Nucleic Acids Research, Vol. 20, No. 14 3779
A new cluster of three tRNA genes in Pseudomonas aeruginosa Marc Bally, Genevieve Ball and Andree Lazdunski Laboratoire de Chimie Bacterienne, Centre National de la Recherche Scientifique, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 9, France EMBL accession no. X66051
Submitted June 19, 1992 Three new tRNA genes were identified by sequencing the DNA from a region located at the min. 40 on the chromosome of Pseudomonas aeruginosa PAOI strain. These genes are located immediately downstream a large operon of nine xcp genes, required for protein secretion (1). Combined with the PAO1 physical genome map, this places this cluster on the SpeI fragment I (2). Analysis of a 863 bp SailI-EcoRI fragment revealed the following organization: 5'-tRNAVal(TAC)-tRNAAsP(GTC)tRNAAsP(GTC), each of these genes sharing more than 90% identity with the corresponding E. coli tRNAvall and tRNAAsPl gene sequences. Such a gene organization has not been identified in E. coli (3). In contrast, the only previously described tRNA gene cluster in P. aeruginosa is arranged as in E. coli, and linked to the EF-Tu gene (4). The genetic organization of these tRNA genes suggests that they are co-transcribed as a single unit. Indeed, analyses of upstream sequences revealed a DNA region with a striking resemblance to the E. coli consensus promoter for tRNA genes (5) (Figure 1). Each of the putative -35 and -10 regions show only one base difference with the corresponding consensus hexamer of E. coli tDNA promoters. A third highly conserved sequence consists of a GC-rich 7 bp-element located immediately 3' to the -10 Pribnow box. In E. coli, this sequence is proposed to represent the discriminator domain common to all genes under stringent control, negatively regulated in response to amino acid limitation (6, 7). The presence of this putative stringency control element in P.aeruginosa indicates that tRNA genes expression in both organisms might be regulated in a similar way. Conservation of these upstream elements is also remarkable in view of the frequent inefficient transcription of P.aeruginosa genes in E.coli, and of the difficulties encountered to tabulate consensus sequences from Pseudomonas identified promoters (8).
A major potential RNA secondary structure (AG-23kCal) was also found in the 3' flanking region of the second tRNAAsP gene. The two tandemly organized tRNAAsP genes described here encode the same anticodon GTC, which corresponds to the preferred Asp codon in P.aeruginosa (9). In contrast, the tRNAval has the anticodon TAC, and decodes specifically GTA, which is a codon very rarely used in this bacterium. In E. coli, rare codons are recognized by the least abundant tRNAs, and a good correspondence was established between tRNA abundance and gene copy number (10). No such data is presently available in Pseudomonas, but the presence of multiple copies of a tRNA gene for a frequently used codon argues for a role of gene copy number in providing a balanced ratio of acceptor species.
ACKNOWLEDGEMENT This work was supported by a grant from the Association Francaise de Lutte contre la Mucoviscidose.
REFERENCES 1. Bally,M., Filloux,A., Akrim,M., Ball,G., Lazdunski,A. and Tommassen,J. (1992) Mol. Microbiol. 6, 1121-1131. 2. Romling,U., Duchene,M., Essar,D.W., Galloway,D., Guidi-Rontani,C.,
3. 4. 5. 6. 7. 8.
9. 10.
Hill,D., Lazdunski,A., Miller,R.V., Schleifer,K.H., Smith,D.W., Toschka,H.Y. and Tummler,B. (1992) J. Bacteriol. 174, 327-330. Komine,Y., Adachi,T., Inokuchi,H. and Ozeki,H. (1990) J. Mol. Biol. 212, 579-598. Hughes,M.A. and Jones,D.S. (1988) Nucleic Acids Res. 16, 7193. Fournier,M.J. and Ozeki,H. (1985) Microbiol. Rev. 49, 379-397. Gallant,J.A. (1979) Annu. Rev. Genet. 13, 393-415. Travers,A.A. (1984) Nucleic Acids Res. 12, 2605-2618. Deretic,V., Konyecsni,W.M., Mohr,C.D., Martin,D.W. and Hibler,N.S. (1989) Bio/Technology 7, 1249-1254. West,S.E.H. and Iglewski,B.H. (1988) Nucleic Acids Res. 16, 9323 -9335. Ikemura,T. (1981) J. Mol. Biol. 146, 1-21.
a.
b.
GCATTGACTTAGGTTTTTCGGTCGGTAGAA CG CTTCGAGAGTGAA *** ***** ~~~**** GTTGAC --- 16-1 8bp --- TATAA CGCCC
Figure 1. Sequence of the upstream region of the The putative stringency control region is boxed.
Asp
Asp
Val tRNA
tRNA
tRNA 1 6bp
1 1 4b
p
tRNAVaI-tRNAAsP-tRNAAsp locus in P.aeruginosa (a), and consensus for E.coli tRNA gene promoter (b) (5).
A new cluster of three tRNA genes in Pseudomonas aeruginosa Marc Bally, Genevieve Ball and Andree Lazdunski Laboratoire de Chimie Bacterienne, Centre National de la Recherche Scientifique, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 9, France EMBL accession no. X66051
Submitted June 19, 1992 Three new tRNA genes were identified by sequencing the DNA from a region located at the min. 40 on the chromosome of Pseudomonas aeruginosa PAOI strain. These genes are located immediately downstream a large operon of nine xcp genes, required for protein secretion (1). Combined with the PAO1 physical genome map, this places this cluster on the SpeI fragment I (2). Analysis of a 863 bp SailI-EcoRI fragment revealed the following organization: 5'-tRNAVal(TAC)-tRNAAsP(GTC)tRNAAsP(GTC), each of these genes sharing more than 90% identity with the corresponding E. coli tRNAvall and tRNAAsPl gene sequences. Such a gene organization has not been identified in E. coli (3). In contrast, the only previously described tRNA gene cluster in P. aeruginosa is arranged as in E. coli, and linked to the EF-Tu gene (4). The genetic organization of these tRNA genes suggests that they are co-transcribed as a single unit. Indeed, analyses of upstream sequences revealed a DNA region with a striking resemblance to the E. coli consensus promoter for tRNA genes (5) (Figure 1). Each of the putative -35 and -10 regions show only one base difference with the corresponding consensus hexamer of E. coli tDNA promoters. A third highly conserved sequence consists of a GC-rich 7 bp-element located immediately 3' to the -10 Pribnow box. In E. coli, this sequence is proposed to represent the discriminator domain common to all genes under stringent control, negatively regulated in response to amino acid limitation (6, 7). The presence of this putative stringency control element in P.aeruginosa indicates that tRNA genes expression in both organisms might be regulated in a similar way. Conservation of these upstream elements is also remarkable in view of the frequent inefficient transcription of P.aeruginosa genes in E.coli, and of the difficulties encountered to tabulate consensus sequences from Pseudomonas identified promoters (8).
A major potential RNA secondary structure (AG-23kCal) was also found in the 3' flanking region of the second tRNAAsP gene. The two tandemly organized tRNAAsP genes described here encode the same anticodon GTC, which corresponds to the preferred Asp codon in P.aeruginosa (9). In contrast, the tRNAval has the anticodon TAC, and decodes specifically GTA, which is a codon very rarely used in this bacterium. In E. coli, rare codons are recognized by the least abundant tRNAs, and a good correspondence was established between tRNA abundance and gene copy number (10). No such data is presently available in Pseudomonas, but the presence of multiple copies of a tRNA gene for a frequently used codon argues for a role of gene copy number in providing a balanced ratio of acceptor species.
ACKNOWLEDGEMENT This work was supported by a grant from the Association Francaise de Lutte contre la Mucoviscidose.
REFERENCES 1. Bally,M., Filloux,A., Akrim,M., Ball,G., Lazdunski,A. and Tommassen,J. (1992) Mol. Microbiol. 6, 1121-1131. 2. Romling,U., Duchene,M., Essar,D.W., Galloway,D., Guidi-Rontani,C.,
3. 4. 5. 6. 7. 8.
9. 10.
Hill,D., Lazdunski,A., Miller,R.V., Schleifer,K.H., Smith,D.W., Toschka,H.Y. and Tummler,B. (1992) J. Bacteriol. 174, 327-330. Komine,Y., Adachi,T., Inokuchi,H. and Ozeki,H. (1990) J. Mol. Biol. 212, 579-598. Hughes,M.A. and Jones,D.S. (1988) Nucleic Acids Res. 16, 7193. Fournier,M.J. and Ozeki,H. (1985) Microbiol. Rev. 49, 379-397. Gallant,J.A. (1979) Annu. Rev. Genet. 13, 393-415. Travers,A.A. (1984) Nucleic Acids Res. 12, 2605-2618. Deretic,V., Konyecsni,W.M., Mohr,C.D., Martin,D.W. and Hibler,N.S. (1989) Bio/Technology 7, 1249-1254. West,S.E.H. and Iglewski,B.H. (1988) Nucleic Acids Res. 16, 9323 -9335. Ikemura,T. (1981) J. Mol. Biol. 146, 1-21.
a.
b.
GCATTGACTTAGGTTTTTCGGTCGGTAGAA CG CTTCGAGAGTGAA *** ***** ~~~**** GTTGAC --- 16-1 8bp --- TATAA CGCCC
Figure 1. Sequence of the upstream region of the The putative stringency control region is boxed.
Asp
Asp
Val tRNA
tRNA
tRNA 1 6bp
1 1 4b
p
tRNAVaI-tRNAAsP-tRNAAsp locus in P.aeruginosa (a), and consensus for E.coli tRNA gene promoter (b) (5).
