very essential to maintain microtubules in a particular equilibrium and control their dynamics (Sakakibara et al., 2013), and we found that Nogo-A highly distributed around centrosome. Thus, except redistributing acetylated ␣-tubulin, Nogo-A maybe influence dynamics of ␣-tubulin through the interaction with centrosome. To check this possibility, we performed microtubule aster formation assay (Tarapore et al., 2012) through overexpressing Nogo-A in COS7L cells. Unfortunately, there was no significant difference compared to control group (data not shown), and the roles of Nogo-A in centrosome need to be further studied. Notably, this location was specially checked with the antibody A201 (Fig. 2A), but not with A620 and A300 (Fig. 1). Thus, there might be a binding domain between amino-Nogo-A 201–250 aa and centrosome, however this possibility should be investigated in future examinations. Primary neuron is the best cell model to study Nogo-A in neuronal development, for that Nogo-A has a concomitant expression pattern in the maturing process (Kumari and Thakur, 2014; Mi et al., 2012). However, the function and mechanism studies on primary neuron culture are hard to perform. Some other studies from knockout mice suggest that neuronal Nogo-A is involved in early neuron migration, neurite formation and synaptic maturation (Enkel et al., 2014; Mingorance-Le Meur et al., 2007; Petrinovic et al., 2013). Consistent with our findings, a recent study has found that cultured dopaminergic neurons from Nogo-A knockout mice exhibited decreased numbers of neurites and branches (Kurowska et al., 2014). In conclusion, we used VPA induced-Neuro2A neuronal differentiation model to find that, intracellular Nogo-A promoted neuronal differentiation and neurite growth. And this function might depend on regulating the redistribution of acetylated ␣-tubulin. However, the precise relationship among Nogo-A, acetylated ␣-tubulin and MTOC should be further studied. Conflict of interest None declared. Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 31400913, 31171033 and 81272801) National Key Basic Research Program of China (“973” Project) (2010CB933900), Natural Science Basic Research Plan in Shaanxi Province of China (No. 2013JQ3017), Scientific Research Program
Funded by Shaanxi Provincial Education Department (Program No. 14JK1617), Scientific Research Program Funded by Shaanxi Provincial Health Department (No. 2014D21) and Doctor Start-up Fund of Xi’an Medical University (No. 2012DOC04). References Chen K, Mi YJ, Ma Y, Fu HL, Jin WL. The mental retardation associated protein, srGAP3 negatively regulates VPA-induced neuronal differentiation of Neuro2A cells. Cell Mol Neurobiol 2011;31:675–86. Dai YK, Ma Y, Chen K, Mi YJ, Fu HL, Cui DX, et al. A link between the nuclearlocalized srGAP3 and the SWI/SNF chromatin remodeler Brg1. Mol Cell Neurosci 2014;60C:10–25. Delekate A, Zagrebelsky M, Kramer S, Schwab ME, Korte M. NogoA restricts synaptic plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A 2011;108:2569–74. Enkel T, Berger SM, Schonig K, Tews B, Bartsch D. Reduced expression of nogo-a leads to motivational deficits in rats. Front Behav Neurosci 2014;8:10. Ewing RM, Chu P, Elisma F, Li H, Taylor P, Climie S, et al. Large-scale mapping of human protein–protein interactions by mass spectrometry. Mol Syst Biol 2007;3:89. Fazi B, Melino S, De Rubeis S, Bagni C, Paci M, Piacentini M, et al. Acetylation of RTN-1C regulates the induction of ER stress by the inhibition of HDAC activity in neuroectodermal tumors. Oncogene 2009;28:3814–24. Fukushima N, Furuta D, Hidaka Y, Moriyama R, Tsujiuchi T. Post-translational modifications of tubulin in the nervous system. J Neurochem 2009;109: 683–93. Gaillard A, Roger M. Early commitment of embryonic neocortical cells to develop area-specific thalamic connections. Cereb Cortex 2000;10:443–53. Hunt D, Coffin RS, Prinjha RK, Campbell G, Anderson PN. Nogo-A expression in the intact and injured nervous system. Mol Cell Neurosci 2003;24: 1083–102. Janke C, Bulinski JC. Post-translational regulation of the microtubule cytoskeleton: mechanisms and functions. Nat Rev Mol Cell Biol 2011;12:773–86. Jin WL, Liu YY, Liu HL, Yang H, Wang Y, Jiao XY, et al. Intraneuronal localization of Nogo-A in the rat. J Comp Neurol 2003;458:1–10. Kumari A, Thakur MK. Age-dependent decline of Nogo-A protein in the mouse cerebrum. Cell Mol Neurobiol 2014;34:1131–41. Kurowska Z, Brundin P, Schwab ME, Li JY. Intracellular Nogo-A facilitates initiation of neurite formation in mouse midbrain neurons in vitro. Neuroscience 2014;256:456–66. Liu H, Ng CE, Tang BL. Nogo-A expression in mouse central nervous system neurons. Neurosci Lett 2002;328:257–60. Ma Y, Mi YJ, Dai YK, Fu HL, Cui DX, Jin WL. The inverse F-BAR domain protein srGAP2 acts through srGAP3 to modulate neuronal differentiation and neurite outgrowth of mouse neuroblastoma cells. PLOS ONE 2013;8:e57865. Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, et al. Amino-Nogo-A antagonizes reactive oxygen species generation and protects immature primary cortical neurons from oxidative toxicity. Cell Death Differ 2012;19:1175–86. Mingorance-Le Meur A, Zheng B, Soriano E, del Rio JA. Involvement of the myelin-associated inhibitor Nogo-A in early cortical development and neuronal maturation. Cereb Cortex 2007;17:2375–86. Petrinovic MM, Duncan CS, Bourikas D, Weinman O, Montani L, Schroeter A, et al. Neuronal Nogo-A regulates neurite fasciculation, branching and extension in the developing nervous system. Development 2010;137:2539–50. Petrinovic MM, Hourez R, Aloy EM, Dewarrat G, Gall D, Weinmann O, et al. Neuronal Nogo-A negatively regulates dendritic morphology and synaptic transmission in the cerebellum. Proc Natl Acad Sci U S A 2013;110:1083–8. Poulain FE, Sobel A. The microtubule network and neuronal morphogenesis: dynamic and coordinated orchestration through multiple players. Mol Cell Neurosci 2010;43:15–32. Sakakibara A, Ando R, Sapir T, Tanaka T. Microtubule dynamics in neuronal morphogenesis. Open Biol 2013;3:130061. Schwab ME, Strittmatter SM. Nogo limits neural plasticity and recovery from injury. Curr Opin Neurobiol 2014;27C:53–60. Sirajuddin M, Rice LM, Vale RD. Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Nat Cell Biol 2014;16:335–44. Taketomi M, Kinoshita N, Kimura K, Kitada M, Noda T, Asou H, et al. Nogo-A expression in mature oligodendrocytes of rat spinal cord in association with specific molecules. Neurosci Lett 2002;332:37–40. Tarapore P, Hanashiro K, Fukasawa K. Analysis of centrosome localization of BRCA1 and its activity in suppressing centrosomal aster formation. Cell Cycle 2012;11:2931–46.
