GENETIC TESTING AND MOLECULAR BIOMARKERS Volume 18, Number 4, 2014 ª Mary Ann Liebert, Inc. Pp. 274–278 DOI: 10.1089/gtmb.2013.0426
A Multiplex Polymerase Chain Reaction Method for the Simultaneous Detection of GSTM1, GSTT1, and GSTP1 Polymorphisms Yan Deng,1* Wei Cai,2* Jixiong Xu,3 Weifeng Zhu,4 Daya Luo,4 Wei Zhang,3 Weiwei Liu,4 Fusheng Wan,4 and Jinglin Yi 5
Background: Glutathione S-transferases (GSTs) play an important role in the detoxification of a wide variety of toxicants. Among GSTs, GSTM1 and GSTT1 polymorphic deletions and the GSTP1 Ile105Val polymorphism were often studied in combination in many diseases because of their additive effects, but they were usually genotyped by two separate methods. Aim: The purpose of the present study was to develop a simple and reliable method to simultaneously detect these three polymorphisms. Methods: The three polymorphisms of 259 volunteers were genotyped using a multiplex polymerase chain reaction (PCR) method based on a tetra-primer amplification refractory mutation system–PCR (T-ARMS-PCR), and the results were validated by multiplex PCR for GSTM1 and GSTT1 polymorphisms and DNA sequencing of the GSTP1 Ile105Val polymorphism, respectively. Results: The multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms based on T-ARMS-PCR can simultaneous detect the three polymorphisms in a single PCR. The results of this method are in perfect accord with the results of the multiplex PCR method of determining GSTM1, GSTT1 polymorphisms, and DNA sequencing of GSTP1 Ile105Val polymorphism. Conclusion: The novel multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms is simple, fast, low-cost, and reliable for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms.
Introduction
G
lutathione S-transferases (GSTs) are a superfamily of phase II enzymes that play an important role in metabolism and detoxification of numerous endo- and xenobiotics, including environmental carcinogens, chemotherapeutic agents, and reactive oxygen species (Wu and Dong, 2012; Rebbeck 1997). In humans, GSTs include many cytosolic, mitochondrial, and microsomal proteins. The cytosolic GST group contains at least 18 genes subdivided into seven distinct classes (Board and Menon, 2013). Some polymorphisms of these genes have a direct impact on the structure, function, and expression of human cytosolic GSTs (Board and Menon, 2013). The most commonly studied GST polymorphisms include a GSTM1 deletion, a GSTT1 deletion, and the GSTP1 Ile105Val (rs1695) polymorphism. People with homozygous deletions of GSTM1 or GSTT1 have no activity of the respective enzyme (Zhong et al., 1991; Bruhn
et al., 1998). The GSTP1 Ile105Val polymorphism is an A–G transition at nucleotide 313 of GSTP1. The substitution of valine decreases the enzyme activity (Ali-Osman et al., 1997; Johansson et al., 1998). All three polymorphisms are associated with the occurrence and progression of multiple diseases, such as cancer (Palma et al., 2010; Yadav et al., 2010; Hashemi et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013), diabetes mellitus (Ramprasath et al., 2011; Moasser et al., 2012), and idiopathic male infertility (Safarinejad et al., 2010). Moreover, these polymorphisms are also associated with the response to breast cancer treatment (Ambrosone et al., 2001; Romero et al., 2012). Because all three are functional polymorphisms of GSTs, they have been frequently studied in combination (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail
1
Department of Pediatric Ophthalmology, the Second Affiliated Hospital of Nanchang University, Nanchang, China. Department of Medical Genetics, College of Basic Medical Science of Nanchang University, Nanchang, China. 3 Department of Endocrinology and Metabolism, the First Affiliated Hospital of Nanchang University, Nanchang, China. 4 Department of Biochemistry and Molecular Biology, College of Basic Medical Science of Nanchang University, Nanchang, China. 5 Department of Ophthalmology, Affiliated Eye Hospital of Nanchang University, Nanchang, China. *These authors contributed equally to this work. 2
274
SIMULTANEOUS DETECTION OF THREE GST POLYMORPHISMS
et al., 2013). GSTT1 and GSTM1 polymorphisms are usually assessed by multiplex polymerase chain reaction (PCR) (Ambrosone et al., 2001; Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). For the GSTP1 Ile105Val polymorphism, PCR restriction fragment-length polymorphism is the most commonly used genotyping method (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Moasser et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). This technique requires the use of restriction enzymes and incubation for long periods of time. The tetra-primer amplification refractory mutation system– PCR (T-ARMS-PCR) method is a fast, cost-effective, reliable method for single-nucleotide polymorphism (SNP) genotyping (Ye et al., 2001). Because it does not require any special equipment, the assay can be set up in most molecular biology laboratories (Etlik et al., 2011). A quadruplex T-ARMS-PCR method has been developed to detect three SNPs and one indel polymorphism in a single PCR (Lajin et al. 2012a). The aim of the present work was to develop a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms in a single PCR to reduce detection cost and time. Materials and Methods Participants
The study participants consisted of 259 volunteers living in Jiangxi, China. Each participant provided informed consent. The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Nanchang University. DNA extraction
For DNA extraction, 2 mL of blood was obtained from each participant. The genomic DNA was purified from whole blood using a DNA isolation kit (Bioteke, Beijing, China), and the procedure was performed according to the instruction manual. Multiplex PCR method of the three polymorphisms
Table 1 shows the sequences of primers used for multiplex PCR of the three polymorphisms. A mismatch at the third nucleotide from the 3¢ terminus of the GSTP1 allele-specific
275
primers was introduced to maximize specificity. The primers for the GSTM1 and GSTT1 polymorphisms can be found elsewhere (Chen et al., 1996; Yadav et al., 2010). The PCR (10 mL) contained 5 mL of 2 · Taq master mix (SinoBio, Shanghai, China), eight primers (the final concentration of each primer is listed in Table 1), and 10 ng of genomic DNA. PCR cycling was carried out on a MG96G thermal cycler (LongGene, Hangzhou, China). Amplification was performed by initial denaturation at 94C for 3 min, followed by 35 cycles of 94C for 20 s, 60C for 20 s, and 72C for 30 s. A final extension of 72C for 5 min was performed and then the reaction was cooled to 10C. PCR products were identified by electrophoresis on a 2% agarose gel. The gel was photographed using a JS-680B gel imaging system (Peiqing, Shanghai, China). Method validation
The b-globin gene forward (5¢-CAACTTCATCCA CGTTCACC-3¢) and reverse (5¢-GAAGAGCCAAGGACA GGTAC-3¢) primers were used as an internal positive control for the multiplex PCR method to avoid false-negative results (Yadav et al., 2010). The PCR was performed in a 10-mL mixture containing 5 mL of 2 · Taq master mix, 0.2 mM of each primer, and 10 ng of genomic DNA. Amplification was performed by initial denaturation at 94C for 3 min, followed by 35 cycles of 94C for 20 s, 60C for 20 s, and 72C for 25 s, and a final extension of 72C for 5 min. The product lengths were 219 bp, 459 bp, and 268 bp for GSTM1, GSTT1, and b-globin, respectively. Absence and presence of PCR products for GSTM1 and GSTT1 were considered as null and positive genotypes, respectively. For the GSTP1 Ile105Val polymorphism, 26 samples (about 10% of the total samples) were randomly sequenced (Sangon, Shanghai, China). The PCR (10 mL) contained 5 mL of 2 · Taq master mix, 0.2 mM of GSTP1-common-F, 0.2 mM of GSTP1common-R, and 10 ng of genomic DNA. The PCR cycling conditions were the same as those of the multiplex PCR method. Results Multiplex PCR of the three polymorphisms
A representative result of agarose gel electrophoresis is shown in Figure 1. The amplified DNA fragments are 284 bp for GSTP1 105Val (313G), 347 bp for GSTP1 105Ile (313A), 219 bp for GSTM1, and 459 bp for GSTT1, as well as a common 586 bp band for GSTP1. The bands were sufficiently clear for each sample to be genotyped correctly. All genotype combinations of the three polymorphisms are demonstrated
Table 1. Primers for Multiplex Polymerase Chain Reaction of the Three Polymorphisms Primer GSTP1-common-F GSTP1-common-R GSTP1-G GSTP1-A GSTM1-F GSTM1-R GSTT1-F GSTT1-R a
Sequencea (5¢–3¢)
Concentration (lM)
AGGTGTCAGGTGAGCTCTGA CTCTGGCTACTCCAGGAAGC CATAGTTGGTGTAGATGAGGGATAC AGGACCTCCGCTGCAAATCCA GAACTCCCTGAAAAGCTAAAGC GTTGGGCTCAAATATACGGTGG TTCCTTACTGGTCCTCACATCTC TCACCGGATCATGGCCAGCA
0.30 0.30 1.60 0.80 0.15 0.15 0.15 0.15
Specific nucleotides are underlined; specificity-enhancing mismatches are shown in bold italics.
Expected products Common 586 bp G allele 284 bp A allele 347 bp 219 bp 459 bp
276
DENG ET AL.
FIG. 1. Genotyping of three polymorphisms by multiplex polymerase chain reaction. Lanes 1–11 show all genotype combinations of the three polymorphisms, and lane 12 is a negative control. Lane M is DNA marker I. in Fig. 1. Table 2 shows the observed genotype frequencies for GSTP1 Ile105Val, GSTM1, and GSTT1 among the 259 volunteers. Multiplex PCR of GSTM1 and GSTT1
All samples were genotyped by the multiplex PCR method for GSTM1 and GSTT1. No difference in genotype assignment was observed in any of the samples. Figure 2 shows the electrophoretogram of the multiplex PCR for GSTM1 and GSTT1 of 11 different samples, corresponding to the samples described in Figure 1. DNA sequencing
The results of DNA sequencing for the GSTP1 Ile105Val polymorphism were consistent with the results of the multiplex PCR method for the three polymorphisms. Discussion
GSTM1, GSTT1, and GSTP1 polymorphisms have been extensively investigated because they may influence enzyme
Table 2. Genotype Frequencies of GSTM1, GSTT1, and GSTP1 Polymorphisms Among 259 Volunteers Genotype GSTP1
GSTM1
GSTT1
AA AG GG + AA AA AA AA AG AG AG AG GG GG GG
+ + + + + +
+ + + + + + -
Participants, n (%) 183 69 7 162 97 116 143 49 65 33 36 19 27 12 11 2 4 1
(70.7) (26.6) (2.7) (62.5) (37.5) (44.8) (55.2) (18.9) (25.1) (12.7) (13.9) (7.3) (10.4) (4.6) (4.2) (0.8) (1.5) (0.4)
FIG. 2. Genotyping of GSTM1 and GSTT1 by multiplex polymerase chain reaction. Lanes 1–11 correspond to the samples described in Figure 1, and lane 12 is a negative control. Lane M is DNA marker I. activity. To date, many meta-analyses have investigated the relationships between GST polymorphisms and many different diseases. The dual null genotype of GSTM1 and GSTT1 was associated with increased risk of prostate cancer (Gong et al., 2012), diabetes mellitus (Zhang et al., 2013), and hepatocellular carcinoma in Chinese people (Liu et al., 2013). The GSTM1 null genotype was associated with increased risk of prostate cancer (Gong et al., 2012), childhood asthma ( Li et al., 2013), male infertility (Ying et al., 2013), diabetes mellitus (Zhang et al., 2013), and oral cancer in the Asian population (Zhang et al., 2011), while the GSTT1 null genotype was associated with increased risk of chronic myeloid leukemia (Zintzaras, 2009) and diabetes mellitus (Zhang et al., 2013). The GSTP1 Ile105Val polymorphism may increase susceptibility to bladder cancer (Wang et al., 2013) and breast cancer in the Asian population (Lu et al., 2011). The GSTT1 null genotype and GSTP1 Ile105Val polymorphism are also associated with high risk of prostate cancer (Gong et al., 2012), and the GSTM1 null genotype and GSTP1 Ile105Val polymorphism are associated with high risk of primary open-angle glaucoma (Yu et al., 2013). Compared with single gene analysis, the investigation of multiple genetic polymorphisms could contribute to a better understanding of the effects of susceptibility genes on cancer risk (Palma et al., 2010). Thus, it is necessary to develop a simple and reliable method to simultaneously detect these three polymorphisms. Because of its simplicity and reliability, T-ARMS-PCR has been widely used to genotype SNPs and mutations (Etlik et al., 2011; Lajin et al., 2012a; Lajin et al., 2012b). We previously genotyped two SNPs in the CYP19A1 gene using the T-ARMS-PCR method (data not shown). In our experience, to achieve optimal results with T-ARMS-PCR in a short period, the following three steps should be taken. The first step is to find a heterozygous sample. By using an annealing temperature of 56C, two allele-specific fragments, together with the control fragment, are amplified in 10 samples (the primer concentrations of specific fragments are twice those of control fragments). The sample will be heterozygous if the products for both of the allele-specific fragments are observed, whereas a product for only one specific fragment should emerge in other samples. The second step is determination of an optimal annealing temperature. For the determined heterozygous sample, the annealing temperature is altered from 56C to 65C, and the two specific fragments are amplified together with the control fragment. The temperature at which the three fragments are brightest is the optimal annealing temperature. The final step is to determine the optimal primer concentrations. T-ARMS-PCR is performed
SIMULTANEOUS DETECTION OF THREE GST POLYMORPHISMS
at the previously determined optimal annealing temperature with different primer concentrations. The primer concentrations at which the two specific fragments are evenly bright are considered optimal concentrations for T-ARMS-PCR. Consistent with the results of Lajin et al., we also found that introducing mismatches at the third nucleotide from the 3¢ terminus of the primers played a crucial role in the specificity of T-ARMS-PCR, with allele-specific primers losing their specificity upon removal of these mismatches (Lajin et al., 2012b). Moreover, Taq master mix may be an important factor that affects band intensities and the absence or presence of the common band. To get uniform results, Taq master mix should be of the same production lot. On the basis of T-ARMS-PCR of the GSTP1 Ile105Val polymorphism, we developed a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms. For 10 samples, this method can be completed within 4 h after specimen receipt (60 min for DNA extraction, 100 min for PCR amplification, and 40 min for agarose gel electrophoresis). The results of this method are in accordance with the results of the multiplex PCR method for GSTM1 and GSTT1 and DNA sequencing of GSTP1. This confirmed the reliability of this method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms. This method is more convenient and economical than the traditional PCR restriction fragment-length polymorphism because it does not require incubation with costly restriction enzymes for several hours. Other methods, such as denaturing high-performance liquid chromatography, real-time PCR, capillary electrophoresis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and direct DNA sequencing, can also be used to detect these polymorphisms, but they require expensive equipment that might not be routinely available in most laboratories (Etlik et al., 2011). At present, we are using this method to investigate the relationships between diabetic retinopathy and GSTM1, GSTT1, and GSTP1 polymorphisms. Conclusion
In summary, novel multiplex PCR is an accurate, simple, fast, low-cost method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms that can be used in most molecular biology laboratories. Acknowledgments
The authors thank volunteers who donated blood samples for this study. This work was supported by the National Natural Science Foundation of China (no. 30860319, 81160105, 81160248) and the Project Foundation of Jiangxi Education Department (no. GJJ13165). Author Disclosure Statement
No competing financial interests exist. References
Ali-Osman F, Akande O, Antoun G, et al. (1997) Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants. Evidence for differential
277
catalytic activity of the encoded proteins. J Biol Chem 272: 10004–10012. Ambrosone CB, Sweeney C, Coles BF, et al. (2001) Polymorphisms in glutathione S-transferases (GSTM1 and GSTT1) and survival after treatment for breast cancer. Cancer Res 61:7130-–7135. Board PG, Menon D (2013) Glutathione transferases, regulators of cellular metabolism and physiology. Biochim Biophys Acta 1830:3267–3288. Bruhn C, Brockmoller J, Kerb R, et al. (1998) Concordance between enzyme activity and genotype of glutathione S-transferase theta (GSTT1). Biochem Pharmacol 56: 1189– 1193. Chen CL, Liu Q, Relling MV (1996) Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase chain reaction in American whites and blacks. Pharmacogenetics 6:187–191. Cotignola J, Leonardi DB, Shahabi A, et al. (2013) GlutathioneS-transferase (GST) polymorphisms are associated with relapse after radical prostatectomy. Prostate Cancer Prostatic Dis 16:28–34. Etlik O, Koksal V, Arican-Baris ST, et al. (2011) Development and validation of a cost-effective in-house method, tetraprimer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol Cell Probes 25:177–181. Gong M, Dong W, Shi Z, et al. (2012) Genetic polymorphisms of GSTM1, GSTT1, and GSTP1 with prostate cancer risk: a meta-analysis of 57 studies. PLoS One 7: e50587. Hashemi M, Eskandari-Nasab E, Fazaeli A, et al. (2012) Association between polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer risk in a sample Iranian population. Biomark Med 6:797–803. Johansson AS, Stenberg G, Widersten M, et al. (1998) Structure-activity relationships and thermal stability of human glutathione transferase P1-1 governed by the H-site residue 105. J Mol Biol 278:687–698. Lajin B, Alachkar A, Alhaj Sakur A (2012a) A quadruplex tetra-primer ARMS-PCR method for the simultaneous detection of TP53 Arg72Pro, IVS3 16bp Del/Ins and IVS6 + 62A > G, and NQO1 C609T polymorphisms. Gene 504:268– 273. Lajin B, Alachkar A, Sakur AA (2012b) Triplex tetra-primer ARMS-PCR method for the simultaneous detection of MTHFR c.677C > T and c.1298A > C, and MTRR c.66A > G polymorphisms of the folate-homocysteine metabolic pathway. Mol Cell Probes 26:16–20. Li F, Li S, Chang H, et al. (2013) Quantitative assessment of the association between the GSTM1-null genotype and the risk of childhood asthma. Genet Test Mol Biomarkers 17:656–661. Liu K, Zhang L, Lin X, et al. (2013) Association of GST genetic polymorphisms with the susceptibility to hepatocellular carcinoma (HCC) in Chinese population evaluated by an updated systematic meta-analysis. PLoS One 8:e57043. Lu S, Wang Z, Cui D, et al. (2011) Glutathione S-transferase P1 Ile105Val polymorphism and breast cancer risk: a metaanalysis involving 34,658 subjects. Breast Cancer Res Treat 125:253–259. Moasser E, Kazemi-Nezhad SR, Saadat M, et al. (2012) Study of the association between glutathione S-transferase (GSTM1, GSTT1, GSTP1) polymorphisms with type II diabetes mellitus in southern of Iran. Mol Biol Rep 39:10187– 10192. Oliveira C, Lourenco GJ, Sagarra RA, et al. (2012) Polymorphisms of glutathione S-transferase Mu 1 (GSTM1),
278
Theta 1 (GSTT1), and Pi 1 (GSTP1) genes and epithelial ovarian cancer risk. Dis Markers 33:155–159. Palma S, Novelli F, Padua L, et al. (2010) Interaction between glutathione-S-transferase polymorphisms, smoking habit, and HPV infection in cervical cancer risk. J Cancer Res Clin Oncol 136:1101–1109. Ramprasath T, Senthil Murugan P, Prabakaran AD, et al. (2011) Potential risk modifications of GSTT1, GSTM1 and GSTP1 (glutathione-S-transferases) variants and their association to CAD in patients with type-2 diabetes. Biochem Biophys Res Commun 407:49–53. Rebbeck TR (1997) Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev 6:733–743. Romero A, Martin M, Oliva B, et al. (2012) Glutathione S-transferase P1 c.313A > G polymorphism could be useful in the prediction of doxorubicin response in breast cancer patients. Ann Oncol 23:1750–1756. Russo A, Francelin PR, Galbiatti AL, et al. (2013) Association between GSTP1, GSTM1 and GSTT1 polymorphisms involved in xenobiotic metabolism and head and neck cancer development. Mol Biol Rep 40:4181–4188. Safarinejad MR, Shafiei N, Safarinejad S (2010) The association of glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1, GSTP1) with idiopathic male infertility. J Hum Genet 55:565–570. Sohail A, Kanwal N, Ali M, et al. (2013) Effects of glutathioneS-transferase polymorphisms on the risk of breast cancer: a population-based case-control study in Pakistan. Environ Toxicol Pharmacol 35:143–153. Wang Z, Xue L, Chong T, et al. (2013) Quantitative assessment of the association between glutathione S-transferase P1 Ile105Val polymorphism and bladder cancer risk. Tumour Biol 34:1651–1657. Wu B, Dong D (2012) Human cytosolic glutathione transferases: structure, function, and drug discovery. Trends Pharmacol Sci 33:656–668.
DENG ET AL.
Yadav DS, Devi TR, Ihsan R, et al. (2010) Polymorphisms of glutathione-S-transferase genes and the risk of aerodigestive tract cancers in the Northeast Indian population. Genet Test Mol Biomarkers 14:715–723. Ye S, Dhillon S, Ke X, et al. (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 29:E88–88. Ying HQ, Qi Y, Pu XY, et al. (2013) Association of GSTM1 and GSTT1 genes with the susceptibility to male infertility: result from a meta-analysis. Genet Test Mol Biomarkers 17:535–542. Yu Y, Weng Y, Guo J, et al. (2013) Association of glutathione S transferases polymorphisms with glaucoma: a meta-analysis. PLoS One 8:e54037. Zhang J, Liu H, Yan H, et al. (2013) Null genotypes of GSTM1 and GSTT1 contribute to increased risk of diabetes mellitus: a meta-analysis. Gene 518:405–411. Zhang ZJ, Hao K, Shi R, et al. (2011) Glutathione S-transferase M1 (GSTM1) and glutathione S-transferase T1 (GSTT1) null polymorphisms, smoking, and their interaction in oral cancer: a HuGE review and meta-analysis. Am J Epidemiol 173:847–857. Zhong S, Howie AF, Ketterer B, et al. (1991) Glutathione Stransferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis 12:1533–1537. Zintzaras E (2009) Glutathione S-transferase M1 and T1 genes and susceptibility to chronic myeloid leukemia: a metaanalysis. Genet Test Mol Biomarkers 13:791–797.
Address correspondence to: Jinglin Yi, MS Department of Ophthalmology Affiliated Eye Hospital of Nanchang University 461 Bayi Street Nanchang, 330006 China E-mail: [email protected]
A Multiplex Polymerase Chain Reaction Method for the Simultaneous Detection of GSTM1, GSTT1, and GSTP1 Polymorphisms Yan Deng,1* Wei Cai,2* Jixiong Xu,3 Weifeng Zhu,4 Daya Luo,4 Wei Zhang,3 Weiwei Liu,4 Fusheng Wan,4 and Jinglin Yi 5
Background: Glutathione S-transferases (GSTs) play an important role in the detoxification of a wide variety of toxicants. Among GSTs, GSTM1 and GSTT1 polymorphic deletions and the GSTP1 Ile105Val polymorphism were often studied in combination in many diseases because of their additive effects, but they were usually genotyped by two separate methods. Aim: The purpose of the present study was to develop a simple and reliable method to simultaneously detect these three polymorphisms. Methods: The three polymorphisms of 259 volunteers were genotyped using a multiplex polymerase chain reaction (PCR) method based on a tetra-primer amplification refractory mutation system–PCR (T-ARMS-PCR), and the results were validated by multiplex PCR for GSTM1 and GSTT1 polymorphisms and DNA sequencing of the GSTP1 Ile105Val polymorphism, respectively. Results: The multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms based on T-ARMS-PCR can simultaneous detect the three polymorphisms in a single PCR. The results of this method are in perfect accord with the results of the multiplex PCR method of determining GSTM1, GSTT1 polymorphisms, and DNA sequencing of GSTP1 Ile105Val polymorphism. Conclusion: The novel multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms is simple, fast, low-cost, and reliable for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms.
Introduction
G
lutathione S-transferases (GSTs) are a superfamily of phase II enzymes that play an important role in metabolism and detoxification of numerous endo- and xenobiotics, including environmental carcinogens, chemotherapeutic agents, and reactive oxygen species (Wu and Dong, 2012; Rebbeck 1997). In humans, GSTs include many cytosolic, mitochondrial, and microsomal proteins. The cytosolic GST group contains at least 18 genes subdivided into seven distinct classes (Board and Menon, 2013). Some polymorphisms of these genes have a direct impact on the structure, function, and expression of human cytosolic GSTs (Board and Menon, 2013). The most commonly studied GST polymorphisms include a GSTM1 deletion, a GSTT1 deletion, and the GSTP1 Ile105Val (rs1695) polymorphism. People with homozygous deletions of GSTM1 or GSTT1 have no activity of the respective enzyme (Zhong et al., 1991; Bruhn
et al., 1998). The GSTP1 Ile105Val polymorphism is an A–G transition at nucleotide 313 of GSTP1. The substitution of valine decreases the enzyme activity (Ali-Osman et al., 1997; Johansson et al., 1998). All three polymorphisms are associated with the occurrence and progression of multiple diseases, such as cancer (Palma et al., 2010; Yadav et al., 2010; Hashemi et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013), diabetes mellitus (Ramprasath et al., 2011; Moasser et al., 2012), and idiopathic male infertility (Safarinejad et al., 2010). Moreover, these polymorphisms are also associated with the response to breast cancer treatment (Ambrosone et al., 2001; Romero et al., 2012). Because all three are functional polymorphisms of GSTs, they have been frequently studied in combination (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail
1
Department of Pediatric Ophthalmology, the Second Affiliated Hospital of Nanchang University, Nanchang, China. Department of Medical Genetics, College of Basic Medical Science of Nanchang University, Nanchang, China. 3 Department of Endocrinology and Metabolism, the First Affiliated Hospital of Nanchang University, Nanchang, China. 4 Department of Biochemistry and Molecular Biology, College of Basic Medical Science of Nanchang University, Nanchang, China. 5 Department of Ophthalmology, Affiliated Eye Hospital of Nanchang University, Nanchang, China. *These authors contributed equally to this work. 2
274
SIMULTANEOUS DETECTION OF THREE GST POLYMORPHISMS
et al., 2013). GSTT1 and GSTM1 polymorphisms are usually assessed by multiplex polymerase chain reaction (PCR) (Ambrosone et al., 2001; Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). For the GSTP1 Ile105Val polymorphism, PCR restriction fragment-length polymorphism is the most commonly used genotyping method (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Moasser et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). This technique requires the use of restriction enzymes and incubation for long periods of time. The tetra-primer amplification refractory mutation system– PCR (T-ARMS-PCR) method is a fast, cost-effective, reliable method for single-nucleotide polymorphism (SNP) genotyping (Ye et al., 2001). Because it does not require any special equipment, the assay can be set up in most molecular biology laboratories (Etlik et al., 2011). A quadruplex T-ARMS-PCR method has been developed to detect three SNPs and one indel polymorphism in a single PCR (Lajin et al. 2012a). The aim of the present work was to develop a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms in a single PCR to reduce detection cost and time. Materials and Methods Participants
The study participants consisted of 259 volunteers living in Jiangxi, China. Each participant provided informed consent. The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Nanchang University. DNA extraction
For DNA extraction, 2 mL of blood was obtained from each participant. The genomic DNA was purified from whole blood using a DNA isolation kit (Bioteke, Beijing, China), and the procedure was performed according to the instruction manual. Multiplex PCR method of the three polymorphisms
Table 1 shows the sequences of primers used for multiplex PCR of the three polymorphisms. A mismatch at the third nucleotide from the 3¢ terminus of the GSTP1 allele-specific
275
primers was introduced to maximize specificity. The primers for the GSTM1 and GSTT1 polymorphisms can be found elsewhere (Chen et al., 1996; Yadav et al., 2010). The PCR (10 mL) contained 5 mL of 2 · Taq master mix (SinoBio, Shanghai, China), eight primers (the final concentration of each primer is listed in Table 1), and 10 ng of genomic DNA. PCR cycling was carried out on a MG96G thermal cycler (LongGene, Hangzhou, China). Amplification was performed by initial denaturation at 94C for 3 min, followed by 35 cycles of 94C for 20 s, 60C for 20 s, and 72C for 30 s. A final extension of 72C for 5 min was performed and then the reaction was cooled to 10C. PCR products were identified by electrophoresis on a 2% agarose gel. The gel was photographed using a JS-680B gel imaging system (Peiqing, Shanghai, China). Method validation
The b-globin gene forward (5¢-CAACTTCATCCA CGTTCACC-3¢) and reverse (5¢-GAAGAGCCAAGGACA GGTAC-3¢) primers were used as an internal positive control for the multiplex PCR method to avoid false-negative results (Yadav et al., 2010). The PCR was performed in a 10-mL mixture containing 5 mL of 2 · Taq master mix, 0.2 mM of each primer, and 10 ng of genomic DNA. Amplification was performed by initial denaturation at 94C for 3 min, followed by 35 cycles of 94C for 20 s, 60C for 20 s, and 72C for 25 s, and a final extension of 72C for 5 min. The product lengths were 219 bp, 459 bp, and 268 bp for GSTM1, GSTT1, and b-globin, respectively. Absence and presence of PCR products for GSTM1 and GSTT1 were considered as null and positive genotypes, respectively. For the GSTP1 Ile105Val polymorphism, 26 samples (about 10% of the total samples) were randomly sequenced (Sangon, Shanghai, China). The PCR (10 mL) contained 5 mL of 2 · Taq master mix, 0.2 mM of GSTP1-common-F, 0.2 mM of GSTP1common-R, and 10 ng of genomic DNA. The PCR cycling conditions were the same as those of the multiplex PCR method. Results Multiplex PCR of the three polymorphisms
A representative result of agarose gel electrophoresis is shown in Figure 1. The amplified DNA fragments are 284 bp for GSTP1 105Val (313G), 347 bp for GSTP1 105Ile (313A), 219 bp for GSTM1, and 459 bp for GSTT1, as well as a common 586 bp band for GSTP1. The bands were sufficiently clear for each sample to be genotyped correctly. All genotype combinations of the three polymorphisms are demonstrated
Table 1. Primers for Multiplex Polymerase Chain Reaction of the Three Polymorphisms Primer GSTP1-common-F GSTP1-common-R GSTP1-G GSTP1-A GSTM1-F GSTM1-R GSTT1-F GSTT1-R a
Sequencea (5¢–3¢)
Concentration (lM)
AGGTGTCAGGTGAGCTCTGA CTCTGGCTACTCCAGGAAGC CATAGTTGGTGTAGATGAGGGATAC AGGACCTCCGCTGCAAATCCA GAACTCCCTGAAAAGCTAAAGC GTTGGGCTCAAATATACGGTGG TTCCTTACTGGTCCTCACATCTC TCACCGGATCATGGCCAGCA
0.30 0.30 1.60 0.80 0.15 0.15 0.15 0.15
Specific nucleotides are underlined; specificity-enhancing mismatches are shown in bold italics.
Expected products Common 586 bp G allele 284 bp A allele 347 bp 219 bp 459 bp
276
DENG ET AL.
FIG. 1. Genotyping of three polymorphisms by multiplex polymerase chain reaction. Lanes 1–11 show all genotype combinations of the three polymorphisms, and lane 12 is a negative control. Lane M is DNA marker I. in Fig. 1. Table 2 shows the observed genotype frequencies for GSTP1 Ile105Val, GSTM1, and GSTT1 among the 259 volunteers. Multiplex PCR of GSTM1 and GSTT1
All samples were genotyped by the multiplex PCR method for GSTM1 and GSTT1. No difference in genotype assignment was observed in any of the samples. Figure 2 shows the electrophoretogram of the multiplex PCR for GSTM1 and GSTT1 of 11 different samples, corresponding to the samples described in Figure 1. DNA sequencing
The results of DNA sequencing for the GSTP1 Ile105Val polymorphism were consistent with the results of the multiplex PCR method for the three polymorphisms. Discussion
GSTM1, GSTT1, and GSTP1 polymorphisms have been extensively investigated because they may influence enzyme
Table 2. Genotype Frequencies of GSTM1, GSTT1, and GSTP1 Polymorphisms Among 259 Volunteers Genotype GSTP1
GSTM1
GSTT1
AA AG GG + AA AA AA AA AG AG AG AG GG GG GG
+ + + + + +
+ + + + + + -
Participants, n (%) 183 69 7 162 97 116 143 49 65 33 36 19 27 12 11 2 4 1
(70.7) (26.6) (2.7) (62.5) (37.5) (44.8) (55.2) (18.9) (25.1) (12.7) (13.9) (7.3) (10.4) (4.6) (4.2) (0.8) (1.5) (0.4)
FIG. 2. Genotyping of GSTM1 and GSTT1 by multiplex polymerase chain reaction. Lanes 1–11 correspond to the samples described in Figure 1, and lane 12 is a negative control. Lane M is DNA marker I. activity. To date, many meta-analyses have investigated the relationships between GST polymorphisms and many different diseases. The dual null genotype of GSTM1 and GSTT1 was associated with increased risk of prostate cancer (Gong et al., 2012), diabetes mellitus (Zhang et al., 2013), and hepatocellular carcinoma in Chinese people (Liu et al., 2013). The GSTM1 null genotype was associated with increased risk of prostate cancer (Gong et al., 2012), childhood asthma ( Li et al., 2013), male infertility (Ying et al., 2013), diabetes mellitus (Zhang et al., 2013), and oral cancer in the Asian population (Zhang et al., 2011), while the GSTT1 null genotype was associated with increased risk of chronic myeloid leukemia (Zintzaras, 2009) and diabetes mellitus (Zhang et al., 2013). The GSTP1 Ile105Val polymorphism may increase susceptibility to bladder cancer (Wang et al., 2013) and breast cancer in the Asian population (Lu et al., 2011). The GSTT1 null genotype and GSTP1 Ile105Val polymorphism are also associated with high risk of prostate cancer (Gong et al., 2012), and the GSTM1 null genotype and GSTP1 Ile105Val polymorphism are associated with high risk of primary open-angle glaucoma (Yu et al., 2013). Compared with single gene analysis, the investigation of multiple genetic polymorphisms could contribute to a better understanding of the effects of susceptibility genes on cancer risk (Palma et al., 2010). Thus, it is necessary to develop a simple and reliable method to simultaneously detect these three polymorphisms. Because of its simplicity and reliability, T-ARMS-PCR has been widely used to genotype SNPs and mutations (Etlik et al., 2011; Lajin et al., 2012a; Lajin et al., 2012b). We previously genotyped two SNPs in the CYP19A1 gene using the T-ARMS-PCR method (data not shown). In our experience, to achieve optimal results with T-ARMS-PCR in a short period, the following three steps should be taken. The first step is to find a heterozygous sample. By using an annealing temperature of 56C, two allele-specific fragments, together with the control fragment, are amplified in 10 samples (the primer concentrations of specific fragments are twice those of control fragments). The sample will be heterozygous if the products for both of the allele-specific fragments are observed, whereas a product for only one specific fragment should emerge in other samples. The second step is determination of an optimal annealing temperature. For the determined heterozygous sample, the annealing temperature is altered from 56C to 65C, and the two specific fragments are amplified together with the control fragment. The temperature at which the three fragments are brightest is the optimal annealing temperature. The final step is to determine the optimal primer concentrations. T-ARMS-PCR is performed
SIMULTANEOUS DETECTION OF THREE GST POLYMORPHISMS
at the previously determined optimal annealing temperature with different primer concentrations. The primer concentrations at which the two specific fragments are evenly bright are considered optimal concentrations for T-ARMS-PCR. Consistent with the results of Lajin et al., we also found that introducing mismatches at the third nucleotide from the 3¢ terminus of the primers played a crucial role in the specificity of T-ARMS-PCR, with allele-specific primers losing their specificity upon removal of these mismatches (Lajin et al., 2012b). Moreover, Taq master mix may be an important factor that affects band intensities and the absence or presence of the common band. To get uniform results, Taq master mix should be of the same production lot. On the basis of T-ARMS-PCR of the GSTP1 Ile105Val polymorphism, we developed a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms. For 10 samples, this method can be completed within 4 h after specimen receipt (60 min for DNA extraction, 100 min for PCR amplification, and 40 min for agarose gel electrophoresis). The results of this method are in accordance with the results of the multiplex PCR method for GSTM1 and GSTT1 and DNA sequencing of GSTP1. This confirmed the reliability of this method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms. This method is more convenient and economical than the traditional PCR restriction fragment-length polymorphism because it does not require incubation with costly restriction enzymes for several hours. Other methods, such as denaturing high-performance liquid chromatography, real-time PCR, capillary electrophoresis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and direct DNA sequencing, can also be used to detect these polymorphisms, but they require expensive equipment that might not be routinely available in most laboratories (Etlik et al., 2011). At present, we are using this method to investigate the relationships between diabetic retinopathy and GSTM1, GSTT1, and GSTP1 polymorphisms. Conclusion
In summary, novel multiplex PCR is an accurate, simple, fast, low-cost method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms that can be used in most molecular biology laboratories. Acknowledgments
The authors thank volunteers who donated blood samples for this study. This work was supported by the National Natural Science Foundation of China (no. 30860319, 81160105, 81160248) and the Project Foundation of Jiangxi Education Department (no. GJJ13165). Author Disclosure Statement
No competing financial interests exist. References
Ali-Osman F, Akande O, Antoun G, et al. (1997) Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants. Evidence for differential
277
catalytic activity of the encoded proteins. J Biol Chem 272: 10004–10012. Ambrosone CB, Sweeney C, Coles BF, et al. (2001) Polymorphisms in glutathione S-transferases (GSTM1 and GSTT1) and survival after treatment for breast cancer. Cancer Res 61:7130-–7135. Board PG, Menon D (2013) Glutathione transferases, regulators of cellular metabolism and physiology. Biochim Biophys Acta 1830:3267–3288. Bruhn C, Brockmoller J, Kerb R, et al. (1998) Concordance between enzyme activity and genotype of glutathione S-transferase theta (GSTT1). Biochem Pharmacol 56: 1189– 1193. Chen CL, Liu Q, Relling MV (1996) Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase chain reaction in American whites and blacks. Pharmacogenetics 6:187–191. Cotignola J, Leonardi DB, Shahabi A, et al. (2013) GlutathioneS-transferase (GST) polymorphisms are associated with relapse after radical prostatectomy. Prostate Cancer Prostatic Dis 16:28–34. Etlik O, Koksal V, Arican-Baris ST, et al. (2011) Development and validation of a cost-effective in-house method, tetraprimer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol Cell Probes 25:177–181. Gong M, Dong W, Shi Z, et al. (2012) Genetic polymorphisms of GSTM1, GSTT1, and GSTP1 with prostate cancer risk: a meta-analysis of 57 studies. PLoS One 7: e50587. Hashemi M, Eskandari-Nasab E, Fazaeli A, et al. (2012) Association between polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer risk in a sample Iranian population. Biomark Med 6:797–803. Johansson AS, Stenberg G, Widersten M, et al. (1998) Structure-activity relationships and thermal stability of human glutathione transferase P1-1 governed by the H-site residue 105. J Mol Biol 278:687–698. Lajin B, Alachkar A, Alhaj Sakur A (2012a) A quadruplex tetra-primer ARMS-PCR method for the simultaneous detection of TP53 Arg72Pro, IVS3 16bp Del/Ins and IVS6 + 62A > G, and NQO1 C609T polymorphisms. Gene 504:268– 273. Lajin B, Alachkar A, Sakur AA (2012b) Triplex tetra-primer ARMS-PCR method for the simultaneous detection of MTHFR c.677C > T and c.1298A > C, and MTRR c.66A > G polymorphisms of the folate-homocysteine metabolic pathway. Mol Cell Probes 26:16–20. Li F, Li S, Chang H, et al. (2013) Quantitative assessment of the association between the GSTM1-null genotype and the risk of childhood asthma. Genet Test Mol Biomarkers 17:656–661. Liu K, Zhang L, Lin X, et al. (2013) Association of GST genetic polymorphisms with the susceptibility to hepatocellular carcinoma (HCC) in Chinese population evaluated by an updated systematic meta-analysis. PLoS One 8:e57043. Lu S, Wang Z, Cui D, et al. (2011) Glutathione S-transferase P1 Ile105Val polymorphism and breast cancer risk: a metaanalysis involving 34,658 subjects. Breast Cancer Res Treat 125:253–259. Moasser E, Kazemi-Nezhad SR, Saadat M, et al. (2012) Study of the association between glutathione S-transferase (GSTM1, GSTT1, GSTP1) polymorphisms with type II diabetes mellitus in southern of Iran. Mol Biol Rep 39:10187– 10192. Oliveira C, Lourenco GJ, Sagarra RA, et al. (2012) Polymorphisms of glutathione S-transferase Mu 1 (GSTM1),
278
Theta 1 (GSTT1), and Pi 1 (GSTP1) genes and epithelial ovarian cancer risk. Dis Markers 33:155–159. Palma S, Novelli F, Padua L, et al. (2010) Interaction between glutathione-S-transferase polymorphisms, smoking habit, and HPV infection in cervical cancer risk. J Cancer Res Clin Oncol 136:1101–1109. Ramprasath T, Senthil Murugan P, Prabakaran AD, et al. (2011) Potential risk modifications of GSTT1, GSTM1 and GSTP1 (glutathione-S-transferases) variants and their association to CAD in patients with type-2 diabetes. Biochem Biophys Res Commun 407:49–53. Rebbeck TR (1997) Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev 6:733–743. Romero A, Martin M, Oliva B, et al. (2012) Glutathione S-transferase P1 c.313A > G polymorphism could be useful in the prediction of doxorubicin response in breast cancer patients. Ann Oncol 23:1750–1756. Russo A, Francelin PR, Galbiatti AL, et al. (2013) Association between GSTP1, GSTM1 and GSTT1 polymorphisms involved in xenobiotic metabolism and head and neck cancer development. Mol Biol Rep 40:4181–4188. Safarinejad MR, Shafiei N, Safarinejad S (2010) The association of glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1, GSTP1) with idiopathic male infertility. J Hum Genet 55:565–570. Sohail A, Kanwal N, Ali M, et al. (2013) Effects of glutathioneS-transferase polymorphisms on the risk of breast cancer: a population-based case-control study in Pakistan. Environ Toxicol Pharmacol 35:143–153. Wang Z, Xue L, Chong T, et al. (2013) Quantitative assessment of the association between glutathione S-transferase P1 Ile105Val polymorphism and bladder cancer risk. Tumour Biol 34:1651–1657. Wu B, Dong D (2012) Human cytosolic glutathione transferases: structure, function, and drug discovery. Trends Pharmacol Sci 33:656–668.
DENG ET AL.
Yadav DS, Devi TR, Ihsan R, et al. (2010) Polymorphisms of glutathione-S-transferase genes and the risk of aerodigestive tract cancers in the Northeast Indian population. Genet Test Mol Biomarkers 14:715–723. Ye S, Dhillon S, Ke X, et al. (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 29:E88–88. Ying HQ, Qi Y, Pu XY, et al. (2013) Association of GSTM1 and GSTT1 genes with the susceptibility to male infertility: result from a meta-analysis. Genet Test Mol Biomarkers 17:535–542. Yu Y, Weng Y, Guo J, et al. (2013) Association of glutathione S transferases polymorphisms with glaucoma: a meta-analysis. PLoS One 8:e54037. Zhang J, Liu H, Yan H, et al. (2013) Null genotypes of GSTM1 and GSTT1 contribute to increased risk of diabetes mellitus: a meta-analysis. Gene 518:405–411. Zhang ZJ, Hao K, Shi R, et al. (2011) Glutathione S-transferase M1 (GSTM1) and glutathione S-transferase T1 (GSTT1) null polymorphisms, smoking, and their interaction in oral cancer: a HuGE review and meta-analysis. Am J Epidemiol 173:847–857. Zhong S, Howie AF, Ketterer B, et al. (1991) Glutathione Stransferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis 12:1533–1537. Zintzaras E (2009) Glutathione S-transferase M1 and T1 genes and susceptibility to chronic myeloid leukemia: a metaanalysis. Genet Test Mol Biomarkers 13:791–797.
Address correspondence to: Jinglin Yi, MS Department of Ophthalmology Affiliated Eye Hospital of Nanchang University 461 Bayi Street Nanchang, 330006 China E-mail: [email protected]
