Molecular Immunology 46 (2009) 1867–1877

Contents lists available at ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Short communication

STAT3 tyrosine phosphorylation is critical for interleukin 1 beta and interleukin-6 production in response to lipopolysaccharide and live bacteria Lobelia Samavati a,b,∗ , Ruchi Rastogi a,b , Wenjin Du a,b , Maik Hüttemann c , Alemu Fite a,b , Luigi Franchi d a

Department of Medicine, Division of Pulmonary, Critical Care and Sleep Medicine, Wayne State University School of Medicine, Detroit, MI 48201, USA Detroit Medical Center, Detroit, MI 48201, USA c Center for Molecular Medicine and Genetics, Wayne State University School of Medicine, 540 E. Canfield, Detroit, MI 48201, USA d University of Michigan Medical School, Department of Pathology and Comprehensive Cancer Center, Ann Arbor, MI 48109, USA b

a r t i c l e

i n f o

Article history: Received 3 January 2009 Received in revised form 10 February 2009 Accepted 14 February 2009 Available online 18 March 2009 Keywords: IL-1 beta IL-6 Cytokines Lipopolysaccharide Signal transducer and activator of transcription STAT1 STAT3 Signaling pathway STAT3 inhibitors TNF-alpha Tyrphostin JAK/STAT pathway Toll like receptor 4 Toll like receptor 2 TRIF

a b s t r a c t Both interleukin 1 beta (IL-1␤) and interleukin-6 (IL-6) are pro-inflammatory cytokines that play a major role in inflammatory diseases as well as cancer. In this work we investigated the signaling pathway involving lipopolysaccharide (LPS)-mediated IL-1␤ and IL-6 production in murine macrophage cell lines and primary macrophages. We show that in response to LPS, the JAK/STAT pathway is activated, leading to tyrosine phosphorylation at residue 705 on STAT3 and at residue 701 on STAT1, respectively. A newly developed STAT3 specific inhibitor (stattic) blocked LPS-mediated STAT3 tyrosine phosphorylation and led to inhibition of LPS-mediated IL-1␤ and IL-6 production but not TNF-␣ production. Knockdown of STAT3 expression via small interfering RNA (siRNA) decreased the level of STAT3 expression in Raw 264.7 cells and decreased STAT3 tyrosine phosphorylation in response to LPS treatment. Quantitative real time PCR and Western analysis of cells treated with inhibitor or STAT3 siRNA after LPS treatment showed a significant reduction of IL-1␤ and IL-6 mRNA and protein compared to cells treated with LPS alone. Moreover stattic abrogated IL-1␤ formation in response to extracellular bacteria Staphylococcus aureus and Escherichia coli in murine peritoneal macrophages. This inhibition did not affect caspase-1 activation. These results highlight the complex role of STAT3 in cytokine production and the key role of STAT3 tyrosine phosphorylation in IL-1␤ and IL-6 production in response to inflammation. © 2009 Elsevier Ltd. All rights reserved.

1. Introduction Interleukin 1 beta (IL-1␤) is a potent pyrogen and a key regulatory cytokine that exerts its effect at low concentrations and is lethal in higher concentrations (Dinarello, 1998). IL-1␤ plays a pivotal role in the pathogenesis of several autoinflammatory diseases (Dinarello, 2002). More recently, it has been shown in an

Abbreviations: IL-1␤, interleukin 1 beta; LPS, lipopolysacharide; IL-6, interleukin-6; JAK, Janus-activated kinase; INF␥, interferon gamma; ICE, IL-1␤ converting enzyme; TLR4, toll like receptor 4; STAT, signal transducer and activator of transcription; PTK, protein-tyrosine kinase; GM-CSF, granulocyte–macrophage colony-stimulating factor; RTK, receptor tyrosine kinase; TRIF, toll/IL-1 receptordomain-containing adapter-inducing interferon-␤. ∗ Corresponding author at: Division of Pulmonary, Allergy, Critical Care and Sleep Medicine, Wayne State University School of Medicine, 3990 John R, 3 Hudson, Detroit, MI 48021, USA. Tel.: +1 313 745 1718; fax: +1 313 933 0562. E-mail address: [email protected] (L. Samavati). 0161-5890/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2009.02.018

animal model that IL-1␤ plays a critical role in acute lung injury (Glasgow et al., 2007; Kolb et al., 2001; Severgnini et al., 2004) and that the targeted down-regulation of IL-1␤ ameliorates this injury (Glasgow et al., 2007). In addition, IL-1␤ regulates the production of IL-6, a pleiotropic inflammatory cytokine, which plays an important role in diverse pathophysiological conditions, such as during acute and chronic fibrotic lung disease (Glasgow et al., 2007). IL-1␤ is synthesized as a precursor, a 35-kDa protein (pro-IL-1␤) and its activation requires an additional post-translational processing step through caspase-1 or IL-1␤ converting enzyme (ICE) (Dinarello, 2006; Martinon et al., 2002). In response to inflammatory stimuli, including pathogenic bacteria, the IL-1␤ precursor is induced in monocytes and macrophages and processed into the biologically active IL-1␤ molecule by caspase-1 (Dinarello, 1998, 2006). The protease caspase-1 is expressed in monocytes/macrophages as an inactive zymogen that is activated by self-cleavage as part of large multiprotein complexes named “inflammasomes” (Martinon et al., 2002).

1868

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

Lipopolysaccharide (LPS)-induced activation of monocytes and macrophages involves toll-like receptor 4 (TLR4). This activation results in production of proinflammatory cytokines including TNF-␣, IL-1␤, and IL-6. The cytoplasmic part of TLRs is highly homologous to the IL-1 receptor family, currently referred to as toll/IL-1 domain (TIR). The receptor signaling events include the association of adapter protein MyD88 with TLR4/IL-1, followed by the recruitment and activation of IL-1R-associated kinase 1 (IRAK1) (Gay et al., 2006; Nunez Miguel et al., 2007). More distal to the receptor, sequential phosphorylation of upstream kinases like the mitogen-activated protein kinases (MAPKs), ERK1/2, p38, and JNK leads to activation of the transcription factors NF-␬B and AP-1, that promote gene transcription of several pro-inflammatory cytokines (Nunez Miguel et al., 2007). Another important pathway in cytokine production is the signal transducer and activator of transcription (STAT) pathway (Levy and Granot, 2006). STATs have been shown to play roles in the inflammatory signaling cascades triggered by LPS, interferon gamma (INF␥) and other cytokines (Levy and Darnell, 2002; Murray, 2007; Okugawa et al., 2003). Activated STATs dimerize and translocate to the nucleus, where they bind to specific promoter sequences and induce transcription of several target genes (Levy and Darnell, 2002). STAT1 and STAT3 have been implicated to be key transcription factors in both immunity and inflammatory pathways. JAK/STAT1 pathways appear to be central for the production of several cytokines in response to LPS alone or in combination with IFN␥ (Galdiero et al., 2006; Yeh et al., 2004). In addition, it has been shown that LPS-induced IL-1␤ production in macrophages is in part regulated through JAK2 (Okugawa et al., 2003). The STAT3 pathway is activated in response to several cytokines including IL-1␤, IL-4, and IL-10 (Okugawa et al., 2003; Yu et al., 2002, 2006). Additionally, STAT3 has a dual role in IL-6 mediated signaling; its activation may result in increased IL-6, but also IL-6 itself may lead to phosphorylation of STAT3 resulting in diverse biological responses (Fielding et al., 2008). Although it appears that NF-␬B activation plays a central role in IL-1␤ production, as it does for most other cytokines, it is not clear whether other nuclear factors including STAT1 and STAT3 are required for effective LPS-mediated IL-1␤ and IL-6 synthesis. We hypothesized that STAT1 and STAT3 proteins play a crucial role in LPS-mediated IL-1␤ and IL-6 production and that their interplay with other nuclear factors is important for cytokine production in response to LPS. This study was designed to analyze the upstream signaling events that lead to differential activation of pathways involving TNF-␣, IL-1␤, and IL-6 in response to LPS. 2. Materials and methods 2.1. Chemicals All chemicals were purchased from Sigma Chemical (St. Louis, MO) unless specified otherwise. Inhibitors (AG490 and stattic) were purchased from Calbiochem. Anti-total STAT3, STAT1, antiphosphotyrosine for STAT3 and STAT1, and ␤-actin antibodies were purchased from Cell Signaling Technology (Beverly, CA). STAT3 and STAT1 anti-phosphoserine antibodies ware purchased from Upstate Biotechnology. Anti-IL-1␤ antibody was purchased from R&D Systems (Minneapolis, MN). Anti-mouse IgG and anti-rabbit IgG horseradish peroxidase-linked (HRP) antibodies were purchased from Cell Signaling Technology (Beverly, CA), and anti-goat HRP was purchased from Bio-Rad (Hercules, CA). 2.2. Cell culture RAW 264.7 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were maintained in a 95% air, 5% CO2

humidified atmosphere at 37 ◦ C in RPMI medium supplemented with l-glutamine, penicillin–streptomycin and 10% fetal calf serum (FCS; Invitrogen). Bone marrow-derived dendritic cells (BMDC) were generated as described (Inaba et al., 1992). Briefly, female BALB/c mice were sacrificed and bone marrow was extracted from femurs and tibias by flushing the shaft with PBS. Red blood cells were lysed using red blood lysis buffer (Sigma–Aldrich), and the remaining cells were seeded on tissue culture plates at a density of 4 × 106 cells per plate in medium (RPMI 1640, 10% FCS, 5 × 10−5 M 2-ME, 2 mM glutamine and penicillin/streptomycin) for 2 h. Non-adherent cells were collected, and aliquots of 1 × 106 cells were placed in 6-well plates (Becton Dickinson) containing media supplemented with GM-CSF (75 U/ml) and IL-4 (75 U/ml). The medium was replaced every 3 days, and the loosely adherent cells were collected after 8–10 days. Cells were used as source of DC in subsequent experiments. The BMDC were characterized for their surface marker expression profile by FACS. BMDC were treated with LPS (500 ng/ml) for 6 h in the presence or absence of inhibitor. Generation of peritoneal macrophages was performed using 8–10 week old male BALB/C mice. The peritoneal cavity was injected with 2 ml of 4% thioglycollate solution, 4–5 days later, macrophages were collected by peritoneal lavage and plated in IMDM supplemented with 10% FCS, 2 mM l-glutamine, 100 U/ml penicillin G, and 100 ␮g/ml streptomycin. The macrophages were allowed to adhere overnight (37 ◦ C, 5% CO2 ) and washed with fresh medium to remove unattached cells before use. 2.3. Bacterial infection The E. coli strain was DH5␣ (Invitrogen) and the S. aureus strain was SA113 (ATCC). Single colonies were inoculated into 5 ml of Luria Bertani medium and grown overnight at 30 ◦ C with shaking. On the day of the infection, a 1/5 dilution of the overnight culture was prepared and allowed to grow at 37 ◦ C with shaking to A600 = 0.5, corresponding to ∼109 CFU/ml. 60 min after infection at 37 ◦ C, macrophages were washed twice with PBS and IMDM supplemented with 10% heat inactivated serum and 100 ␮g/ml of gentamicin to limit the growth of extracellular bacteria. Extracts were prepared from cells and culture supernatants 4 h after infection. The animal studies were conducted under protocols approved by the Wayne State University and University of Michigan Committees on Use and Care of Animals. 2.4. Enzyme-linked immunosorbent assay (ELISA) Murine TNF-␣, IL-1␤, and IL-6 cytokines were measured in cell culture supernatants according to the manufacturer’s instructions (ELISA DuoKits, R&D Systems). 2.5. Protein extraction and immunoblotting Cells were harvested after the appropriate treatment and washed with PBS. Total cellular proteins were extracted by adding RIPA buffer after addition of a protease inhibitor cocktail, antiphosphatases I and II (Sigma–Aldrich). Protein concentration of samples was measured with the BCA assay (Bio-Rad). Equal amounts of proteins (10–50 ␮g) were mixed 1/1 with sample buffer (20% glycerol, 4% SDS, 10% 2-ME, 0.05% bromophenol blue, and 1.25 M Tris–HCl, pH 6.8), fractionated on a 10% SDS-polyacrylamide gel, and run at 40 mA for 3 h. Proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Hercules, CA) for 30 min at 20 V on a SemiDry Transfer Cell (Bio-Rad, Hercules, CA). The PVDF membrane was then blocked with 5% dry milk in TBST (Tris-buffered saline with 0.1% Tween 20) for 1 h, washed, and incubated with primary Abs (diluted between 1/500 and 1/1000 in 5% dry milk in

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

TBST) overnight at 4 ◦ C. The blots were washed four times with TBST and then incubated for 1 h with the HRP-conjugated secondary anti-IgG Ab using a dilution between 1/5000 and 1/10,000 in 5% dry milk in TBST. Membranes were washed four times in TBST. Immunoreactive bands were visualized using a chemiluminescent substrate (ECL-Plus, GE healthcare) for 5 min. Images were captured on Hyblot CL film (Denville, Scientific Inc.). Optical density analysis of signals was performed using ImageQuant software from Molecular Dynamics (version 5). Equal loading of the blots was shown either by total STATs or ␤-actin. 2.6. Transfection RAW 264.7 cells were seeded with a density of 5 × 104 per well in 6-well plates. After reaching 50% confluency, cells were transfected with either 50 nM of STAT3 siRNA (STAT3 siRNA SMART pool: L-040794-00-0005, Thermo Scientific) or with a non-targeting siRNA pool (D-001810-10-05, Thermo Scientific) using Lipofectamine 2000 (Invitrogen) (Qin et al., 2007). After 48 h, transfected cells were treated with LPS (500 ng/ml) for 6 h. Supernatants were collected for cytokine analysis via ELISA. Cell pellets were used for protein analysis or for RNA extraction.

1869

(ANOVA) test and post hoc repeated measure comparisons (least significant difference (LSD)) were performed. ELISA, MTT, and qRT-PCR results were expressed as mean ± S.E.M. For all analyses, two-tailed p-values of less than 0.05 were considered significant. 3. Results 3.1. LPS stimulation induces TNF-˛, IL-1ˇ, and IL-6 production in RAW 246.7 cells Several reports suggested that different serotypes of LPS may differentially affect cytokine profiles and lead to distinct physiologic responses (Akarsu and Mamuk, 2007). After using different LPS serotypes, we observed a robust and consistent cytokine response to E. coli 055:B5 serotype (500 ng/ml). Fig. 1 demonstrates the kinetics of TNF-␣ (Fig. 1A), IL-1␤ (Fig. 1B), and IL-6 (Fig. 1C) expression in response to LPS treatment in murine macrophage RAW 264.7 cells. RAW 264.7 cells were cultured in the absence or presence

2.7. RNA extraction and quantitative reverse transcriptase/real time-PCR (qRT-PCR) Total RNA was extracted using Stat 60 (Iso-Tex Diagnostics) and reverse transcribed using the Reverse Transcription System (Promega). The primers (target of STAT3, STAT1, IL-1␤, IL-6, and a reference gene, ␤-Actin) were used to amplify the corresponding cDNAs. Using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) quantitative analysis of mRNA expression was performed with a MX3000p instrument (Stratagene, CA). PCR amplification was performed in a total volume of 20 ␮l containing 2 ␮l of each cDNA and 20 pg primers (Invitrogen). The PCR amplification protocol consisted of one initial denaturation step for 10 min at 95 ◦ C, followed by 45 cycles: denaturation (95 ◦ C for 10 s), annealing for 20 s at 60 ◦ C, and extension at 72 ◦ C for 20 s. Relative mRNA levels were calculated after normalizing to ␤-actin. Data were analyzed using the unpaired, two-tailed Student’s t-test and the results were expressed as relative fold change. Primer sequences were: ␤-actin Forward GATTACTGCTCTGGCTCCTAGC and Reverse GACTCATCGTACTCCTGCTTGC; IL-1␤ Forward CGCAGCAGCACATCAACAAGAGC and Reverse TGTCCTCATCCTGGAAGGTCCACG; IL-6 Forward CACAAGTCCGGAGAGGAGAC and Reverse, CAGAATTGCCATTGCACAAC; STAT3 Forward GAAACAACCAGTCTGTGACCAG and Reverse CACGTACTCCATTGCTGACAAG; STAT1 Forward CAGGAATCTCTCCTTCTTCCTG and Reverse TTCAGACCTCTCTTGGTGACTG; TNF Forward GTGAAGGGAATGGGTGTTC and Reverse CAGGTCACTGTCCCAGCATC. 2.8. Cell viability Cell viability was measured using the MTT (3(4,5) dimethyl thiazol-2,5-diphenyl tetrazolium bromide) assay as described (Mizel, 1982). Cells equivalent to 1 × 105 ml−1 were seeded in 96well cell culture plates and incubated for 24 h before treatment as indicated in Section 3. Absorbance was measured at 550 nm. Relative cell viability was calculated according to the formula: cell viability = absorbance experimental/absorbance control × 100. 2.9. Statistical analysis Statistical analyses were performed using SPSS software, version 15.0 (SPSS Inc.; Chicago, IL, USA). One-way analysis of variance

Fig. 1. Kinetic responses of cytokines in RAW 264.7 cells after LPS treatment. Raw 264.7 cells were treated with LPS (500 ng/mL) for the indicated time periods. Media were collected and centrifuged, and supernatants were analyzed for TNF-␣ (A), IL1␤ (B), and IL-6 (C) via enzyme-linked immunosorbent assays (ELISA). Data are presented as means of eight independent experiments and error bars indicate the standard error of the mean. LPS treated cells showed a significantly altered cytokine profile at 3 h in comparison to controls (p < 0.01).

1870

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

of LPS (500 ng/ml) and analyzed at various time points as indicated. Cytokine levels were then determined by ELISA. LPS induced a robust increase of IL-1␤ secretion starting 3 h after LPS exposure (Fig. 1B) (p < 0.01), whereas IL-6 was detected at later time points (after 6 h; Fig. 1C). Both cytokines peaked at 24 h. RAW 264.7 cells also responded to LPS treatment with a robust increase of TNF-␣. Similar results were obtained using primary murine bone marrow derived dendritic cells (data not shown). 3.2. Pretreatments of raw 264.7 cells with AG490 and stattic modify LPS-mediated IL-1ˇ, IL-6, but not TNF-˛ production Previously, it has been shown that JAK2 inhibitor AG490 suppresses IL-1␤ expression in pancreatic cells after stimulation with cerulein (Yu et al., 2006). Other studies suggested that STAT3 and STAT1 play a role in IL-1␤ and IL-6 production in response to diverse stimuli (Lee et al., 2006; Sodhi and Kesherwani, 2007). AG490 (Tyrphostin) is a JAK2 inhibitor and has been shown to inhibit predominantly the JAK2–STAT1 pathway (Gorina et al., 2005). A newly identified STAT3 inhibitor, stattic, predominantly inhibits tyrosine phosphorylation on STAT3. This selective inhibition is due to interference with the SH2 binding domain of STAT3 and the prevention of interaction with docking sites as was shown in vitro (Schust et al., 2006). Thus, stattic selectively inhibits tyrosine phosphorylation of STAT3, and the subsequent dimerization and nuclear translocation of this protein (McMurray, 2006; Schust et al., 2006). To further investigate the role of STAT3 and STAT1 in LPS-mediated IL-1␤ and IL-6 production, cells were pre-incubated either in the presence (+) or absence (−) of AG490 or stattic 45 min prior to LPS stimulation and the cytokine responses were measured by ELISA at 24 hrs. AG490 inhibited LPS-mediated IL-1␤ and IL-6 production only partially (Fig. 2A and B). In contrast, stattic completely abrogated both LPS mediated IL-1␤ (Fig. 2A) and IL-6 (Fig. 2B) production. But none

of the inhibitors decreased the LPS mediated TNF-␣ production in Raw 264.7 cells (Fig. 2C). To further explore whether these effects are regulated through transcriptional activity of cytokine genes or other post-translational modifications, we evaluated mRNA levels of IL-1␤, IL-6, TNF-␣, STAT1, and STAT3 mRNA using quantitative real time PCR (qRTPCR). Fig. 2D shows mRNA expression data 4 h after LPS treatment in Raw264.7 cells in the presence (+) and absence (−) of stattic. LPS strongly induced transcription of IL-1␤, IL-6, and TNF-␣, and both IL-1␤ and IL-6 mRNAs were significantly decreased in the presence of stattic (p < 0.01). However, TNF-␣ mRNA did not decrease in the presence of stattic. Stattic significantly decreased the level of STAT3 expression, whereas AG490 partially decreased the expression of both STAT1 and STAT3 (data not shown). These data together with the previous experiments suggest that STAT3 plays an essential role in the signaling pathway for the production of these two important cytokines, and that its regulation is a necessary step for LPS-mediated up-regulation of IL-1␤ and IL-6. These data also suggest that LPS increases IL-1␤ and IL-6 production through the JAK/STAT pathway and that IL-1␤ and IL-6 are co-regulated. Interestingly, the STAT3 inhibitor did not significantly change LPSmediated TNF-␣ production. These results suggest that STAT3 is not a requirement for LPS-mediated TNF-␣ production. Our findings corroborate findings of others that STAT3 activation is a poor regulator of TNF-␣ expression (Prele et al., 2007). Since it has been shown that STAT3 upregulation or activation plays a key role in proliferation in different human tumors (Lewis et al., 2008; Yan et al., 2008), and because STAT3 inhibitors prevent this growth (Levy and Darnell, 2002; McMurray, 2006), we investigated cell survival in the presence and absence of stattic and AG490 after LPS treatment up to 48 h using the MTT assay. LPS treatment led to proliferation of Raw 264.7 cells after 24 h and 48 h (121% and 110% of not treated cells, respectively), while AG490 only had a minimal

Fig. 2. AG490 and stattic inhibits LPS-mediated IL-1␤ and IL-6 but not TNF-␣ production in Raw 264.7 cells. RAW 264.7 cells were pretreated for 45 min with (+) or without (−) AG490 (10 ␮M) or stattic (10 ␮M). After pre-incubation, cells were treated with (+) or without (−) LPS (500 ng/mL) for 24 h. TNF␣, IL-1␤, and IL-6 immunoreactivity in supernatants was analyzed by ELISA. Data presented are mean values of 6 independent experiments; bars represent means ± S.E.M. Significance was determined using ANOVA (p < 0.05 was considered significant). (A) Inhibition of LPS-induced IL-1␤ expression in the presence of stattic or AG490 in Raw 246.7 cells. (B) Stattic or AG490 inhibits LPS-induced IL-6 production in RAW 246.7 cells. (C) Stattic or AG490 has no effect on LPS mediated TNF-␣ production. Pre-incubation of RAW 246.7 cells with AG490 or stattic did not abrogate LPS-mediated TNF-␣ production (p = 0.6). (D) Stattic blocks IL-1␤ and IL-6 gene expression in Raw 264.7 cells in response to LPS. Raw 264.7 cells were treated with/without LPS (500 ng/ml) in the presence or absence of stattic for 24 h. RNA was isolated from the cells and subjected to real time RT-PCR. Data are presented as the means ± S.E.M. of four independent experiments (p < 0.05).

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

1871

effect on cell survival in the presence or absence of LPS. In contrast, although stattic alone did not change the survival of macrophages, simultaneous treatment with stattic and LPS led to decreased cell survival to 85% and 75% of control after 24 h and 48 h, respectively. 3.3. LPS induces serine and tyrosine phosphorylation of STAT1 and STAT3 in murine macrophage RAW 246.7 cells LPS and several cytokines, such as type I interferon, IL-10, and IL-6, activate the JAK-STAT pathway, leading to tyrosine and serine phosphorylation of either STATs. These processes are crucial for production of several cytokines in different cell types (Cho et al., 2006; Galdiero et al., 2006). Serine phosphorylation of both STATs has been postulated as a requirement for maximal activation of these pathways (Horvath, 2004; Levy and Darnell, 2002), and in vitro studies suggested that serine/threonine phosphorylation of STAT1 and STAT3 is through MAPKs (Galdiero et al., 2006). Therefore, we investigated the kinetic responses of tyrosine and serine phosphorylation of both STATs after LPS challenge. Raw 264.7 cells were treated with LPS (500 ng/ml) and the response analyzed at different time points. Total cell lysates were then subjected to immunoblotting using specific anti-STAT3 and antiSTAT1 phosphotyrosine and phosphoserine antibodies. As shown in Fig. 3, LPS induced tyrosine phosphorylation started at 2 h postLPS challenge on both STATs. This process was time-dependent and the highest phosphorylation levels were reached at 6 h. STAT3 but not STAT1 tyrosine phosphorylation remained weakly positive up to 24 h (data not shown). In contrast, LPS-induced STAT1 and STAT3 serine phosphorylation occurred much earlier (5 min, data not shown). Total (non-phosphorylated) STAT1 and STAT3 levels remained unchanged (Fig. 3). 3.4. AG490 and stattic abrogate LPS-mediated tyrosine phosphorylation of STAT1 at tyrosine 701 and STAT3 at tyrosine 705 Next we investigated the effect of both inhibitors on serine and tyrosine phosphorylation of both STATS in response to LPS. Raw 264.7 cells were pre-incubated either with 10 ␮M AG490 or 10 ␮M stattic for 45 min prior to LPS stimulation for different time periods.

Fig. 4. Pretreatment of RAW 264.7 cells with AG490 or stattic blocks LPS-mediated tyrosine phosphorylation on STAT1 and STAT3. RAW 264.7 cells were treated with AG490 or stattic for 45 min before the addition of LPS (500 ng/ml). Four hours after LPS stimulation, total cell lysates were prepared and 30 ␮g of total cellular protein were subjected to Western blot analysis using phosphoepitope-specific STAT3 (pTyr705 and pSer727), STAT1 (pTyr701 and p Ser 727) antibodies. Stattic completely blocked tyrosine 705 phosphorylation on STAT3 (top panel), whereas pretreatment with stattic increased phosphorylation on Ser727 of STAT3. AG490 only minimally decreased tyrosine phosphorylation of both STATs. Equal loading of protein was confirmed using total STAT3 or STAT1 antibodies. The results shown are representative of three independent experiments.

After completion of the experiments, cell lysates were subjected to protein electrophoresis and immunoblotting. Fig. 4 shows that incubation with AG490 prior to LPS stimulation primarily prevents tyrosine 701 phosphorylation of STAT1 but has no effect on serine phosphorylation of either STAT. AG490 partially inhibited STAT3 tyrosine phosphorylation. In contrast, stattic completely abrogated LPS-mediated tyrosine phosphorylation on tyrosine 705 of STAT3 (Fig. 4; upper panel). We followed up the inhibitory effects of stattic and AG490 of both tyrosine and serine phosphorylations up to 24 h. Interestingly, only the inhibitory effect of stattic persisted even until the longest time period investigated (24 h; data not shown). These findings are suggestive of an irreversible inhibitory effect of stattic. Furthermore, presence of both AG490 and stattic did not have a significant effect on serine phosphorylation on either STATs after LPS treatment. These results suggest a specific inhibitory effect of these compounds on tyrosine phosphorylation. 3.5. Stattic blocks LPS-mediated induction of IL-1ˇ precursor expression in RAW 246.7 cells and in murine bone marrow-derived dendritic cells

Fig. 3. Phosphorylation of STAT1 and STAT3 in response to LPS. RAW 264.7 cells were treated with LPS (500 ng/ml) for different time points as indicated. Whole cell lysates were subjected to SDS-PAGE followed by Western blot analysis using phosphoepitope-specific antibodies against STAT3 (pTyr705), STAT1 (pTyr701), and STAT3 (pSer 727). As controls total STAT1 and STAT3 were also detected. LPS induces tyrosine and serine phosphorylation on both STATs tyrosine and serine phosphorylation in RAW 264.7 cells in a time-dependent manner. Serine phosphorylation on both STATs occurred early and was detectable 5 min after treatment with LPS whereas tyrosine phosphorylation of STAT3 occurred after 2 h. Data presented are representative results of four independent experiments.

In addition to analyzing secreted IL-1␤ in the supernatants via ELISA (Fig. 2), we investigated the effect of stattic on LPS-mediated pro-IL-1␤ expression. Western blot analysis was performed with an IL-1␤ antibody which detects both forms, the 35-kDa IL-1␤ precursor and the 17-kDa mature form. Fig. 5 demonstrates that pretreatment of RAW 246.7 cells with stattic abrogates the formation of IL-1␤ precursor in response to LPS. Fig. 5A indicates a direct correlation between STAT3 tyrosine phosphorylation and the formation of pro-IL-1␤ at different time points after LPS treatment.

1872

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

Fig. 5. (A) LPS stimulation leads to a time-dependent activation of STAT3 and pro-IL-1␤ expression in RAW 264.7 cells. RAW 264.7 cells were treated with LPS for the indicated time periods. After incubation, whole cell extracts were prepared and 20 ␮g of total protein was subjected to SDS-PAGE and Western blot analysis. The blots were analyzed for activated STAT3 pTyr705 using phosphoepitope-specific STAT3 and IL-1␤ antibodies. ␤-actin was used as a control. The figure is a representative of four independent experiments. (B) Stattic and AG490 inhibit pro-IL-1␤ induction in response to LPS. Raw 264.7 cells were pretreated with AG490 and stattic for 45 min prior to adding LPS (500 ng/ml) to the media. At different time points, 20 ␮g of total cell lysates were separated on SDS-PAGE followed by Western blot analysis using an IL-1␤ antibody. ␤-actin was used as control. Top panel, densitometry performed on immunoreactive bands and expressed as fold increase (experimental value/control value) in arbitrary luminescence units of four independent experiments. (C) Stattic inhibits LPS-mediated pro-IL-1␤ formation in a dose-dependent manner. RAW 264.7 cells were pre-incubated with different concentrations of stattic (0.01, 0.1, 1 and 10 ␮M) prior to stimulation with LPS (500 ng/ml). After 4 h whole cell lysates were prepared and 20 ␮g total protein was separated by SDS-PAGE followed by Western blot analysis using an IL-1␤ antibody. ␤-actin was determined as a loading control. Top, densitometric analysis from three independent samples. A dose-effect relationship between stattic concentration and inhibition of LPS-mediated IL-1␤ synthesis is apparent. (D) Stattic inhibits LPS-mediated IL-1␤ in BMDCs. Cells were used 8–10 days after differentiation as described in Section 2. BMDCs were pre-incubated in presence (+) or absence (−) of stattic or AG490 for 45 min prior to LPS (500 ng/ml) stimulation, or kept in media for 6 h. Cells were supplemented with (+) or without (−) 5 mM ATP for 30 min. Supernatants were collected and analyzed by ELISA for production of IL-1␤ (top panel). Total cell lysates were prepared from pellets and supernatant and subjected to SDS-PAGE and followed by Western blot analysis using an IL-1␤ antibody to detect both pro-IL-1␤ and the active form of IL-1␤ (p17). ␤-actin was used as a loading control. Data shown are representative of three independent experiments.

Fig. 5B shows the effect of both inhibitors on pro-IL-1␤ formation at 3 h and 6 h after LPS (500 ng/ml) treatment. The top panel summarizes the densitometric analysis of 4 different experiments. These data clearly demonstrate that stattic inhibits the formation of IL-

1␤ in response to LPS. Since this is the first study that assesses the inhibitory effect of stattic on LPS mediated IL-1␤ production, we determined the minimal inhibitory concentration of stattic on IL1␤ production. Fig. 5C demonstrates a dose-dependent inhibitory

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

effect of stattic on LPS-mediated pro-IL-1␤ expression. Pro-IL-1␤ synthesis is significantly inhibited at 0.01 ␮M stattic (p = 0.02). In addition, we investigated the effect of another STAT3 inhibitor (inhibitor VI, S31-201, Calbiochem) on LPS triggered IL-1␤ synthesis, and observed that this inhibitor was less efficacious both in inhibiting LPS mediated IL-1␤ production and in abrogating STAT3 phosphorylation (data not shown). Some studies suggested that full activation of the inflammasome and release of active IL-1␤ (17 kDa protein) requires ATP. ATP activates procaspase-1, whose activation leads to cleavage of pro-IL-1␤ and release of biologically active IL-1␤ (Franchi et al., 2007). The above data may result from decreased maturation of pro-IL-1␤, release of mature IL-1␤, or secondary suppression of the precursor of IL-1␤ formed in response to LPS. To extend these observations to a different cell system, we used bone marrow derived dendritic cells (BMDC). The loosely adherent cells collected after 8–10 days in culture were used for experiments. Cells were kept in media (−) or pretreated with AG490 (+) or stattic (+) for 45 min. After the preincubation period cells were treated with LPS (500 ng/ml) for 6 h (+). Thirty minutes prior to completion of the experiments cells were supplemented with 5 ␮M ATP. Cells supernatants were subjected to ELISA to assess IL-1␤ and IL-6 levels. As shown in Fig. 5D, BMDC responded to LPS stimulation with an increased IL-1␤ production; in addition, ATP supplementation led to a pronounced elevation of

1873

IL-1␤ (5-fold increase) in the supernatants as measured by ELISA. Stattic abrogated this effect, whereas AG490 inhibition led to an approximately 40% decrease in IL-1␤. Furthermore, we confirmed these findings by Western blot analysis. Total cell lysates were subjected to immunoblotting to assess both forms of IL-1␤, pro IL-1␤ (35 kDa) and the active form of IL-1␤ (17 kDa). Fig. 5E demonstrates that pro IL-1␤ is formed in response to LPS and that addition of ATP led to release of the active form of IL-1␤ with an increase of the 17-kDa band. Presence of stattic led to complete blockade of IL-1␤ production in response to LPS stimulation in the presence or absence of ATP. These observations confirm first that this effect is not cell type specific, and second that the inhibitory effect of stattic is not mediated through caspase-1 inhibition. Similarly, as observed in RAW 264.7 cells, IL-6 decreased in the presence of stattic but pre-incubation with AG490 resulted in minimal decreased IL-6 production (data not shown). 3.6. Targeted downregulation of STAT3 in RAW 264.7 cells leads to decreased LPS-mediated STAT3 tyrosine phosphorylation and decreased IL-1ˇ synthesis Since studies with any kinase inhibitor may raise the question of selectivity toward a given kinase, we took advantage of targeted downregulation of STAT3 via small interference RNA vectors.

Fig. 6. STAT3 knockdown via siRNA decreased STAT3 transcript and protein levels. RAW 264.7 cells were transfected with STAT3 or nonspecific siRNA as described in Section 2. 48 h post-transfection, cells were incubated with/without LPS (500 ng/ml) for 6 h. Supernatants were collected for cytokine analyses via ELISA and cell pellets were used for protein analysis, and RNA extraction followed by quantitative real time PCR. (A) 48 h post-transfection cells were treated as above and analyzed for gene expression by RT-PCR. Targeted down regulation of STAT3 resulted in a significant decrease of STAT3 but not STAT1 gene expression in RAW 264.7 cells (p < 0.05). Data are presented as relative gene expression levels from two independent transfections each performed in triplicates. Bars represent mean ± S.E.M. (B) 48 h post-transfection targeted downregulation of STAT3 resulted in a significant decrease of IL-1␤ and IL-6 gene expression in RAW 264.7 cells in response to LPS stimulation as compared to non-targeted transfected cells (p < 0.05). (C) Targeted down-regulation of STAT3 via siRNA leads to decreased secretion of IL-1␤ and IL-6 in response to LPS challenge in media supernatants. IL-1␤ and IL-6 were analyzed by ELISA. Data are representative results of two independent experiments each performed in triplicates. Bars are means ± S.E.M. Statistical significance between groups was determined using Student’s t-test (p < 0.05). (D) Total cellular protein (30 ␮g) of siRNA transfected cells were subjected to Western blot analysis with phosphoepitope-specific STAT3 and STAT1, total STAT3, and total STAT1, and IL-1␤ antibodies. Targeted down-regulation of STAT3 decreased IL-1␤ synthesis in response to LPS stimulation.

1874

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

Cells were transiently transfected with either nonsense vector (non-targeted siRNA) or vector encoding STAT3 siRNA. We found that after 48 h, transfection with STAT3 siRNA leads to significantly decreased STAT3 mRNA and STAT3 protein. Targeted downregulation of STAT3 as compared to non-targeted transfection resulted in a downregulation of STAT3 mRNA but not STAT1 mRNA as measured by quantitative real time PCR (Fig. 6A). In addition, after LPS stimulation, these cells show a 50% decreased expression of IL-1␤ and IL-6 mRNA in comparison to non-targeted siRNA transfected cells (Fig. 6B). To confirm these results at the protein level, 48 h after transfection, cells were treated with LPS for 6 h as described above. Supernatants were used to detect IL-1␤ and IL-6 via ELISA. Fig. 6C demonstrates that targeted downregulation of STAT3 resulted in decreased IL-1␤ and IL-6 (p < 0.05 for both) in the supernatants in response to LPS stimulation. In contrast TNF-␣ production did not significantly change (supplementary Fig. 1). Total cell lysates were then subjected to Western blot analysis using specific anti-STAT3, STAT1 phosphotyrosine, total STAT3, total STAT1, and IL-1␤ antibodies. As shown in Fig. 6D, LPS treatment led to less tyrosine phosphorylation in targeted transfected cells in comparison to non-targeted transfected cells (Fig. 6D). These results collectively confirm that STAT3 plays an essential role in LPS-mediated IL-1␤ production and that phosphorylation of STAT3 plays a key role in the regulation of IL-6 production. 3.7. Stattic inhibits bacterial-induced pro-IL-1ˇ production, but has no effect on caspase-1 activation Next we investigated whether production and maturation of pro-IL-1␤ in peritoneal macrophages in response to live bacteria was similarly inhibited in the presence of stattic. It has been shown that the extracellular bacterial infection with E. coli and S. aureus strongly induces the pro-IL-1␤ expression in macrophages and that the release of mature IL-␤ in response to both bacteria requires caspase-1 activation (Franchi et al., 2007). Fig. 7A shows that infection with E. coli or S. aureus induces a strong upregulation of pro-IL-1␤ in peritoneal macrophages. In contrast, pretreatment with stattic prevented the production of pro-IL-1␤ in response to

Fig. 7. The inhibitory effect of stattic is not mediated through inhibition of procaspase 1. Peritoneal macrophages were cultured in media (control) or in the presence (+) of stattic for 45 min. After the pre-incubation period cells were infected with E. coli or S. aureus at a macrophage/bacteria ratio of 1/10 for 4 h. ATP was added and cells were incubated for 30 min. Total cell extracts were prepared and combined with the precipitated culture supernatants and subjected to immunoblotting using IL-1␤ (A) or caspase-1 (B) antibodies. Arrows denote pro-IL-1␤ and mature IL-1␤ (p17) (A), and procaspase-1 and its processed subunit p20 (B).

both bacteria. Consistent with previous results, the infection of macrophages with E. coli and S. aureus did not induce the maturation of pro-IL-1␤. However, in macrophages infected with E. coli and S. aureus the maturation of pro-IL-1␤ into IL-1␤ was rapidly induced by stimulation of the purinergic receptor P2X7 with ATP, a fact that correlates with the activation of caspase-1 (Franchi et al., 2007). Importantly, pretreatment with stattic did not affect the activation of caspase-1 thus confirming the specificity of its action.

4. Discussion IL-1␤ and IL-6 are involved in the pathogenesis of diverse inflammatory disorders. IL-1␤ synthesis and its secretion are tightly regulated (Dinarello, 1998). In the present study we report that LPS-mediated IL-1␤ and IL-6 production is associated with tyrosine phosphorylation of STAT1 and STAT3 in a murine macrophage cell line as well as in primary murine bone marrow derived dendritic cells and peritoneal macrophages. We show that LPS-mediated upregulation of IL-1␤ precursor is dependent on phosphorylation of STAT3 on tyrosine 705. A newly identified STAT3 inhibitor, stattic, which binds to the SH2 domain of STAT3 and prevents tyrosine 705 phosphorylation, inhibited LPS-mediated IL-1␤ production but not the production of TNF-␣. We also observed a reduction in the production of IL-6 that may be due to the lack of IL-1␤, since IL-1␤ is a strong inducer of IL-6. In contrast, AG490, an inhibitor of JAK2, predominantly prevented tyrosine phosphorylation at tyrosine residue 701 of STAT1 but only partially inhibited tyrosine phosphorylation of STAT3. AG490 was less effective in decreasing LPS-mediated IL6 and pro-IL-1␤ synthesis, and we found only a partial inhibition of tyrosine phosphorylation of STAT3. Targeted down-regulation of STAT3 via small interference RNA vectors, also resulted in decreased IL-␤ and IL-6 production in response to LPS. Taken together these data clearly demonstrate that STAT3 tyrosine phosphorylation on residue 705 is crucial for LPS-mediated IL-1␤ and IL-6 production. STATs are recruited via their SH2 domains and phosphorylated on a tyrosine residue next to the SH2 domain by receptor associated kinases (JAKs), intrinsic kinase activity, or Src kinase (Levy and Darnell, 2002). After tyrosine phosphorylation, STATs form hetero- and/or homodimers. 6-nitro-benzothiphene-1,1-dioxide 1 was dubbed stattic (for STAT three inhibitory compound), because of its ability to preferentially inhibit tyrosine phosphorylation of STAT3, in addition to preventing the hetero- and homodimerization, nuclear translocation, and DNA binding of this STAT compared to STAT1 or other SH2 domain containing tyrosine kinases (McMurray, 2006; Schust et al., 2006). It is noteworthy to point out that this compound is predominantly a STAT3 tyrosine phosphorylation inhibitor rather than a STAT3 pathway inhibitor. As we show in our results, stattic prevents tyrosine phosphorylation in response to LPS on STAT3, despite the presence of abundant total STAT3 and its ability to undergo serine phosphorylation. STAT3 is upregulated in most human tumors, and its downregulation leads to apoptosis. STAT3 is a multifunctional protein which has been implicated to play a role both in anti-inflammation through SOCs-IL-10-signaling in different tissues (Jacoby et al., 2003; Zhang et al., 2006) and inflammation (Simeone-Penney et al., 2007, 2008). Most interestingly, it has been shown that STAT3 is required in chemotactic activity in response to CXCR2 (Panopoulos et al., 2006). The elucidation of the exact role of STAT3 in biological processes has been difficult because the knockout (KO) of STAT3 leads to early embryonic lethality (Takeda et al., 1997). Additionally, the interpretation of results of cell and tissue specific KO is not less complex. For example, despite the well accepted role of STAT3 in IL6 and IL-10 activation and production, septic mice lacking STAT3 in

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

macrophages and neutrophils surprisingly showed increased production of several inflammatory cytokines, including TNF-␣, IL-6, and IL-1␤ but also anti-inflammatory cytokine IL-10 (Matsukawa et al., 2005). These results appear at first sight contradictory to data presented here and to other studies indicating a pro-inflammatory role for STAT3 (Nowell et al., 2009; Yang et al., 2007). However, given the multiple interactions of STAT3 with other nuclear factors including NF-␬B (Yang et al., 2007; Yu et al., 2002), the STAT3 KO may trigger compensatory cellular mechanisms including upregulation of proinflammatory cytokines and IL-10. Furthermore, it appears that pro- and anti-inflammatory roles of STAT3 are mostly cell- and stimulation-specific, and post-translational modifications, such as phosphorylation play a major role in this process. To our knowledge, however, no previous study has addressed the role of STAT3 tyrosine phosphorylation and a possible inhibitory effect of stattic on the production of IL-1␤ induced by LPS or live bacteria. Most interestingly, stattic abgrogated the IL-1␤ production in response to both E. coli and S. aureus. E. coli, a gram negative bacteria activates mostly TLR4 (but also TLR2 via lipoproteins produced by the bacterium) via the Trif/IFN␤ pathway (Yamamoto et al., 2003), while S. aureus, a gram positive bacteria is recognized by TLR2 whose signaling pathway is independent of Trif/IFN␤ (Mullaly and Kubes, 2006). This suggests that stattic inhibits signaling events downstream of both TLR2 and TLR4. Numerous auto-inflammatory disorders, such as rheumatoid arthritis (de Vries-Bouwstra et al., 2007), gout (Martinon et al., 2006), and type 1 diabetes (Larsen et al., 2007), as well as many other chronic diseases, are associated with an excessive production and an increased bioavailability of IL-1␤. These diseases are characterized by fever, anemia, and elevated acute phase protein. Some of these conditions respond favorably to anakinra, a recombinant human interleukin-1-receptor antagonist which specifically blocks IL-1R (Church et al., 2008; Larsen et al., 2007). However, IL1␤ is an extremely potent cytokine and therefore must be blocked continuously. Anakinra is a short acting drug, requires daily application, and is very expensive (Burger et al., 1995, 2006; Dayer et al., 2001). In this study we identified the inhibitory action on STAT3 of a new drug, which might be useful for future therapy of such conditions. Stattic appears to be a potent inhibitor of both IL-1␤ and IL-6 expression. We also used another STAT3 inhibitor (inhibitor VI, S31-201), and were able to confirm similar inhibitory effects on LPS-mediated IL-1␤ synthesis, but this drug was less potent. Hence, our findings open a new avenue for targeted therapy of IL-1␤- and IL-6-associated inflammatory diseases. Once the safety of stattic is confirmed, targeting STAT3 tyrosine phosphorylation might result in a novel therapy for diseases associated with increased production of IL-1␤. It is widely believed that monocytes and macrophages from healthy subjects or mice do not express IL-1␤, but upon exposure to bacterial pathogens or their cell wall constituents, IL-1␤ precursor is rapidly synthesized. After exposure to endotoxin, signaling is presumably initiated through the recruitment of MyD88 to TLRs via TIR–TIR interactions (Gay et al., 2006; Nunez Miguel et al., 2007). Formation of a TIR–TIR platform recruits MyD88, in turn leading to the recruitment of IL-1 receptor (IL-1R)-associated kinase (IRAK) IRAK-4 and subsequently phosphorylation of IRAK-1 (O’Neill, 2006). Furthermore, a series of ubiquitinylation reactions take place leading to NF-␬B activation (O’Neill, 2006). Numerous studies investigated the critical role of NF-␬B in LPS-mediated cytokine production (Lee, 2007 #42; Yamamoto, 2003 #43). However, the interplay with other cytokine pathways is not well established. There is evidence suggesting an interaction between TLR4/TIR, protein-tyrosine kinases (PTKs) and the JAK/STAT pathway. It has been demonstrated that systemic lipopolysaccharide and IL-1␤ challenge leads to an activation of IL-6 through STAT1 and STAT3 (Kobierski et al., 2000). Interestingly, others have shown that

1875

mice lacking Tyk2, which is a member of the JAK kinase family were resistant to LPS-induced endotoxic shock (Kamezaki et al., 2004). In addition, these investigators found that Tyk2-deficient mice have the ability to respond to LPS with activation of MAPK and NF-␬B, but the production of TNF-␣ and IL-12 was not affected (Kamezaki et al., 2004). Moreover, IRAK1 was initially thought to be responsible for NF-␬B activation, yet IRAK1 knockout mice still exhibit NF-␬B activation upon LPS challenge. For example, it has been shown that IRAK1 deficient mice fail to exhibit LPS-induced STAT3 activation and subsequent interleukin-10 (IL-10) gene expression (Huang et al., 2004). Tyrosine phosphorylation is an important event that occurs in response to LPS, yet the elucidation of the role of individual protein tyrosine kinases for cytokine production has been difficult due to the complex nature of the underlying processes, including the presence of multiple phosphorylation sites in addition to cross-talk between different pathways. LPS has been shown to activate multiple PTKs, including Bruton’s tyrosine kinase (Horwood et al., 2006), SRC family PTKs (Napolitani et al., 2003; Smolinska et al., 2008), and proline-rich tyrosine kinase 2 (Hazeki et al., 2003). Recently, it has been shown that the activation of PTKs in a Src-dependent manner is required for TLR4 signaling in lung endothelial cells (Gong et al., 2008). Src kinase (Hausherr et al., 2007; Sam et al., 2007) and other PTKs along with JAKs (Gao et al., 2007) have been postulated to play a role in tyrosine phorphorylation of STAT3 in different tissues. We therefore also investigated the effect of stattic on c-Src phosphorylation. In contrast to the prevention of STAT3 phosphorylation, static increased tyrosine phosphorylation on residue 416 of Src, and use of a Src inhibitor did not decrease the level of IL-1␤ production in response to LPS (data not shown). These findings may suggest that phosphorylated STAT3 has a negative feedback role leading to down-regulation of Src, or Src may have a redundant function in LPS-mediated IL-1␤ synthesis. However, it remains unclear whether LPS mediates a direct effect on the JAK/STAT pathway or acts through the TLR/TIR receptor associated protein tyrosine kinases or other adaptor proteins through cross-talk among these receptors eventually inducing STAT3 phosphorylation. In this report we demonstrate for the first time that STAT3 tyrosine phosphorylation is critical for the production of IL-1␤ and IL-6. Disclosure The authors have no financial conflict of interest. Acknowledgements We thank Gabriel Nunez, MD (University of Michigan) for critical review of the manuscript. We also would like to thank Drs. Micheal Shaw and Harly Tse (Wayne State University) for providing the BMDC and critical discussions, and Jeffrey Doan (Wayne State University) for his assistance with editing the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2009.02.018. References Akarsu, E.S., Mamuk, S., 2007. Escherichia coli lipopolysaccharides produce serotypespecific hypothermic response in biotelemetered rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R1846–R1850. Burger, D., Chicheportiche, R., Giri, J.G., Dayer, J.M., 1995. The inhibitory activity of human interleukin-1 receptor antagonist is enhanced by type II interleukin-1 soluble receptor and hindered by type I interleukin-1 soluble receptor. J. Clin. Invest. 96, 38–41.

1876

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877

Burger, D., Dayer, J.M., Palmer, G., Gabay, C., 2006. Is IL-1 a good therapeutic target in the treatment of arthritis? Best Pract. Res. Clin. Rheumatol. 20, 879–896. Cho, M.L., Kang, J.W., Moon, Y.M., Nam, H.J., Jhun, J.Y., Heo, S.B., Jin, H.T., Min, S.Y., Ju, J.H., Park, K.S., Cho, Y.G., Yoon, C.H., Park, S.H., Sung, Y.C., Kim, H.Y., 2006. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J. Immunol. 176, 5652–5661. Church, L.D., Cook, G.P., McDermott, M.F., 2008. Primer: inflammasomes and interleukin 1beta in inflammatory disorders. Nat. Clin. Pract. Rheumatol. 4, 34–42. Dayer, J.M., Feige, U., Edwards 3rd, C.K., Burger, D., 2001. Anti-interleukin-1 therapy in rheumatic diseases. Curr. Opin. Rheumatol. 13, 170–176. de Vries-Bouwstra, J.K., Goekoop-Ruiterman, Y.P., Wesoly, J., Hulsmans, H.J., de Craen, A.J., Breedveld, F.C., Dijkmans, B.A., Allaart, C.F., Huizinga, T.W., 2007. Ex vivo interleukin 1 receptor antagonist production on lipopolysaccharide stimulation is associated with rheumatoid arthritis and with joint damage. Ann. Rheum. Dis. 66, 1033–1037. Dinarello, C.A., 1998. Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting enzyme. Ann. N Y Acad. Sci. 856, 1–11. Dinarello, C.A., 2002. The IL-1 family and inflammatory diseases. Clin. Exp. Rheumatol. 20, S1–S13. Dinarello, C.A., 2006. Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process. Am. J. Clin. Nutr. 83, 447S–455S. Fielding, C.A., McLoughlin, R.M., McLeod, L., Colmont, C.S., Najdovska, M., Grail, D., Ernst, M., Jones, S.A., Topley, N., Jenkins, B.J., 2008. IL-6 regulates neutrophil trafficking during acute inflammation via STAT3. J. Immunol. 181, 2189–2195. Franchi, L., Kanneganti, T.D., Dubyak, G.R., Nunez, G., 2007. Differential requirement of P2X7 receptor and intracellular K+ for caspase-1 activation induced by intracellular and extracellular bacteria. J. Biol. Chem. 282, 18810–18818. Galdiero, M., Vitiello, M., D’Isanto, M., Raieta, K., Galdiero, E., 2006. STAT1 and STAT3 phosphorylation by porins are independent of JAKs but are dependent on MAPK pathway and plays a role in U937 cells production of interleukin-6. Cytokine 36, 218–228. Gao, S.P., Mark, K.G., Leslie, K., Pao, W., Motoi, N., Gerald, W.L., Travis, W.D., Bornmann, W., Veach, D., Clarkson, B., Bromberg, J.F., 2007. Mutations in the EGFR kinase domain mediate STAT3 activation via IL-6 production in human lung adenocarcinomas. J. Clin. Invest. 117, 3846–3856. Gay, N.J., Gangloff, M., Weber, A.N., 2006. Toll-like receptors as molecular switches. Nat. Rev. Immunol. 6, 693–698. Glasgow, S.C., Ramachandran, S., Blackwell, T.S., Mohanakumar, T., Chapman, W.C., 2007. Interleukin-1beta is the primary initiator of pulmonary inflammation following liver injury in mice. Am. J. Physiol. Lung Cell Mol. Physiol. 293, L491–L496. Gong, P., Angelini, D.J., Yang, S., Xia, G., Cross, A.S., Mann, D., Bannerman, D.D., Vogel, S.N., Goldblum, S.E., 2008. TLR4 signaling is coupled to SRC family kinase activation, tyrosine phosphorylation of zonula adherens proteins, and opening of the paracellular pathway in human lung microvascular endothelia. J. Biol. Chem. 283, 13437–13449. Gorina, R., Petegnief, V., Chamorro, A., Planas, A.M., 2005. AG490 prevents cell death after exposure of rat astrocytes to hydrogen peroxide or proinflammatory cytokines: involvement of the Jak2/STAT pathway. J. Neurochem. 92, 505–518. Hausherr, A., Tavares, R., Schaffer, M., Obermeier, A., Miksch, C., Mitina, O., Ellwart, J., Hallek, M., Krause, G., 2007. Inhibition of IL-6-dependent growth of myeloma cells by an acidic peptide repressing the gp130-mediated activation of Src family kinases. Oncogene 26, 4987–4998. Hazeki, K., Masuda, N., Funami, K., Sukenobu, N., Matsumoto, M., Akira, S., Takeda, K., Seya, T., Hazeki, O., 2003. Toll-like receptor-mediated tyrosine phosphorylation of paxillin via MyD88-dependent and -independent pathways. Eur. J. Immunol. 33, 740–747. Horvath, C.M., 2004. The Jak–STAT pathway stimulated by interferon gamma. Sci. STKE 2004, tr8. Horwood, N.J., Page, T.H., McDaid, J.P., Palmer, C.D., Campbell, J., Mahon, T., Brennan, F.M., Webster, D., Foxwell, B.M., 2006. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6, production. J. Immunol. 176, 3635–3641. Huang, Y., Li, T., Sane, D.C., Li, L., 2004. IRAK1 serves as a novel regulator essential for lipopolysaccharide-induced interleukin-10 gene expression. J. Biol. Chem. 279, 51697–51703. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S., Steinman, R.M., 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colonystimulating factor. J. Exp. Med. 176, 1693–1702. Jacoby, J.J., Kalinowski, A., Liu, M.G., Zhang, S.S., Gao, Q., Chai, G.X., Ji, L., Iwamoto, Y., Li, E., Schneider, M., Russell, K.S., Fu, X.Y., 2003. Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age. Proc. Natl. Acad. Sci. U.S.A. 100, 12929–12934. Kamezaki, K., Shimoda, K., Numata, A., Matsuda, T., Nakayama, K., Harada, M., 2004. The role of Tyk2, Stat1 and Stat4 in LPS-induced endotoxin signals. Int. Immunol. 16, 1173–1179. Kobierski, L.A., Srivastava, S., Borsook, D., 2000. Systemic lipopolysaccharide and interleukin-1beta activate the interleukin 6: STAT intracellular signaling pathway in neurons of mouse trigeminal ganglion. Neurosci. Lett. 281, 61–64. Kolb, M., Margetts, P.J., Anthony, D.C., Pitossi, F., Gauldie, J., 2001. Transient expression of IL-1beta induces acute lung injury and chronic repair leading to pulmonary fibrosis. J. Clin. Invest. 107, 1529–1536. Larsen, C.M., Faulenbach, M., Vaag, A., Volund, A., Ehses, J.A., Seifert, B., MandrupPoulsen, T., Donath, M.Y., 2007. Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N. Engl. J. Med. 356, 1517–1526.

Lee, C., Lim, H.K., Sakong, J., Lee, Y.S., Kim, J.R., Baek, S.H., 2006. Janus kinase-signal transducer and activator of transcription mediates phosphatidic acid-induced interleukin (IL)-1beta and IL-6 production. Mol. Pharmacol. 69, 1041– 1047. Levy, D.E., Darnell Jr., J.E., 2002. Stats: transcriptional control and biological impact. Nat. Rev. Mol. Cell Biol. 3, 651–662. Levy, O., Granot, Y., 2006. Arginine-vasopressin activates the JAK–STAT pathway in vascular smooth muscle cells. J. Biol. Chem. 281, 15597–15604. Lewis, H.D., Winter, A., Murphy, T.F., Tripathi, S., Pandey, V.N., Barton, B.E., 2008. STAT3 inhibition in prostate and pancreatic cancer lines by STAT3 binding sequence oligonucleotides: differential activity between 5 and 3 ends. Mol. Cancer Ther. 7, 1543–1550. Martinon, F., Burns, K., Tschopp, J., 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell 10, 417–426. Martinon, F., Petrilli, V., Mayor, A., Tardivel, A., Tschopp, J., 2006. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature 440, 237–241. Matsukawa, A., Kudo, S., Maeda, T., Numata, K., Watanabe, H., Takeda, K., Akira, S., Ito, T., 2005. Stat3 in resident macrophages as a repressor protein of inflammatory response. J. Immunol. 175, 3354–3359. McMurray, J.S., 2006. A new small-molecule Stat3 inhibitor. Chem. Biol. 13, 1123–1124. Mizel, S.B., 1982. Interleukin 1 and T cell activation. Immunol. Rev. 63, 51–72. Mullaly, S.C., Kubes, P., 2006. The role of TLR2 in vivo following challenge with Staphylococcus aureus and prototypic ligands. J. Immunol. 177, 8154–8163. Murray, P.J., 2007. The JAK–STAT signaling pathway: input and output integration. J. Immunol. 178, 2623–2629. Napolitani, G., Bortoletto, N., Racioppi, L., Lanzavecchia, A., D’Oro, U., 2003. Activation of src-family tyrosine kinases by LPS regulates cytokine production in dendritic cells by controlling AP-1 formation. Eur. J. Immunol. 33, 2832–2841. Nowell, M.A., Williams, A.S., Carty, S.A., Scheller, J., Hayes, A.J., Jones, G.W., Richards, P.J., Slinn, S., Ernst, M., Jenkins, B.J., Topley, N., Rose-John, S., Jones, S.A., 2009. Therapeutic targeting of IL-6 trans signaling counteracts STAT3 control of experimental inflammatory arthritis. J. Immunol. 182, 613–622. Nunez Miguel, R., Wong, J., Westoll, J.F., Brooks, H.J., O’Neill, L.A., Gay, N.J., Bryant, C.E., Monie, T.P., 2007. A dimer of the Toll-like receptor 4 cytoplasmic domain provides a specific scaffold for the recruitment of signalling adaptor proteins. PLoS ONE 2, e788. O’Neill, L.A., 2006. How Toll-like receptors signal: what we know and what we don’t know. Curr. Opin. Immunol. 18, 3–9. Okugawa, S., Ota, Y., Kitazawa, T., Nakayama, K., Yanagimoto, S., Tsukada, K., Kawada, M., Kimura, S., 2003. Janus kinase 2 is involved in lipopolysaccharide-induced activation of macrophages. Am. J. Physiol. Cell Physiol. 285, C399–C408. Panopoulos, A.D., Zhang, L., Snow, J.W., Jones, D.M., Smith, A.M., El Kasmi, K.C., Liu, F., Goldsmith, M.A., Link, D.C., Murray, P.J., Watowich, S.S., 2006. STAT3 governs distinct pathways in emergency granulopoiesis and mature neutrophils. Blood 108, 3682–3690. Prele, C.M., Keith-Magee, A.L., Murcha, M., Hart, P.H., 2007. Activated signal transducer and activator of transcription-3 (STAT3) is a poor regulator of tumour necrosis factor-alpha production by human monocytes. Clin. Exp. Immunol. 147, 564–572. Qin, H., Roberts, K.L., Niyongere, S.A., Cong, Y., Elson, C.O., Benveniste, E.N., 2007. Molecular mechanism of lipopolysaccharide-induced SOCS-3 gene expression in macrophages and microglia. J. Immunol. 179, 5966–5976. Sam, M.R., Elliott, B.E., Mueller, C.R., 2007. A novel activating role of SRC and STAT3 on HGF transcription in human breast cancer cells. Mol. Cancer 6, 69. Schust, J., Sperl, B., Hollis, A., Mayer, T.U., Berg, T., 2006. Stattic: a smallmolecule inhibitor of STAT3 activation and dimerization. Chem. Biol. 13, 1235– 1242. Severgnini, M., Takahashi, S., Rozo, L.M., Homer, R.J., Kuhn, C., Jhung, J.W., Perides, G., Steer, M., Hassoun, P.M., Fanburg, B.L., Cochran, B.H., Simon, A.R., 2004. Activation of the STAT pathway in acute lung injury. Am. J. Physiol. Lung Cell Mol. Physiol. 286, L1282–L1292. Simeone-Penney, M.C., Severgnini, M., Rozo, L., Takahashi, S., Cochran, B.H., Simon, A.R., 2008. PDGF-induced human airway smooth muscle cell proliferation requires STAT3 and the small GTPase Rac1. Am. J. Physiol. Lung Cell Mol. Physiol. 294, L698–704. Simeone-Penney, M.C., Severgnini, M., Tu, P., Homer, R.J., Mariani, T.J., Cohn, L., Simon, A.R., 2007. Airway epithelial STAT3 is required for allergic inflammation in a murine model of asthma. J. Immunol. 178, 6191–6199. Smolinska, M.J., Horwood, N.J., Page, T.H., Smallie, T., Foxwell, B.M., 2008. Chemical inhibition of Src family kinases affects major LPS-activated pathways in primary human macrophages. Mol. Immunol. 45, 990–1000. Sodhi, A., Kesherwani, V., 2007. Signaling molecules involved in production and regulation of IL-1beta by murine peritoneal macrophages in vitro on treatment with concanavalin A. Int. Immunopharmacol. 7, 1403–1413. Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M., Yoshida, N., Kishimoto, T., Akira, S., 1997. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc. Natl. Acad. Sci. U.S.A. 94, 3801–3804. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., Akira, S., 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301, 640–643. Yan, S., Zhou, C., Zhang, W., Zhang, G., Zhao, X., Yang, S., Wang, Y., Lu, N., Zhu, H., Xu, N., 2008. beta-Catenin/TCF pathway upregulates STAT3 expression in human esophageal squamous cell carcinoma. Cancer Lett..

L. Samavati et al. / Molecular Immunology 46 (2009) 1867–1877 Yang, J., Liao, X., Agarwal, M.K., Barnes, L., Auron, P.E., Stark, G.R., 2007. Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev. 21, 1396–1408. Yeh, M., Gharavi, N.M., Choi, J., Hsieh, X., Reed, E., Mouillesseaux, K.P., Cole, A.L., Reddy, S.T., Berliner, J.A., 2004. Oxidized phospholipids increase interleukin 8 (IL-8) synthesis by activation of the c-src/signal transducers and activators of transcription (STAT)3 pathway. J. Biol. Chem. 279, 30175–30181. Yu, J.H., Kim, K.H., Kim, H., 2006. Suppression of IL-1beta expression by the Jak 2 inhibitor AG490 in cerulein-stimulated pancreatic acinar cells. Biochem. Pharmacol. 72, 1555–1562.

1877

Yu, Z., Zhang, W., Kone, B.C., 2002. Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB. Biochem. J. 367, 97–105. Zhang, L., Badgwell, D.B., Bevers, J.J., Schlessinger 3rd, K., Murray, P.J., Levy, D.E., Watowich, S.S., 2006. IL-6 signaling via the STAT3/SOCS3 pathway: functional analysis of the conserved STAT3 N-domain. Mol. Cell Biochem. 288, 179– 189.