Virus Research 197 (2015) 127–136

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

A mitovirus related to plant mitochondrial gene confers hypovirulence on the phytopathogenic fungus Sclerotinia sclerotiorum Zhiyong Xu a,b , Songsong Wu a,b , Lijiang Liu a,b , Jiasen Cheng b , Yanping Fu b , Daohong Jiang a,b , Jiatao Xie b,∗ a

State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, Hubei Province, People’s Republic of China Provincial Key Laboratory of Plant Pathology of Hubei Province, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, Hubei Province, People’s Republic of China b

a r t i c l e

i n f o

Article history: Received 30 October 2014 Received in revised form 15 December 2014 Accepted 18 December 2014 Available online 27 December 2014 Keywords: Sclerotinia sclerotiorum Mitovirus Sclerotinia sclerotiorum mitovirus 1 Hypovirulence Plant mitovirus-like gene

a b s t r a c t A double-stranded RNA (dsRNA) segment was isolated from a hypovirulent strain, HC025, of Sclerotinia sclerotiorum. The complete nucleotide sequence of the dsRNA was determined to be 2530 bp in length. Using the fungal mitochondrial genetic code, the positive strand of the dsRNA was found to contain a single large open reading frame (ORF) with the characteristic conserved motifs of the RNA-dependent RNA polymerase (RdRp). BLAST analysis revealed that RdRp shares 74% sequence identity with Sclerotinia sclerotiorum mitovirus 1 (SsMV1/KL-1). The positive strand of the dsRNA could be folded into potentially stable stem-loop structures at both the 5 and 3 terminal sequences. Moreover, the 5 and 3 terminal sequences were inverted complementary sequences and formed a panhandle structure. These results reveal that this dsRNA segment represents the replicative form of a mitovirus that is a strain of SsMV1 from the genus Mitovirus in the family Narnaviridae and was tentatively designated as Sclerotinia sclerotiorum mitovirus 1 (SsMV1/HC025). Sequence comparison and phylogenetic analysis suggest that mitovirus RdRp gene was evolutionarily related to plant mitochondrial genome. Our results demonstrate that SsMV1/HC025 infection exerted obvious effects on host biological properties. Hypovirulence feature and SsMV1/HC025 could be co-transmitted from hypovirulent strains to other virulent strains via hyphal contact. Thus, SsMV1/HC025 related to plant mitochondrial gene confers hypovirulence on S. sclerotiorum. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Mycoviruses (fungal viruses) are known to infect fungi and are prevalent in all major filamentous fungal groups. Although a large number of reported mycoviruses are generally present as latent infections in fungal hosts, several mycoviruses that cause apparent phenotypic alterations, including attenuation of fungal virulence (hypovirulence), have been recorded in many phytopathogenic fungi (Ghabrial and Suzuki, 2009; Pearson et al., 2009; Xie and Jiang, 2014). The mycoviruses associated with hypovirulence could be utilized as potential biological control agents to combat plant fungal diseases, and be probed for the pathogenicity and other properties of fungal hosts at the molecular level (Nuss, 2005). Thus, mycoviruses associated with hypovirulence have attracted much interest from plant pathologists.

∗ Corresponding author. Tel.: +86 27 87280487. E-mail address: [email protected] (J. Xie). http://dx.doi.org/10.1016/j.virusres.2014.12.023 0168-1702/© 2014 Elsevier B.V. All rights reserved.

Until recently, most hypovirulence-associated mycoviruses had been determined to have single-stranded RNA (ssRNA) genomes. The ssRNA mycoviruses identified thus far are mainly classified into five families: Hypoviridae, Alphaflexiviridae, Gammaflexiviridae, Narnaviridae and Barnaviridae (Hillman and Esteban, 2011). The mycoviruses belonging to family Narnaviridae are the simplest known mycoviruses and are divided into two genera, Narnavirus and Mitovirus, based on subcellular location (Ghabrial and Suzuki, 2009; Hillman and Cai, 2013). Mitoviruses are widespread among phytopathogenic fungi and often reduce the virulence of phytopathogenic fungal hosts (Hillman and Cai, 2013). Sclerotinia sclerotiorum is a destructive soil-borne phytopathogenic fungus. It has a broad host range of over 400 plant species (Bolton et al., 2006). This fungus causes Sclerotinia disease and is responsible for serious annual yield losses of many economically important crops, including soybean (Glycine max), rapeseed (Brassica napus) and vegetable plants. At present, several types of mycoviruses with dsRNA, ssRNA and ssDNA genomes have been characterized from S. sclerotiorum, and most of these reported

128

Z. Xu et al. / Virus Research 197 (2015) 127–136

mycoviruses cause hypovirulence (Jiang et al., 2013; Khalifa and Pearson, 2013; Hu et al., 2014; Xiao et al., 2014; Xie and Jiang, 2014). Moreover, previous study showed that Sclerotinia sclerotiorum hypovirulence-associated DNA virus 1 (SsHADV-1) holds the significant potential for biological control of Sclerotinia diseases in rapeseed field (Yu et al., 2013). Therefore, virocontrol is an important alternative for the biological control of Sclerotinia disease. Screening new and different types of mycoviruses from S. sclerotiorum populations will enrich virocontrol resources. In the present study, we isolated a S. sclerotiorum hypovirulent strain HC025 that harbors a mitovirus named as Sclerotinia sclerotiorum mitovirus 1 (SsMV1/HC025). The aims of the present study were: (1) to determine the full cDNA sequence of SsMV1/HC025 and the phylogenetic relationships between SsMV1/HC025 and other reported mitoviruses, (2) to investigate the biological role of SsMV1/HC025 in hypovirulent strains of S. sclerotiorum, and (3) to discuss the evolution of mitoviruses. 2. Materials and methods 2.1. Fungal isolates and culture conditions S. sclerotiorum strain HC025 was originally isolated from a diseased soybean (G. max) in Heilongjiang province which produces the greatest amount of soybean in China. Strains Ep-1PNA367 and 1980 are two virus-free virulent strains of S. sclerotiorum, and belong to different vegetative groups. Strains Ep-1PNA367R and 1980R were labeled with a hygromycin resistance gene via an Agrobacterium tumefaciens-mediated transformation technique. All strains were cultured on potato dextrose agar (PDA) medium at 20 ◦ C and were stored on PDA slants at 4 ◦ C. 2.2. DsRNA extraction and purification A previously described dsRNA extraction method was used with minor modifications (Xie et al., 2006). All fungal isolates were cultured on PDA plates overlaid with cellophane membranes (CMPDA) for 6–7 days. Subsequently, the mycelia were harvested from the CM-PDA with a sterile knife. The double-stranded nature of the extraction RNA was verified via digestion with DNase I and S1 nuclease (Takara, Dalian, China) as described by the manufacturer. The isolated dsRNA was electrophoresed on 1% agarose gel and purified with a gel extraction kit (Axygen, USA). The purified dsRNA was dissolved in DEPC-treated water and stored at −20 ◦ C until used. 2.3. cDNA synthesis, molecular cloning and sequencing Full-length cDNA cloning and sequencing of the purified dsRNA were performed as previously described with slight modifications (Xie et al., 2011). The terminal sequences of dsRNA were obtained by ligating the adapter PC3-T7loop (5 -pGGATCCCGGGAATTCGGTAATACGACTCACTATATTTTTATAGTGAGTCGTATTA-OH-3 ) to the 3 end of the dsRNA at 4–16 ◦ C for 16–24 h using T4 RNA ligase (Takara, Dalian, China) as previously described (Potgieter et al., 2009; Darissa et al., 2010). The PC3-T7loop-ligated dsRNA was purified with chloroform and isopropanol and then kept in DEPC-treated water. Subsequently, the purified ligated dsRNA was denatured and used for RT-PCR with M-MLV reverse transcriptase (Promega, USA) following the manufacturer’s instructions. The cDNA was used for PCR amplification with the primer PC2 (5 -p-CCGAATTCCCGGGATCC-3 ), which was complementary to the ligating adapter of the PC3-T7loop, and sequence-specific primers corresponding to the 5 and 3 terminal sequences of the dsRNA. The expected PCR products were gel-purified using a gel extraction kit (Axygen, USA) and then cloned into the pMD18-T

vector (Takara, Dalian, China) and sequenced in both orientations. To ensure the accuracy of the sequences obtained, each nucleotide of the dsRNA was sequenced with a minimum of three times. 2.4. Sequence and phylogenetic analyses The corresponding mitoviruses retrieved from NCBI GenBank were used for phylogenetic analysis. The DNAMAN version 6.0 software (Lynnon Biosoft) was used for sequence annotations, including open reading frame (ORF) searching and nucleotide statistics. Multiple alignments of the deduced amino acid sequences were performed using the PSI-Coffee (http://tcoffee.crg.cat/apps/tcoffee/do:psicoffee). To estimate the relationships among SsMV1/HC025 and other reported mitoviruses and plant mitochondrial genes, phylogenetic tree was constructed based on the aligned amino acid sequences with software PhyML 3.1 (Guindon et al., 2010), with SPRs algorithms and 8 categories of ␥-distributed substitution rates, using the LG + G + F model selected by Prot-Test2.4 (Abascal et al., 2005). The reliability of internal branches was evaluated based on SH-aLRT supports. Potential secondary structures of the 5 and 3 terminal sequences were predicted, and the free energy (G) was estimated using RNA structure software (Reuter and Mathews, 2010). 2.5. Curing strain HC025 and horizontal transmission of SsMV1/HC025 To eliminate the mitovirus from strain HC025, a protoplast isolation and regeneration experiment was conducted. Protoplasts were prepared with a previously described method (Zhang et al., 2009). As strain HC025 was vegetative incompatible with virus-free strains Ep-1PNA367 and 1980, the mitovirus SsMV1/HC025 was horizontally transmitted from strain HC025 to Ep-1PNA367R and 1980R via mixed cultures of hyphal homogenates. After the homogenates were spread on PDA plates for 7 days, mycelial plugs were selected randomly from the mixed homogenates and transferred onto fresh PDA plates containing 30 ␮g/ml hygromycin, on which unlabeled strains could not grow. New hygromycin-resistant isolates (Ep-1PNA367RV and 1980RV) were purified via a minimum of 5 rounds of hyphal-tip isolation on hygromycin PDA plates, and finally mycelial plugs were taken from the new colonies and transferred onto fresh PDA plates without hygromycin. To further eliminate the possibility of heterokaryons, the new mitovirus-infected strains Ep-1PNA367RV and 1980RV were dualcultured with their parental strains on PDA plates. After the mycelia of Ep-1PNA367RV and Ep-1PNA367 (or 1980RV and 1980) had been contacted for 12 h, agar plugs of Ep-1PNA367 (or 1980) were taken from the far side of strain Ep-1PNA367RV (or 1980RV). The new mitovirus-infected subcultures Ep-1PNA367V and 1980V could grow on PDA plates but failed to grow in the presence of hygromycin. 2.6. Comparison of the biological properties of strain HC025 and its derivatives To address whether mitovirus SsMV1/HC025 was associated with the hypovirulence trait of S. sclerotiorum, strain HC025, the two virus-free strains Ep-1PNA367R and 1980R, and the new virusinfected strains Ep-1PNA367RV and 1980RV were assessed for their biological properties, such as mycelial growth rates, virulence, sclerotia production, and morphology of hyphal tips and mitochondria. Growth rates were determined on PDA plates by measuring colony diameters after inoculating for 12, 24, 36 and 48 h. The colony morphology of each strain was observed and photographed at 5 days post-inoculation. A virulence assay was performed on detached rapeseed (B. napus) plants, soybean (G. max), and tomato

Z. Xu et al. / Virus Research 197 (2015) 127–136

Fig. 1. DsRNA extraction and schematic representation of SsMV1 from S. sclerotiorum strain HC025. (A) Agarose gel electrophoresis of dsRNA associated with strain HC025 of S. sclerotiorum. The dsRNA sample was treated with DNase I and S1 nuclease prior to electrophoresis. (B) Diagrammatic representation of the genomic organization of SsMV1/HC025 indicating the presence of a single large ORF. The ORF (308–2476 nt) encodes a putative RdRp protein. The 5 -untranslated region (UTR, 1–307 nt) and 3 -UTR (2477–2530 nt) are indicated as lines. AUG (308–310 nt) denotes the initiation codon, and UAGUAA (2477–2482 nt) denotes the two continuous stop codons.

(Lycopersicon esculentum) leaves, which were placed in an incubator with 100% relative humidity at 20 ◦ C. After 2 days, lesion diameters on leaves inoculated with strains were measured. To assess sclerotia production, all strains were incubated on PDA medium for 20 days, and then the number of sclerotia was calculated. There were at least three replicates for each treatment. After actively growing mycelial agar plugs were transferred onto CM-PDA and then incubated for 3 days, morphology of hyphal tips and mitochondria were observed using stereo-microscope and transmission electron microscopy (TEM, Model Tecnai G2 20; FEI, Hillsboro, OR), respectively. Sample preparation and procedure of TEM observation were performed as previously described (Boland et al., 1993). 3. Results 3.1. A dsRNA segment was isolated from a hypovirulent strain HC025 of S. sclerotiorum Since strain HC025 was incapable of causing disease lesions on its hosts, we suspected that strain HC025 harbored one or more mycoviruses. Thus, dsRNA and genomic DNA were extracted from the mycelial mass of strain HC025 and then electrophoretically separated on a 1% agarose gel. Electrophoresis revealed the presence of a slightly clear extra-chromosomal segment with a length of approximate 2.5 kbp, which was verified to be dsRNA in nature given its resistance to digestion with RNase-free DNase I and S1 nuclease (Fig. 1A). No extra-chromosomal DNA segments were observed in strain HC025. 3.2. Genome organization and content of the mitovirus SsMV1/HC025 To better understand its potential genetic information, the complete cDNA sequence of the purified dsRNA segment isolated from strain HC025 was determined by conventional random priming cDNA synthesis, RT-PCR and RACE cloning. The full-length cDNA sequence of the dsRNA segment was comprised of 2530 bp with a G + C content of 39.75%, which was similar to the size estimated by agarose gel electrophoresis. The genetic organization of the dsRNA segment is shown in Fig. 1B. It contains a 5 -untranslated region (UTR) of 307 nts and a 3 -UTR of 48 nts. More than eight smaller putative open reading frames (ORFs) were detected on the positive strand of the dsRNA when universal codon usage was applied. However, when fungal mitochondrial codon usage was invoked

129

(UGA coding for tryptophan), a single large putative ORF initiated by the start codon AUG (nt positions 308–310) and terminated by the two contiguous stop codons UAGUAA (nt positions 2477–2482) was identified on the positive strand. This ORF was predicted to encode a protein of 722 amino acids with an approximate molecular mass of 83.3 kDa. BLASTP search using the deduced amino acid sequence of the ORF indicated that it shared significant sequence identity with the RdRps of viruses in the genus Mitovirus (Fig. 2). Thus, we believed that the dsRNA segment from strain HC025 was a replication intermediate form of a novel member of the genus Mitovirus and tentatively designated as Sclerotinia sclerotiorum mitovirus 1 (SsMV1/HC025). The complete nucleotide sequence of SsMV1/HC025 was deposited in the Genbank database under accession number KJ463570. 3.3. Phylogenetic analysis of the mitovirus SsMV1/HC025 To determine taxonomic relationships among SsMV1/HC025 and other related mitoviruses, phylogenetic analysis was performed. Multiple alignments based on viral RdRps indicated that the RdRp of SsMV1/HC025 contains six conserved motifs (I–VI) (Fig. 2), which are characteristic of the genus Mitovirus (Hong et al., 1999). A BLASTP search of the RdRps revealed that SsMV1/HC025 shared the highest sequence identity with Sclerotinia sclerotiorum mitovirus 1 (SsMV1/KL-1) (74%). Based on the ICTV rules of species demarcation criteria about mitovirus, putative RdRp proteins of the distinct mitovirus species defined are less than 40% identities, whereas strains of the same mitovirus species should be greater than 90% (Hillman and Esteban, 2011; Martínez-Álvarez et al., 2014). In the present research, the putative RdRp protein sequence of SsMV1/HC025 was 74% identical to that of SsMV1, which are greater than 40% for species delimitation, but less than 90% for conspecific strains. Since SsMV1/HC025 and SsMV1/KL-1 infect the same hosts S. sclerotiorum, we presumed that SsMV1/HC025 is a new strain of SsMV1. Interestingly, mitoviruses isolated from the same host (S. sclerotiorum or Ophiostoma novo-ulmi) were phylogenetically and randomly placed into two different clusters. Moreover, the same species of Mitovirus (such as Sclerotinia sclerotiorum mitovirus 2, SsMV2) were detected in different countries (SsMV2/NZ1 and SsMV2/14563 from New Zealand strains, whereas SsMV2/KL-1 from USA strain) (Fig. 3A). 3.4. Mitoviruses was evolutionarily related to plant mitochondrial genomes BLASTP search of the plant database revealed that SsMV1/HC025 RdRp shared 30% to 36% identities with the proteins encoded by mitochondrial genes in plants Capsicum annuum (E value = 2e−25), Brassica oleracea (E value = 7e−21), Raphanus sativus (E value = 4e−20), Arabidopsis thaliana (E value = 3e−17), Solanum tuberosum (E value = 1e−16), G. max (E value = 1e−15), Medicago truncatula (E value = 1e−09) and Cicer arietinum (E value = 4e−05). To better understand the relationships between mitoviruses and mitochondrial mitovirus-like RdRp genes of plants, multiple alignments were conducted and the results revealed that six conserved motifs characteristic of mitovirus RdRps (I–VI) were screened in RdRp-like protein encoded by mitochondrial genes of plants referenced (Fig. 2). Moreover, those mitochondrial mitovirus-like RdRp genes were detected from plants with PCR method (Fig. 3B), which eliminated the sequence contamination. Phylogenetic analyses based on multiple alignments further supported that mitovirus-like RdRp proteins from plant mitochondria were evolutionarily related to that from mitoviruses, and mitovirus-like RdRp proteins formed an independent phylogenetical branch with

130

Z. Xu et al. / Virus Research 197 (2015) 127–136

Fig. 2. Multiple alignment of conserved amino acid motifs in RdRp regions of SsMV1/HC025 and other mitoviruses and corresponding regions in some plant homologues. The ORF encodes a putative protein containing six conserved motifs characteristic of RdRps of mitoviruses similar to SsMV1/HC025. The positions of motifs I–VI are indicated as lines above the sequences. Numbers in square brackets correspond to the number of amino acid residues separating the motifs. Identical residues are shaded and indicated by asterisks; conserved and semi-conserved amino acid residues are indicated by colons and dots, respectively. All GenBank accessions of viruses and plant mitovirus-like elements selected were shown in Table S1.

cluster of Mitovirus III (Fig. 3A), which was distant to clusters of Mitovirus I and II. 3.5. Predicted secondary structures of the 5 - and 3 -UTRs As the stem-loop structures at the termini are characteristic of mitoviruses, the potential secondary structures of the 5 - and 3 -UTRs of the positive strand of SsMV1/HC025 were predicted using RNA structure software. The results revealed that the 5 - and 3 -UTRs could be folded into two predicted stable stem-loop structures (Fig. 4A and B). The G values of the stem-loop structures at the 5 - and 3 -UTRs were −30.8 kcal/mol and −35.3 kcal/mol, respectively. In addition, the 5 - and 3 -UTRs of the positive strand of SsMV1/HC025 had an inverted complementarity, and a potentially stable panhandle structure was predicted with a G value of −64.3 kcal/mol (Fig. 4C). 3.6. SsMV1/HC025 confers hypovirulence on S. sclerotiorum To determine the relationship between SsMV1/HC025 and hypovirulence on strain HC025, we attempted to eliminate the mitovirus SsMV1/HC025 from strain HC025 via protoplast regeneration but failed, indicating that similar to other mitoviruses (Xie and Ghabrial, 2012), SsMV1/HC025 cannot be eliminated from its host via protoplast regeneration. Therefore, horizontal transmission of SsMV1/HC025 between different strains of S. sclerotiorum was performed using mixed cultures of hyphal homogenates. The results with mixed hyphal homogenate cultures indicated that SsMV1/HC025 could be transmitted into two virus-free strains, Ep-1PNA367R and 1980R. Successful transmission was also confirmed by RT-PCR analysis (Fig. 5F). The new SsMV1/HC025-infected strains were designated as Ep-1PNA367RV

and 1980RV. It is interesting that, in comparison to the original strains, strains Ep-1PNA367RV and 1980RV exhibited hypovirulence, including slower mycelial growth (Fig. 5A and B), lower levels of virulence on detached rapeseed (B. napus) plants (Fig. 5D upper panels) and soybean (G. max) leaves (Fig. 5D lower panels, 5E), and reduced sclerotia production (measured as sclerotia number) (Fig. 5C). To further confirm that SsMV1/HC025 is the determinant of host hypovirulence, dual culture was used to test the transmission of SsMV1/HC025 from the hypovirulent strain Ep-1PNA367RV (donor) to the virulent strain Ep-1PNA367 (recipient) (Fig. 6A) or from the hypovirulent strain 1980RV to the virulent strain 1980 (Fig. 6B). The resultant infected strains were designated as Ep1PNA367V and 1980V. The presence of SsMV1/HC025 in strains Ep-1PNA367V and 1980V was verified by dsRNA extraction and RTPCR (Fig. 6D). Compared with the parental strain Ep-1PNA367 (or 1980), the SsMV1/HC025-infected strain Ep-1PNA367V (or 1980V) exhibited hypovirulence, including lower levels of virulence on detached tomato (L. esculentum) leaves (Fig. 6C). These results revealed that mitovirus SsMV1/HC025 and the hypovirulence traits of strain HC025 were horizontally co-transmitted into two virusfree strains, and SsMV1/HC025 was associated with hypovirulence and other related traits of strain HC025. Compared to the virus-free strains Ep-1PNA367R and 1980R, new SsMV1/HC025-infected isolates Ep-1PNA367RV and 1980RV have more branches in hyphal tips, which was similar to wild type strain HC025 (Fig. 7A). Ultrastructure showed that most of mitochondria in strains Ep-1PNA367R and 1980R had oval or oblong shape and contained abundant cristae inside, whereas the mitochondria in strains Ep-1PNA367RV, 1980RV and HC025 became swollen and contained aggregates of fibrous matrix materials (Fig. 7B). Thus, the abnormal morphology of hyphal tips and

Z. Xu et al. / Virus Research 197 (2015) 127–136

131

Fig. 3. (A) Maximum likelihood (ML) phylogenetic tree based on multiple alignments of RdRp regions of SsMV1/HC025 and other mitoviruses and corresponding regions in some plant homologues. Mitoviruses marked by gray shade were isolated from strains of S. sclerotiorum. SsMV1/HC025 clustered closely with the Sclerotinia mitovirus SsMV1/KL-1 and SsMV5. All selected mitoviruses were divided into three clusters (Mitovirus I, Mitovirus II and Mitovirus III). The mitovirus-like proteins encoded by plant mitochondrial genes were phylogenetically related to RdRp proteins of mitoviruses. All information of mitoviruses and plant mitovirus-like elements were shown in Table S1. (B) Molecular detection of plant mitovirus-like genes in plants. Lane 1–6 represented Arabidopsis thaliana ArthMp097, Brassica napus BrnapMp064, Capsicum annuum KY47 p118, Glycine max AtMg01410-like, Raphanus sativus DCGMS 00160, and Solanum tuberosum AtMg01110-like, respectively. Primers used in the molecular detection were showed in Table S2. The mitovirus-like RdRp genes were detected from plants, which eliminated the sequence contamination.

mitochondria were co-transferred with mitovirus SsMV1/HC025 on strains of S. sclerotiorum. In summary, SsMV1/HC025 confers hypovirulence on S. sclerotiorum and its infection also had obvious effects on other fungal biological properties including mycelial growth, sclerotia production, hyphal tips morphology, and mitochondrial malformation. 4. Discussion In the present study, we described the molecular and biological characteristics of a novel strain of mitovirus SsMV1, SsMV1/HC025, which was isolated from the hypovirulent strain HC025 of the phytopathogenic fungus S. sclerotiorum. Complete nucleotide sequence analysis revealed that SsMV1/HC025 had a single ORF that encoded an RdRp protein. BLASTP search with the deduced RdRp protein indicated that SsMV1/HC025 shared significant sequence identity with known mitoviruses (Fig. 3A). Sequence and phylogenetic analyses of RdRp strongly supported the conclusion that SsMV1/HC025 is most closely related to mitovirus SsMV1/KL-1, which was isolated from S. sclerotiorum

in USA. Therefore, it is hypothesized that SsMV1/HC025 represents a new member of the genus Mitovirus in the family Narnaviridae. To the best of our knowledge, SsMV1/HC025 is the firstly reported mitovirus infecting S. sclerotiorum in Asia including China. Viruses of the genus Mitovirus are known to be the simplest naked mycoviruses, whose RNA genomes encode only an RdRp protein, and the viruses exist as RNA-RdRp nucleoprotein complexes (Ghabrial and Suzuki, 2009). Most mitoviruses usually contain 7–12 UGA codons, which have been speculated to encode tryptophan rather than acting as stop codons, as in the universal genetic code (Paquin et al., 1997). Sequence analysis revealed that SsMV1/HC025 had 10 UGA codons. It is noteworthy that SsMV1/HC025 had a codon preference of either A or U in the third wobble position, and the frequency of codons XYA + XYU was 63.3% (457/722 codons). Such codon preferences are characteristic of fungal and plant mitochondrial genomes and may reflect the A-U rich nature (usually >60%) of mitochondrial genomes (Paquin et al., 1997; Hong et al., 1998). Our results also suggested that SsMV1/HC025 has a high A-U content of 60.25%.

132

Z. Xu et al. / Virus Research 197 (2015) 127–136

Fig. 4. Predicted secondary structures of the 5 - and 3 -UTRs of SsMV1/HC025 genome. (A) The predicted 5 stem-loop structure. (B) The predicted 3 stem-loop structure. (C) The predicted panhandle structure formed by the complementary sequences of the 5 and 3 terminal sequences. The RNAs were folded, and the free energy was calculated with RNA structure software.

Fig. 5. SsMV1/HC025-infected strains exhibited hypovirulence. (A, B, and C) S. sclerotiorum SsMV1/HC025-infected strains exhibit abnormal colonies with slower growth rates and lower sclerotial production. The mycelia of strain Ep-1PNA367R and 1980R covered the entire surface of a PDA plate at 5 dpi, whereas the mycelia of SsMV1/HC025infected strains did not cover the entire PDA plate, even at 20 dpi. Growth rate (B) was determined on PDA medium by measuring colony diameters after inoculating for 12, 24, 36 and 48 h. Sclerotia number (C) was calculated after a 20 day incubation period of mycelium plugs on PDA medium. (D and E) Pathogenicity assays with S. sclerotiorum SsMV1/HC025-infected strains and virus-free strains on detached rapeseed plants (upper panels) and soybean leaves (lower panels). Virulence on detached rapeseed plants and soybean leaves was assessed at 48 hpi. Compared to the original strains, strains Ep-1PNA367RV and 1980RV exhibited lower level of virulence on detached rapeseed plants and soybean leaves, and almost no lesion observing. (F) Detection of the mitovirus SsMV1/HC025 in individual isolates of S. sclerotiorum. The actin gene of S. sclerotiorum was used as an internal control. The results were expressed as the means ± standard error of the mean for each isolate or strain in the growth rate test, sclerotial production test and pathogenicity test. Bars in each figure for each parameter headed with the same letters are not significantly different (P > 0.05) according to the least significant difference test.

Z. Xu et al. / Virus Research 197 (2015) 127–136

133

Fig. 6. Co-transmission of the hypovirulence trait and SsMV1/HC025 from the hypovirulent strains Ep-1PNA367RV and 1980RV to the virulent strains Ep-1PNA367 and 1980 via hyphal contact on PDA plates. (A, B) Colony morphologies of strains Ep-1PNA367 (a1), and Ep-1PNA367RV (b1), 1980 (a2) and 1980RV (b2). After the two strains (a1 vs. b1 or a2 vs. b2) were dual-cultured until the mycelia of the two strain were in contact, a mycelial agar plug (marked with a black arrow) was removed from the colony margin of strain Ep-1PNA367 or 1980 (black arrow) and then transferred onto a fresh PDA plate to establish the derivative isolate Ep-1PNA367V (c1) or 1980V (c2). After culturing on PDA for 5 days, the derivative isolates Ep-1PNA367V and 1980V were transferred onto a fresh PDA plate containing 30 ␮g/ml hygromycin, but they failed to grow (right plate). (C) Virulence assay with S. sclerotiorum strains HC025, Ep-1PNA367, Ep-1PNA367V, 1980 and 1980V on detached tomato leaves (20 ◦ C, 48 hpi). (D) RT-PCR detection of SsMV1/HC025 in strains HC025, Ep-1PNA367 (a1), Ep-1PNA367V (c1), 1980 (a2) and 1980V (c2). The dsRNA was extracted from these strains, and all dsRNA samples were treated with RNase-free DNase I and S1 nuclease prior to electrophoresis. The actin gene of S. sclerotiorum was used as an internal control.

The 5 - and 3 -UTRs of the positive strand of SsMV1/HC025 could be folded into potentially stable stem-loop structures. The presence of stem-loop structures at both the 5 and 3 ends is the characteristic feature of mitovirus genomic RNA (Hong et al., 1999), which is also the case for many mitoviruses found in different fungi, such as S. sclerotiorum (SsMV1/KL-1, SsMV2/KL-1, SsMV3/NZ1 and SsMV4/NZ1), Botrytis cinerea (Botrytis cinerea mitovirus 1, BcMV1) and O. novo-ulmi (Ophiostoma novo-ulmi mitovirus 3a-Ld, OnuMV4-Ld, OnuMV5-Ld and OnuMV6-Ld). The stem-loop structures may play important roles in many aspects of mitoviral replication, including protecting the naked ssRNA from degradation (Hong et al., 1998; 1999) and acting as recognition sites for RdRp (Buck, 1996; Buck and Brasier, 2002). Moreover, the positive strand of SsMV1/HC025 had inverted complementarity with a potential panhandle structure, as reported for SsMV2/NZ-1. Previous research on the diversity of mitoviruses from O. novoulmi revealed that there were a variety of novel mitoviruses, and at least seven independent species of mitoviruses co-infected the hypovirulent strain Ld (Cole et al., 1998). Full sequences of nine Ophiostoma mitovirus species have been determined to date (Doherty et al., 2006; Hong et al., 1999); five species were isolated from Europe, and two species co-infected the North American strain 93–1224 (Hintz et al., 2013). Similar to O. novo-ulmi, Sclerotinia mitovirus is also widespread, and there is complicated diversity in the S. sclerotiorum population. Seven mitovirus species (twelve isolates) have thus far been reported in S. sclerotiorum. Two

mitoviruses (SsMV1 and SsMV2) were isolated from a US strain KL1 (Xie and Ghabrial, 2012), and six mitoviruses (SsMV2 to SsMV7) mixture-infected four New Zealand strains (Khalifa and Pearson, 2013, 2014). Here, we described a novel strain of mitovirus SsMV1, SsMV1/HC025, which was isolated from a Chinese strain HC025 of S. sclerotiorum. It is notable that other full or partial sequences of 12 mitoviruses (SsMV5 to SsMV16 with accession numbers from KF913880 to KF913891) were recently submitted to GenBank by researchers from the University of Illinois, USA. It is more interesting that SsMV5 (KJ462510), SsMV6 (KJ462512) and SsMV7 (KJ462514) were also isolated from certain New Zealand strains, given that USA and New Zealand are separated by the Pacific Ocean. The question of how those mitoviruses were transmitted across the Pacific Ocean should be further explored. Thus, these results also revealed that mitoviruses of S. sclerotiorum exhibit great diversity not only in terms of species but also in terms of geographical distribution. The interaction between mitoviruses and S. sclerotiorum may represent a new virus-host interaction system to explore the mechanism of mitoviral transmission overseas based on ecology, evolutionary biology and epidemiology. Phylogenetic analysis indicated that all mitoviruses were divided into three main clusters (Mitovirus I, Mitovirus II and Mitovirus III). Based on the phylogenetic tree, mitoviruses infecting the same fungal species (such as S. sclerotiorum or O. novoulmi) clustered randomly into different groups. Conversely, some mitoviruses (such as OnuMV4 and SsMV4, OnuMV5 and SsMV5)

134

Z. Xu et al. / Virus Research 197 (2015) 127–136

Fig. 7. Hyphal tips morphology (A) and mitochondrial morphology (B) comparisons among S. sclerotiorum strains. All strains were cultured on CM-PDA for 3 days. (A) Compared to the virus-free strains Ep-1PNA367R and 1980R, new SsMV1/HC025-infected isolates Ep-1PNA367RV, 1980RV and wild type strain HC025 have more branches in hyphal tips. Scale bars = 500 nm. (B) Transmission electron micrographs showed that most of mitochondria in strains Ep-1PNA367R and 1980R had oval or oblong shape and contained abundant cristae inside, whereas the mitochondria in strains Ep-1PNA367RV, 1980RV and HC025 became swollen and contained aggregates of fibrous matrix materials. The images in lower panels are the enlarged images framed by white boxes in upper panels. M = mitochondrion, scale bars = 1 ␮m.

isolated from different fungal species had relatively close relationships in terms of phylogenetics (Fig. 3A). These results revealed, in part, that distinct mitoviruses may have evolutionally existed before the fungal hosts diverged. Given that it is believed that RNA mycoviruses evolve at a more rapid rate than their host DNA genomes, the long-term co-evolution of mitoviruses with their fungal hosts would have caused an important sequence divergence of mitoviral genomes (Hong et al., 1999). Horizontal gene transfer (HGT) is one explanation for mitovirus RdRp related to some plant mitochondrial protein. Increasing reports supported that HGT is extremely widespread between plant nuclear genomes and viruses in both directions (Chiba et al., 2011; Liu et al., 2010, 2011; Moreira and López-García, 2009; Monier et al., 2009). RdRp, the sole gene encoded by mitovirus, is the most important gene for RNA viruses. Several papers previously mentioned that mitoviral nucleic acid sequence may transfer between fungi and plants (Marienfeld et al., 1997; Goremykin et al., 2009; Shackelton and Holmes, 2008). In our research, sequence comparison and phylogenetic analyses both suggested that RdRp proteins of mitoviruses were phylogenetically related to mitovirus-like RdRp proteins from plant mitochondrial genomes. Those findings reveal that HGT may occur between mitovirus and plant mitochondrial genome. It should be noted that nine plants containing homologous gene of mitovirus RdRp are the natural hosts of S. sclerotiorum and B. cinerea, which both harbor mitovirus. The similar ecological sites supply a chance for genetic exchange between mitovirus and plant during the long-term co-evolution. Since the mitovirus homologous genes exist in only limited plant mitochondrial genomes but lack in most plants, we speculated that plant mitochondrial mitovirus-like RdRp genes were captured from mitovirus infecting fungi via fungi-mediated HGT event during the long-term co-evolution.

Virus integration may be the second explanation for mitovirus RdRp related to some plant mitochondrial protein. Phylogenetic analysis revealed that plant mitochondrial mitovirus-like elements formed an independent cluster that does not cluster with mitoviruses; thus, mitoviruses and plant mitochondrial mitovirus-like elements may evolve from the same mitovirusrelated ancestral virus (such as RNA bacteriophages) (Dolja and Koonin, 2012). After the divergence of fungi and plants occurred, the mitovirus-related ancestral virus could be integrated into plant genomes. The integrated virus-like copies could contribute to acquire immunity to the respective viruses (Koonin, 2010), which may be a potential explanation that no mitovirus has been reported so far from plants. However, virus integration has not occurred in fungi during the long-term co-evolution, thus mitovirus-related elements were not discovered in fungal mitochondria genomes. Our results confirm that SsMV1/HC025 confers hypovirulence on S. sclerotiorum. Similarly, previous studies reported that several mitoviruses reduced the virulence or pathogenicity of fungal hosts including B. cinerea (Wu et al., 2007, 2010), Cryphonectria parasitica (Polashock and Hillman, 1994), O. novo-ulmi (Hong et al., 1999), Rhizoctonia solani (Lakshman and Tavantzis, 1994), Sclerotinia homoeocarpa (Deng and Boland, 2006) and S. sclerotiorum (Xie and Ghabrial, 2012; Khalifa and Pearson, 2013). However, the mitoviruses including Cryphonectria cubensis mitovirus 1b (CMV1b) and Cryphonectria cubensis mitovirus 2a (CMV2a) had little or no obvious effect on the colony morphology and virulence of Cryphonectria cubensis (Van Heerden, 2004). Although several previously reported mitoviruses were associated with hypovirulence on S. sclerotiorum, all reported hypovirulent strains were mixed infections by two or more mitoviruses, and which mitovirus was responsible for hypovirulence needs to be further researched. Here, we reported a hypovirulent strain HC025 of S. sclerotiorum

Z. Xu et al. / Virus Research 197 (2015) 127–136

that was infected by mitovirus SsMV1/HC025 alone, and confirmed that SsMV1/HC025 infection is closely related to hypovirulence and other biological traits of S. sclerotiorum. Thus, it is the first report that SsMV1/HC025 is a clear and definite mitovirus related to hypovirulence on S. sclerotiorum. Previously reported mitoviruses, which are associated with hypovirulence on fungal hosts, may be an alternative for the biocontrol of plant diseases. Previous studies showed that many mitoviruses were often transmitted to only one type of virus-free host strain, but in the present study, SsMV1/HC025 could be successfully transferred into two vegetatively incompatible virus-free strains of S. sclerotiorum, which suggested that SsMV1/HC025 has the potential to be exploited as a virocontrol agent for the management of Sclerotinia disease. It is well-known that mitochondria are extremely important organelles that generate energy for cellular activities. Previous studies have described the location of mitoviruses in their host mitochondria and caused ultrastructural mitochondrial malformations. For example, Thielaviopsis basicola mitovirus (TbMV) was related to smaller and fewer mitochondria formation in Chalara elegans (Park et al., 2006), and BcMV1 infected strain of B. cinerea has malformed mitochondria containing fibrous matrix materials and disintegrated cristae (Wu et al., 2010). Thereby, the altered mitochondria by mitoviruses may account for hypovirulence of fungal hosts. Similarly, our results showed that the virus-free strains contained abundant and normal mitochondria, while some mitochondria in the SsMV1/HC025-infected strains became swollen and had fibrous matrix materials and a few cristae remnants. Acknowledgments The research was financially supported by China National Funds for Distinguished Young Scientists (31125023), the Program for Changjiang Scholars and Innovative Research Team in University of China (IRT1247), the Key Project of the Chinese Ministry of Education (313024), and the Fundamental Research Funds for the Central Universities (2011QC039). We thank Dr. Huiquan Liu (College of Plant Protection, Northwest A&F University) for helping on phylogenetic analysis and Xiangnan Guan (Department of molecular genetics, Ohio state university) for helpful suggestions in editing the revised manuscript. We also wish to thank the reviewers for valuable comments. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.virusres. 2014.12.023. References Abascal, F., Zardoya, R., Posada, D., 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21 (9), 2104–2105. Boland, G.J., Mould, M.J.R., Robb, J., 1993. Ultrastructure of a hypovirulent isolate of Sclerotinia selerotiorum containing double-stranded dsRNA. Physiol. Mol. Plant Pathol. 43, 21–32. Bolton, M.D., Thomma, B.P.H.J., Nelson, B.D., 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Mol. Plant Pathol. 7, 1–16. Buck, K.W., 1996. Comparison of the replication of positive-stranded RNA viruses of plants and animals. Adv. Virus Res. 47, 159–251. Buck, K.W., Brasier, C.M., 2002. Viruses of the Dutch elm disease fungus. In: Tavantzis, S.M. (Ed.), dsRNA Genetic Elements: Concepts and Applications in Agriculture, Forestry and Medicine. CRC Press LCC, FL, USA, pp. 165–190. Chiba, S., Kondo, H., Tani, A., Saisho, D., Sakamoto, W., Kanematsu, S., Suzuki, N., 2011. Widespread endogenization of genome sequences of non-retroviral RNA viruses into plant genomes. PLoS Pathog. 7, 1–16. Cole, T.E., Mcller, B.M., Hong, Y., Brasier, C.M., Buck, K.W., 1998. Complexity of viruslike double-stranded RNA elements in a diseased isolate of the Dutch elm disease fungus, Ophiostoma novo-ulmi. J. Phytopathol. 146, 593–598.

135

Darissa, O., Willingmann, P., Adam, G., 2010. Optimized approaches for the sequence determination of double-stranded RNA templates. J. Virol. Methods 169 (2), 397–403. Deng, F., Boland, G.J., 2006. Attenuation of virulence in Sclerotinia homoeocarpa during storage is associated with latent infection by Ophiostoma mitovirus 3a. Eur. J. Plant Pathol. 114, 127–137. Doherty, M., Coutt, R.H.A., Brasier, C.M., Buck, K.W., 2006. Sequence of RNAdependent RNA polymerase genes provides evidence for three more distinct mitoviruses in Ophiostoma novo-ulmi isolate Ld. Virus Genes 33 (1), 41–44. Dolja, V.V., Koonin, E.V., 2012. Capsid-Less RNA viruses. In: eLS. John Wiley & Sons, Ltd., Chichester, http://dx.doi.org/10.1002/9780470015902.a0023269. Ghabrial, S.A., Suzuki, N., 2009. Viruses of plant pathogenic fungi. Annu. Rev. Phytopathol. 47, 353–384. Goremykin, V.V., Salamini, F., Velasco, R., Viola, R., 2009. Mitochondrial DNA of Vitis vinifera and the issue of rampant horizontal gene transfer. Mol. Biol. Evol. 26 (1), 99–110. Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59 (3), 307–321. Hillman, B.I., Cai, G., 2013. Chapter six-the family Narnaviridae: simplest of RNA viruses. Adv. Virus Res. 86, 149–176. Hillman, B.I., Esteban, R., 2011. Narnaviridae. In: King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier, San Diego, pp. 1055–1060. Hintz, W.E., Carneiro, J.S., Kassatenko, I., Varga, A., James, D., 2013. Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi (93-1224). Virol. J. 10, 252. Hong, Y., Cole, T.E., Brasier, C.M., Buck, K.W., 1998. Evolutionary relationships among putative RNA-dependent RNA polymerases encoded by a mitochondrial viruslike RNA in the Dutch elm disease fungus, Ophiostoma novo-ulmi, by other viruses and virus-like RNAs and by the Arabidopsis mitochondrial genome. Virology 246 (1), 158–169. Hong, Y., Dover, S.L., Cole, T.E., Brasier, C.M., Buck, K.W., 1999. Multiple mitochondrial viruses in an isolate of the Dutch elm disease fungus Ophiostoma novo-ulmi. Virology 258, 118–127. Hu, Z., Wu, S., Cheng, J., Fu, Y., Jiang, D., Xie, J., 2014. Molecular characterization of two positive-strand RNA viruses co-infecting a hypovirulent strain of Sclerotinia sclerotiorum. Virology 464–465, 450–459. Jiang, D., Fu, Y., Li, G., Ghabrial, S.A., 2013. Viruses of the plant pathogenic fungus Sclerotinia sclerotiorum. Adv. Virus Res. 86, 215–248. Khalifa, M.E., Pearson, M.N., 2013. Molecular characterization of three mitoviruses co-infecting a hypovirulent isolate of Sclerotinia sclerotiorum fungus. Virology 441, 22–30. Khalifa, M.E., Pearson, M.N., 2014. Molecular characterisation of novel mitoviruses associated with Sclerotinia sclerotiorum. Arch. Virol. 159, 3157–3160. Koonin, E.V., 2010. Taming of the shrewd: novel eukaryotic genes from RNA viruses. BMC Biol. 8, 2. Lakshman, D.K., Tavantzis, S.M., 1994. Spontaneous appearance of genetically distinct double-stranded RNA elements in Rhizoctonia solani. Phytopathology 84, 633–639. Liu, H., Fu, Y., Li, B., Yu, X., Xie, J., Cheng, J., Ghabrial, S.A., Li, G., Yi, X., Jiang, D., 2011. Widespread horizontal gene transfer from circular single-stranded DNA viruses to eukaryotic genomes. BMC Evol. Biol. 11, 1–15. Liu, H., Fu, Y., Jiang, D., Li, G., Xie, J., Cheng, J., Peng, Y., Ghabrial, S.A., Yi, X., 2010. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes. J. Virol. 84, 11876–11887. Marienfeld, J.R., Unseld, M., Brandt, P., Brennicke, A., 1997. Viral nucleic acid sequence transfer between fungi and plants. Trends Genet. 13, 260–261. Martínez-Álvarez, P., Vainio, E.J., Botella, L., Hantula, J., Diez, J.J., 2014. Three mitovirus strains infecting a single isolate of Fusarium circinatum are the first putative members of the family Narnaviridae detected in a fungus of the genus Fusarium. Arch. Virol. 159 (8), 2153–2155. Monier, A., Pagarete, A., de Vargas, C., Allen, M.J., Read, B., Claverie, J.M., Ogata, H., 2009. Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus. Genome Res. 19, 1441–1449. Moreira, D., López-García, P., 2009. Ten reasons to exclude viruses from the tree of life. Nat. Rev. Microbiol. 7, 306–311. Nuss, D.L., 2005. Hypovirulence: mycoviruses at the fungal-plant interface. Nat. Rev. Microbiol. 3 (8), 632–642. Paquin, B., Laforest, M.J., Forget, L., Roewer, I., Wang, Z., Longcore, J., Lang, B.F., 1997. The fungal mitochondrial genome project: evolution of fungal mitochondrial genomes and their gene expression. Curr. Genet. 31, 380–395. Park, Y., Chen, X., Punja, Z.K., 2006. Molecular and biological characterization of a mitovirus in Chalara elegans (Thielaviopsis basicola). Phytopathology 96, 468–479. Pearson, M.N., Beever, R.E., Boine, B., Arthur, K., 2009. Mycoviruses of filamentous fungi and their relevance to plant pathology. Mol. Plant Pathol. 10, 115–128. Polashock, J.J., Hillman, B.I., 1994. A small mitochondrial double-stranded (ds) RNA element associated with a hypovirulent strain of the chestnut blight fungus and ancestrally related to yeast cytoplasmic T and W dsRNAs. Proc. Natl. Acad. Sci. 91, 8680–8684. Potgieter, A.C., Page, N.A., Liebenberg, J., Wright, I.M., Landt, O., van Dijk, A.A., 2009. Improved strategies for sequence-independent amplification and sequencing of viral double-stranded RNA genomes. J. Gen. Virol. 90, 1423–1432.

136

Z. Xu et al. / Virus Research 197 (2015) 127–136

Reuter, J.S., Mathews, D.H., 2010. RNA structure: software for RNA secondary structure prediction and analysis. BMC Bioinform. 11, 129. Shackelton, L.A., Holmes, E.C., 2008. The role of alternative genetic codes in viral evolution and emergence. J. Theor. Biol. 254 (1), 128–134. Van Heerden, S.W., (Ph.D. thesis) 2004. Studies on Cryphonectria cubensis in South Africa with Special Reference to Mycovirus Infection. University of Pretoria, Pretoria, South Africa. Wu, M., Zhang, L., Jiang, D., Hou, M., Huang, H.C., 2007. Hypovirulence and double stranded RNA in Botrytis cinerea. Phytopathology 97, 1590–1599. Wu, M., Zhang, L., Li, G., Jiang, D., Ghabrial, S.A., 2010. Genome characterization of a debilitation-associated mitovirus infecting the phytopathogenic fungus Botrytis cinerea. Virology 406 (1), 117–126. Xiao, X., Cheng, J., Tang, J., Fu, Y., Jiang, D., Baker, T.S., Ghabrial, S.A., Xie, J., 2014. A novel partitivirus that confers hypovirulence on plant pathogenic fungi. J. Virol. 88 (17), 10120–10233. Xie, J., Ghabrial, S.A., 2012. Molecular characterizations of two mitoviruses coinfecting a hypovirulent isolate of the plant pathogenic fungus Sclerotinia sclerotiorum. Virology 428 (2), 77–85.

Xie, J., Jiang, D., 2014. New insights into mycoviruses and exploration for the biological control of crop fungal diseases. Annu. Rev. Phytopathol. 52, 45–68. Xie, J., Wei, D., Jiang, D., Fu, Y., Li, G., Ghabrial, S.A., Peng, Y., 2006. Characterization of debilitation-associated mycovirus infecting the plant-pathogenic fungus Sclerotinia sclerotiorum. J. Gen. Virol. 87 (1), 241–249. Xie, J., Xiao, X., Fu, Y., Liu, H., Cheng, J., Ghabrial, S.A., Li, G., Jiang, D., 2011. A novel mycovirus closely related to hypoviruses that infects the plant pathogenic fungus Sclerotinia sclerotiorum. Virology 418 (1), 49–56. Yu, X., Li, B., Fu, Y., Xie, J., Cheng, J., Ghabrial, S.A., Li, G., Yi, X., Jiang, D., 2013. Extracellular transmission of a DNA mycovirus and its use as a natural fungicide. Proc. Nat. Acad. Sci. 110 (4), 1452–1457. Zhang, L., Fu, Y., Xie, J., Jiang, D., Li, G., Yi, X., 2009. A novel virus that infecting hypovirulent strain XG36-1 of plant fungal pathogen Sclerotinia sclerotiorum. Virol. J. 6 (96), 1–9.