Fish & Shellfish Immunology 45 (2015) 656e665
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
A manganese superoxide dismutase (MnSOD) from ark shell, Scapharca broughtonii: Molecular characterization, expression and immune activity analysis Libing Zheng a, b, Biao Wu a, *, Zhihong Liu a, Jiteng Tian a, Tao Yu c, Liqing Zhou a, Xiujun Sun a, Aiguo Yang a a
Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, Shandong, PR China College of Fisheries and Life Science, Shanghai Ocean University, 999 Huchenghuan Road, Pudong New District, Shanghai 201306, PR China c Changdao Enhancement and Experiment Station, Chinese Academy of Fishery Sciences, 1 Haibin Road, Changdao 265800, Shandong, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 January 2015 Received in revised form 28 April 2015 Accepted 4 May 2015 Available online 15 May 2015
Manganese superoxide dismutase (MnSOD) is one of the key members of the antioxidant defense enzyme family, however, data regarding to the immune function of MnSOD in mollusks still remain limited now. In this study, a full-length MnSOD cDNA was identified by rapid amplification of cDNA ends (RACE) method from cDNA library of ark shell Scapharca broughtonii (termed SbMnSOD). The cDNA contained an open reading frame (ORF) of 696 bp which encoded a polypeptide of 232 amino acids, a 50 UTR with length of 32 bp and a 30 -UTR of 275 bp. Four putative amino acid residues (His-57, His-105, Asp190 and His-194) responsible for manganese coordination were located in the most highly conserved regions of SbMnSOD and the signature sequence (DVWEHAYY) also existed in SbMnSOD. The deduced amino acid sequence of SbMnSOD shared high homology to MnSOD from other species. All those data revealed that the SbMnSOD was a novel member of the MnSOD family. The mRNA expression profiles of SbMnSOD in tissues of foot, gill, mantle, adductor muscle, hemocytes and hepatopancreas analyzed by quantitative real-time PCR (qRT-PCR) suggested the mRNA transcripts of SbMnSOD distributed in all the examined tissues. Importantly, Vibrio anguillarum challenge resulted in the increased expression of SbMnSOD mRNA with a regular change trend in all examined tissues, indicating SbMnSOD actively participated in the immune response process. What's more, further analysis on the antibacterial activity of the recombinant SbMnSOD showed that the fusion protein could remarkably inhibit growth of both Gram-positive and Gram-negative bacteria. The present results clearly suggested that SbMnSOD was an acute phase protein involved in the immune reaction in S. broughtonii. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Scapharca broughtonii MnSOD Gene expression Antibacterial activity Enzyme activity
1. Introduction During normal cell metabolism, especially under the condition of pathogeny or environmental stress, the living organisms will produce and accumulate reactive oxygen species (ROS), such as superoxide anion (O2.), hydroxyl radical ($OH), which can be harmful to the membrane lipids, DNA and some enzymes. To prevent the oxidative damage, organisms can clean the redundant ROS by initiating a complex antioxidant system. The superoxide dismutase (SOD) is a sort of important metalloenzyme to clear the ROS
* Corresponding author. Tel.: þ86 532 85811982. E-mail addresses: [email protected], [email protected] (B. Wu). http://dx.doi.org/10.1016/j.fsi.2015.05.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
in the organisms by catalyzing ROS to form harmless molecular oxygen and hydrogen peroxide [10,27], and it can enhance phagocyte defense capacity and immune function [36]. So far, several types of SOD have been identified according to the metal cofactors and three predominant types, Mn-SOD, Fe-SOD, and Cu/ZnSOD, were mostly reported in many species [1,3,18,35]. Among those SODs, manganese superoxide dismutase (MnSOD), primarily found in prokaryotes and eukaryotic mitochondrion, played an important role in eliminating toxicity of ROS, and has been found to be involved in immune response induced by bacteria [4,15], virus infection [37] and toxic chemical exposure [19], and so on. It was found that the salt tolerance, radiation proof and cold resistance of SOD-deficient Escherichia coli had been apparently improved after being transfected recombinant MnSOD gene [6]. In
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
addition, the mice would die of myocardial infarction and neurotrophy in several days once the MnSOD gene was knocked out [12,22]. Due to the importance of MnSOD, many other studies on MnSOD have also been carried out [7,16,24]. Mollusks mainly rely on the innate immune system to protect them against invaders due to the lack of the adaptive immune system. In addition, the water where mollusks dwell in is generally an open environment containing various pathogens and hazardous substance, which may cause much immune response to generate much oxygen free radical [25]. Therefore, as effective materials for degrading ROS, SODs are very important in the mollusks immune process. Up to date, MnSODs were identified and cloned in several mollusks such as Tegillarca granosa (ADC34695), Argopecten irradians (ACU00737), Patinopecten yesoensis (AHX22598.1), Azumapecten farreri (AFN29183.1) and so on. The ark shell, Scapharca broughtonii, belonging to Mollusca, Bivalve, Arcoida, is an important marine economic bivalve. In the recent years, it has become one of the most popular farming mollusks in North China due to its high economic value. To our knowledge, despite many studies on MnSOD in mollusks have been carried out, the data about the gene characteristics and protein activity of MnSOD from S. broughtonii are still lacking until now. Herein, the main objectives of the present study were to: 1) clone the gene of MnSOD from S. broughtonii (denoted as SbMnSOD); 2) investigate the tissues expression profiles of SbMnSOD and the dynamic change after challenged by Vibrio anguillarum; 3) express, purify the fusion protein SbMnSOD and test its antibacterial activity; 5) obtain the optimal temperature and pH of recombinant SbMnSOD for high enzymatic activity. 2. Materials and methods 2.1. Animals, bacterial challenge and tissues collection The healthy ark shells S. broughtonii, averaging 55 mm in shell length, were collected from Nanshan aquatic product market (Qingdao, Shandong Province, China), and acclimatized in aerated seawater at 20 C for a week before processing. For the bacterial challenge experiment, ark shells were randomly divided into challenge and control groups. The bacterial challenge group was treated by injecting with 50 ml of Gramnegative bacterium V. anguillarum suspended in PBS (OD600 ¼ 0.4, 1 OD ¼ 5 108 bacteria/ml, pH ¼ 7.4) into the adductor muscle, while the control group was injected with 50 ml PBS (pH ¼ 7.4, 0.1 mM) instead. All processed ark shells were then returned to the initial seawater. Six tissues (foot, mantle, gill, adductor muscle, hemocytes and hepatopancreas) of three random individuals in each group were sampled at 0, 4, 8, 12, 24, 32 and 64 h after injection for total RNA isolation, respectively. All tissues were dissected to liquid nitrogen and then stored at 80 C until used. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from the six tissues (as mentioned above) using Guanidine Thiocyanate methods described as Dong [8] with slight modification. Briefly, samples were dissociated in solution D (4 M Guanidine Thiocyanate, 17 mM Sodium lauroyl inosine acid and 25 mM sodium citrate) and b-mercaptoethanol, then extracted by Chloroform/Isoamyl alcohol (24:1) and Phenol water to eliminate proteins, precipitated with Isopropyl alcohol and sodium acetate and successively washed by 75% ethanol. RNaseFree DNase I (Promega) was added into the extracted RNA to eliminate genome DNA contamination according to the manufacturer's instruction. The quality, purity and integrity of RNA were tested by spectrophotometer (A260/A280) and agarose gel
657
electrophoresis. First-strand cDNA was synthesized using SMARTer™ RACE Amplification Kit (TaKaRa) according to the protocol of the manufacturer. 2.3. Cloning of MnSOD cDNA To obtain the full-length cDNA of MnSOD, the primers Sb5R and Sb3F (Table 1) were designed by primer premier 5.0 based on the known sequence in the transcriptome library for the rapid amplification ends (RACE). The RACE experiments were carried out using SMARTer™ RACE Amplification Kit (TaKaRa) according to the manufacturer's instructions. The RACE was performed in a 50 ml of reaction volume, containing 30 or 50 -RACE cDNA 2.5 ml, PCR-Grade water 34.5 ml, 10 advantage two PCR buffer 5.0 ml, dNTP Mix (10 mM) 1.0 ml, UPM 5.0 ml, Sb3F or Sb5R (10 mM) 1.0 ml. The PCR was taken out as following: 3 min at 94 C, 30 cycles of 94 C for 30 s, 68 C for 30 s, and 72 C for 2 min. All the amplified target products were gel-purified (Clontech) and then cloned into pMD18-T simple vector (TaKaRa) according to the provided instruction. The vectors were transformed into the competent E. coli Top10 cells, and after that, recombinants were identified by resistance selection in Kanamycin-containing LB plates. The single clones were picked for sequencing, and then the sequences amplified correctly were assembled with the known sequence by SeqMan to yield the full-length cDNA of MnSOD in S. broughtonii. 2.4. Sequence analysis The open reading frame (ORF) and amino acid sequence were inferred from SbMnSOD cDNA using the software DNAStar 7.0 and the protein motif feature was predicted by Simple Modular Architecture Research Tool (http://smart.embl-heidelberg.de/). The homologs were analyzed by the Blastp program available on the website of National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/blast). Multiple alignments of SbMnSOD were performed using the software DNAMan 8.0. A phylogenetic tree was constructed using the Neighbor-Joining method by Mega 5.0 based on the putative amino acid sequence and the tree topology was tested using bootstrap of 1000 replications. The prediction of glycosylation site was deduced by NetNglyc 1.0. 2.5. Tissue-specific expression of SbMnSOD mRNA The expression of SbMnSOD in different tissues and its dynamic changes after V. anguillarum challenge were determined by quantitative Real-time PCR (qRT-PCR) performed at an ABI PCR machine (Applied Biosystems 7500). A pair of specific primers (Q-F/Q-R in Table 1) was designed by primer premier 5.0 to amplify a certain product from cDNA, and b-actin gene of ark shell was used as an internal control [21]. The templates of cDNA were synthesized from the total RNAs from six tissues (as mentioned above) using PrimerScript™ RT reagent kit (TaKaRa) with Oligo (dT) and random 6 mers primers following the manufacturer's protocol, and the quality was detected by b-actin gene. The qRT-PCR amplifications were performed in a 20 ml reaction volume, containing 10 ml SYBR Premix Ex Taq_II (2) (TaKaRa), 0.4 ml ROX Reference Dye II (50), 0.4 ml of each primer (10 mM), 2.0 ml of 1:5 diluted cDNA, and 7.2 ml of PCR-grade water. The qRT-PCR profile was 95 C for 2 min followed by 38 cycles at 95 C for 5 s, 60 C for 34 s. The analysis of dissociation curves after thermocycling was performed to confirm the amplification specificity of SbMnSOD and b-actin. The expression level of the SbMnSOD relative to the b-actin gene was quantified by the 2DDCt method [26]. Reaction of each sample was carried out in triplicates and all the data were given in terms of
658
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665 Table 1 The primers used in this study. Primers
Sequence (50 e30 )
10 Universal Primer A Mix (UPM) Sb3F Sb5R b-actin-F b-actin-R Q-F Q-R P-F P-R T7-F T7-R
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT0 CTAATACGACTCACTATAGGGC CCTGAGTCCAAACGGCGGAGGCGAG TCCTAACCATCCCCATCCAGAACCC GGTTACACTTTCACCACCACAG ACCGGAAGTTTCCATACCTAAGA GATGGGGATGGTTAGGA CAGGACGCACATTCTTG CCGGAATTCATGCTGTCTGCA CCGCTCGAGTGAAGCCTGTTT TAATACGACTCACTATAGGG GCTAGTTATTGCTCAGCGG
relative mRNA expressed level as means ± SD (standard deviation of the means). The blank sample with minimal DCт value was used as the calibrator. Differences were considered significant at p < 0.05, highly significant at p < 0.01. 2.6. Construction of expression vector and expression of recombinant SbMnSOD Specific primers P-F and P-R (Table 1) for amplifying the ORF of SbMnSOD were designed by primer premier 5.0. EcoR I and Xho I sites (underlined) were introduced into the primers, respectively. The PCR profile was performed and products were sub-cloned into pEASY-T1 cloning vector and then transformed into Trans 5a Chemically Competent Cells (TransGen Biotech). The plasmids containing target fragments were extracted from Competent Cells and then digested with enzymes EcoR I and Xho I (TaKaRa), and so did expression vector pET-28a (þ) (Novagen). The digested PCR products were then sub-cloned into the pET-28a (þ), and then recombinant plasmids pET-28a (þ)-SbMnSOD were transformed into the host Competent Cells E. coli BL21 (DE3). The recombinant strains were coated on a LuriaeBertani agar plate containing 100 mg/ml of kanamycin, and incubated overnight at 37 C. Single bacterial colonies were picked for sequencing with T7 promoter and T7 terminator primers (Table 1) in BGI Company to confirm the correctness of the inserted fragment. The bacterial colony with right sequences was chosen to be cultured in LB broth containing 100 mg/ml kanamycin at 37 C until culture medium reached OD600 value of 0.6e0.7. 1 mM isopropyl b-D-thiogalacto-pyranoside (IPTG) was added to induce the recombinant protein expression. The culture was kept at 37 C for 3 h at 200 rpm, and then the bacterial cells were collected by centrifuging at 5000g for 10 min, resuspended in PBS, tested by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSePAGE). 2.7. Purification and refolding of recombinant protein The purification and refolding of recombinant protein were performed as described previously by Refs. [32,30]; respectively. After induction, the E. coli cells were harvested by centrifuging at 4 C. The bacterium was successively washed twice, and suspended with inclusion body solution buffer (25 mM TriseHCl, 50 mM NaCl, 5 mM EDTA, 0.3 mg/ml lysozyme, 2%Triton-X, pH 7.5), sonicated on ice with ultrasonic cell disruptor and then centrifuged. The precipitate was washed twice with the inclusion body purgation buffer (50 mM TriseHCl, 100 mM NaCl, 2 M urea, 1.0% Triton X-100, and 0.5 mM EDTA; pH 8.0), the purified inclusion bodies were finally obtained. After dissolution overnight of inclusion bodies in a solution containing 100 mM TriseHCl, 500 mM NaCl, 8 M urea, 10 mM imidazole, pH 7.4, they were concentrated using a Millipore ultrafiltration tube to collect the final supernatant.
The recombinant protein was purified based on its His-tag by using a Ni2þ-NTA column. 3-fold column volume of binding buffer was added to balance pH value, then the supernatant was added to the column and flowed at a flow rate of 1.0 ml/min. Subsequently, the column was successively washed with binding buffer and wash buffer (100 mM TriseHCl, 500 mM NaCl, 20 mM imidazole, 8 M urea, pH 7.4). Finally, the bound protein was eluted using Elution buffer (100 mM Tris, 500 mM NaCl, 250 mM imidazole, 8 M urea, pH 7.4) and collected into 1.5 ml centrifuge tubes. The purified protein was diluted with elution buffer and transferred into a pretreated dialysis bag, and refolded by dialyzing successively with PBS containing 6 M urea, 5 mM DTT and 1 mM EDTA (pH 7.4), for 12 h; PBS containing 4 M urea, 0.2 mM GSSG, 2 mM GSH and 1 mM EDTA (pH 7.4) for 12 h; PBS containing 2 M urea, 0.5 mM GSSG, 1 mM GSH, 1 mM EDTA and 5% glycerol (pH 7.4) for 12 h and PBS containing 1 mM GSSG, 1 mM GSH, 1 mM EDTA and 5% glycerol (pH 7.4), for 12 h; and PBS (pH 7.4) for 12 h at 4 C. During all the dialysis process, the liquid was slowly stirred with a magnetic stirrer in the refrigerator. The final protein solution was centrifuged and the supernatant was really refolded protein. The protein was electrophoresed with 15% SDSePAGE, following stained with Coomassie brilliant blue R-250 and the concentration of purified protein was determined by the Bicinchoninic acid method using bovine serum albumin (BSA) as the standard. 2.8. Western blotting analysis The recombinant protein was boiled for 8 min, separated by 15% SDSePAGE gel, and then transferred to a PVDF (polyvinylidene fluoride) membrane by half dry transfer printing method for western blotting analysis. The membrane was successively incubated by the anti-His mouse monoclonal antibody (diluted 1:2000) and the goat anti-mouse IgG (H þ L) horseradish peroxidaseconjugated antibody (diluted 1:5000), which were used as the primary antibody and the secondary antibody in the process, respectively. The transformed stripe was dyed with HRB-DAB Kit (Thermo) according to the instruction. 2.9. Antibacterial activity of recombinant SbMnSOD The experiment was carried out as previously described by Wu et al. [31]. To test the antibacterial activity of recombinant protein, Gram-negative bacterium E. coli and Gram-positive bacteria Staphylococcus aureus, Micrococcus leteus were employed in this experiment. These bacteria at logarithmic-phase were collected by centrifuging at 5000g for 10 min, suspended with PBS, and the concentration was adjusted to 2 107 cells/ml. The recombinant protein SbMnSOD was gradient diluted to 100 mg/ml and 50 mg/ml, respectively. Then 300 ml bacteria solution and 300 ml diluted recombinant SbMnSOD were mixed thoroughly and subsequently
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
divided into three duplicates, 200 ml mixture in each well of Elisa Plate, and incubated at 37 C for 12 h to read absorbance value at 630 nm every hour, while PBS replaced protein liquid as control. 2.10. Analysis of thermostability of recombinant SbMnSOD In order to test the effect of temperature on enzyme activity of recombinant SbMnSOD, the thermostability experiment was carried out. The assay was conducted as described by Bao et al. [2] with slight modification. Briefly, 30 ml (242 mg/ml) purified recombinant protein was mixed with 30 ml PBS (0.1 mM, pH 7.4), and placed in condition of different temperature gradient which ranged from 10 C to 90 C with a gap of 10 C for 15 min, respectively. The protein was replaced by ddH2O as the blank control group. The enzyme activity was tested using T-SOD kit (Nanjing Jiancheng) by reading the absorbance value at 630 nm of each plate well. There were three duplicates in each group. The enzyme activity of the group with the largest enzyme activity was set as the 100%, and enzyme activity of other groups was the percentage accounting in the largest enzyme activity. 2.11. pH stability of recombinant enzyme SbMnSOD The enzyme activity of rSbMnSOD under different pH conditions was tested in the study. The assay was conducted as described by Bao et al. Ref. [2] with slight modification. The pH buffers with a concentration of 0.2 M Citric Acidesodium citrate (pH 2.2 and 3.0), NaAceHAc (pH 3.9 and 5.0), TriseHCl (pH 7.4 and 9.0), glycineeNaOH (pH 10.0 and 12.0) were prepared, respectively. 30 ml (242 mg/ml) purified protein was mixed adequately with 30 ml different pH values buffer, respectively, and then incubated for 70 min at 25 C. After incubation treatment, the mixtures were immediately transferred to ice and successively the enzyme activity was measured as the method described above. The recombinant protein was replaced by ddH2O in each group as the control. 3. Results 3.1. Characteristics of SbMnSOD cDNA sequence The full length cDNA of SbMnSOD was firstly cloned by RT-PCR and RACE method (GenBank Accession No. KP280005). The assembled cDNA was 1003 bp in length, containing a 50 -untranslated region (UTR) of 32 bp, a 30 -UTR of 275 bp, and an ORF of 696 bp which encoded 232 amino acids. The predicted protein molecular weight (Mw) was 25.67 kDa and the estimated theoretical isoelectric point (pI) was 7.13. Four putative amino acid residues (His-57, His-105, Asp-190 and His-194) responsible for manganese coordination were located in the most highly conserved regions in SbMnSOD. And the signature sequence (DVWEHAYY) also existed. SignalP analysis indicated that there was a signal peptide at the N-terminal of deduced amino acid, and three glycosylation sites were located at the position of 104 (NHST), 144 (NATV) and 160 (NPTS), respectively. All those are shown in Fig. 1.
659
Crassostrea gigas (ABZ90958) (66%), respectively; In addition to those mollusks, the SbMnSOD protein also shared high identity with other species as Callinectes sapidus, Charybdis feriata, Danio rerio and Mus musculus, and so on. In short, the deduced amino acid of SbMnSOD owned high conserved sequences with those from other species (Fig. 2). The phylogenetic tree constructed using the amino acid sequences of MnSOD from 19 representative species showed that this phylogenetic tree had two large clusters (Fig. 3). All the selected MnSOD from mollusks clustered together, while S. broughtonii had the closest relationship with T. granosa. SbMnSOD clustered together firstly with that of T. granosa, and then clustered with those from bivalve and gastropods, which formed the sister cluster with the MnSOD from vertebrates, which indicated the MnSOD cluster was mainly in accordance with the traditional classification. 3.3. SbMnSOD expression in different tissues The relative expression values of SbMnSOD/b-actin in hepatopancreas were considered as the reference group. The expression profile of SbMnSOD in different tissues of normal individuals is shown in Fig. 4. From this figure, it can be seen that the SbMnSOD gene expressed in all examined tissues as hemocytes, foot, gill, mantle, adductor muscle and hepatopancreas, and the expression levels were different among those tissues. The expression of SbMnSOD gene in hemocytes was the highest with 424.29-fold comparing to the control, followed by foot, gill, mantle and adductor muscle. 3.4. Expression of the SbMnSOD transcript after bacterial challenge The dynamic changes of the SbMnSOD transcript in examined tissues of S. broughtonii after V. anguillarum challenge are shown in Fig. 5. As shown in the figure, the response of SbMnSOD gene in all tested tissues to bacterial challenge had similar variation tendency, which showed remarkable up-regulation to the peak and then declined to the normal level. However, the expression profile in different tissues showed different degree lags of time. During the 16 h post-challenge, the expression level went up gradually and reached the peak in hemocytes, gill, foot, and mantle, and the relative transcription level of the SbMnSOD in these four tissues increased 4.97, 2.81, 4.63 and 3.90-fold, respectively. And the peaking time was of high asynchrony, the earliest one was at 8 h after injection in the adductor muscle (7.52-fold) while the last one was 24 h in hepatopancreas (3.79-fold). After reaching the peak, the relative expression level fell down, however, there was a second expression peak in adductor muscle and hemocytes at 32 h after challenge, with the expression values were 3.59-fold (p < 0.05), 2.99-fold (p < 0.05), respectively. Generally, SbMnSOD mRNA expression level fell back to initial level in all tissues after 64 h. These data showed that bacterial challenge caused a significant change in SbMnSOD expression, indicating an involvement of SbMnSOD in the acute phase response in S. broughtonii.
3.2. Homology and phylogenetic analysis of SbMnSOD
3.5. Expression, purification and validation of recombinant SbMnSOD
The homology analysis performed using Blastp program in NCBI indicated that deduced amino acid sequence of SbMnSOD shared relatively high similarity with MnSOD proteins from other species. The highest identity was shared with T. granosa (ADC34695) to 91%, and followed by other mollusks as A. irradians (ACU00737) (76%), P. yesoensis (AHX22598.1) (74%), A. farreri (AFN29183.1) (73%), Ruditapes philippinarum (AFN29183.1) (68%), Haliotis discus hannai (ABF67504) (68%), Crassostrea hongkongensis (AFN29183) (66%),
The recombinant expression vectors including pET-28a (þ)-SbMnSOD were constructed and transformed into the E. coli BL21 (DE3). The rSbMnSOD was purified through the Ni-NTA resin column after 1.0 mM IPTG induction for 3 h. The SDSePAGE analysis indicated that there was an apparent protein band with the molecular weight of about 30 kDa compared to the control without induction, and the band well matched the expected size of rSbMnSOD. Further analysis by western-blotting showed that the
660
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 1. Nucleotide sequence and deduced amino acid sequence of MnSOD from S. broughtonii (SbMnSOD). The start codon (ATG) and stop codon (TAG) are boxed. The polyadenylation signal sequence (ATTAAA) and the poly (A) tail are underlined with the wave line, respectively. The signal peptide is shaded. The signature sequence DVWEAYY is marked with dotted line. Four putative amino acid residues responsible for manganese coordination are showed by bold red color. The glycosylation sites are underlined. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Multiple alignment of the amino acid sequence of the SbMnSOD with those from other animals: T. granosa (ADC34695), A. farreri (AFN29183), M. yessoensis (BAE78580), H. discus hannai (ABF67504), A. irradians (ACU00737), C. gigas (ABZ90958), M. rosenbergii (ABU55005), Salmo salar (ACN12619), D. rerio (NP_956270), H. sapiens (AAP34410). MnSOD signature sequence (DVWEHAYY) is marked by frame and the amino acids responsible for combination with the metal are marked by triangle.
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
661
Fig. 3. The phylogenetic tree constructed by MEGA 5.0 software using the amino acid sequences of MnSOD proteins from representative species. C. sapidus (AF264029_1), Litopenaeus vannamei (ABC59527), Marsupenaeus japonicus (BAB85211), A. farreri (AFN29183), D. rerio (NP_956270), M. yessoensis (BAE78580), H. discus discus (ABF67504), A. irradians (ACU00737), C. gigas (ABZ90958), M. rosenbergii (AAY79405), S. salar (ACN12619), D. rerio (NP_956270), H. sapiens (AAP34410), Xenopus laevis (NP_001083968), M. musculus (NP_038699), Gallus gallus (AF329270_1), C. feriata (AAD01640), T. granosa (ADC34695), Saccharomyces cerevisiae (NC_001142.9). The numbers on each branch suggested the bootstrap values (%) for 1000 replications, the bars represent the distance.
expressed protein could interact with anti-His tag mouse monoclonal antibody. All the data indicated that the protein SbMnSOD was successfully expressed and purified (Fig. 6). 3.6. Antibacterial activity of recombinant SbMnSOD As shown in Fig. 7, the growth curves of Gram-negative bacterium E. coli and the Gram-positive bacteria S. aureus and M. leteus incubated with rSbMnSOD appeared similar variation tendency. Compared to the PBS groups, the growth of all three strains bacteria in treated groups was limited by the recombinant protein. Within the 3e4 h, the three strains bacteria propagated rapidly, then kept in a mild trend in the following hours. This revealed that the rSbMnSOD showed a broad-spectrum antibacterial activity against both Gram-negative and Gram-positive bacteria. 3.7. Optimal temperature
Fig. 4. Expression profile of SbMnSOD in different tissues. The mRNA expression of SbMnSOD and b-actin was measured in six tissues and the relative expression values of SbMnSOD/b-actin in hepatopancreas were considered as the reference group. The relative expression level of SbMnSOD was determined by 2DDCt for each group and the results were shown as means ± SD (n ¼ 3). The columns with different letters indicated extremely significance (p < 0.01) between groups. F: Foot, G: Gill, M: Mantle, He: Hepatopancreas, A: Adductor muscle, Ha: Hemocytes.
The thermostability of refolded recombinant protein at different temperatures was tested. As shown in Fig. 8, the enzyme activity of recombinant SbMnSOD at 10 and 20 C was at a low level (35%), followed by a sharp increasing to a high level at 30 C, and the higher activity maintained from 30 C to 60 C, and the highest activity was 100% at 50 C, and then dropped immediately to 25% when the temperature reached 70 C. However, 9.6% enzyme
662
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 5. SbMnSOD mRNA expression after V. anguillarum challenge in six tissues. The mRNA expression of SbMnSOD and b-actin was detected at 0, 4, 8, 16, 24, 32 and 64 h in treatment and control groups following challenge, respectively. The relative SbMnSOD expression level as exhibited by 2DDCt was determined for each group and the values were shown as means ± SD (n ¼ 3). Two asterisks indicate highly significant differences (p < 0.01), one asterisk indicates significant differences (p < 0.05).
activity still available at 90 C. This suggested that the appropriate temperature to obtain optimal enzyme activity was ranged from 30 C to 60 C, which the enzyme activity kept over 93%. So the rSbMnSOD was heat-resistant. 3.8. Optimal pH The effect of pH on the enzyme activity of recombinant protein is shown in Fig. 9. As presented in this figure, the enzyme activity presented a downtrend manner along with the increasing of the pH values from 2.2 to 12, with the highest activity appeared at the pH value of 2 while the lowest at 12 (12.29%). All these data indicated that the purified recombinant SbMnSOD owned higher enzyme activity in the acidic condition than in alkaline condition. 4. Discussion SODs play an important role in antioxidant defense pathways during the response process [23,28,34]. Compared to other species,
the studies of SODs in aquatic organisms were still in the fledging period, especially in mollusks [9,11,15]. MnSOD was an important enzyme to prevent aquatic organism against diseases, so intensive studies on molecular mechanism and protein characteristic of MnSOD could be of great help for mollusk breeding. In recent years, more and more researches about the characterization of MnSOD and its roles in antioxidant or immune defense have been reported. Li et al. [20] cloned the MnSOD from blood calm T. granosa (TgMnSOD) which could be induced by heavy metal, and obtained its polyclonal antibodies. MnSOD gene from Pacific white shrimp Litopenaeus vannamei was also identified and its mRNA expression increased in hemocytes after infection with WSSV [13]. Those results revealed that MnSODs were involved in the immune reactions in invertebrates, especially when the organisms faced an excessive oxidative stress caused by the invasion of pathogen like bacteria and viruses. In the present study, a full-length cDNA of MnSOD was firstly identified and characterized from ark shell S. broughtonii. The deduced amino acids sequence had a signal peptide, which hinted
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
663
Fig. 8. The enzyme activity changes of recombinant protein SbMnSOD at different temperatures. The activity was test at nine temperature points ranged from 10 to 90 C with a gap of 10 C. Each point in the graph presents the mean ± SD (n ¼ 3). T: temperature.
Fig. 6. Expression and purification of the recombinant protein with Ni-NTA resin affinity chromatography. M: protein molecular standard (TransGen Biotech); Lane 1, total cellular extracts from E. coli BL21 containing recombinant plasmid before IPTG induction; Lane 2, IPTG-induced recombinant protein; Lane 3, the supernatant after ultrasonication; Lane 4, the inclusion body after ultrasonication; Lane 5, the purified recombinant fusion protein (about 30 kDa); Lane 6, western blotting of recombinant protein.
SbMnSOD obtained was likely located in mitochondrial matrix, and the SbMnSOD owned several common features including high conserved sequences and signature sequence DVWEHAYY. All those data indicated that the isolated cDNA was indeed coded for a canonical MnSOD from S. broughtonii. The SbMnSOD transcript had the wide-range distribution in the body, which was highly in agreement with MnSOD expression profile in other animals like T.
granosa [20], L. vannamei [13], M. rosenbergii [4], Hemibarbus mylodon [5], Hypophthalmichthys molitrix [38]. The upregulation of SbMnSOD transcripts with a similar trend in all the tested tissues showed an acute phase response in the bacterial challenge in S. broughtonii. It is of interest to note the immune role of SbMnSOD. Firstly, like other immune factors as Sb-BDef1 [21], PyVg [31]. To further study the properties of MnSOD protein, the recombinant SbMnSOD was expressed, purified and tested successively. The predicted molecular weight of recombinant SbMnSOD was calculated to be 25.67 kDa, which was highly closed to those protein of MnSODs from other organisms like M. rosenbergii [4], Fenneropenaeus chinensis [37]. The recombinant SbMnSOD could remarkably inhibit the growth of gram-negative E. coli and gram-positive S. aureus and M. leteus, which intuitively demonstrated the SbMnSOD was an immune-relevant molecule. Although previous studies have showed that Cu/ZnSOD from oyster C. gigas (Cg-EcSOD) possessed
Fig. 7. The growth curves of E. coli, S. aureus and M. leteus after incubating with different diluted concentration of recombinant protein SbMnSOD, respectively. The X and Y-axis represented time and absorbance values at 630 nm, respectively. Each point in the graph presents the mean ± SD (n ¼ 3).
664
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 9. The enzyme activity change of recombinant protein SbMnSOD in different pH conditions. The pH gradient ranged from 2.2 to 12, and the highest enzyme activity was set as 100% at pH 2.2. Each point in the graph presents the mean ± SD (n ¼ 3).
an LPS-binding motif found in the endotoxin receptor CD14 which displayed an affinity to E. coli and with LPS [14], the reports on antibacterial activity of SbMnSOD were limited. It is thus inferred that the anti-bacterial activation of SbMnSOD may rely on the conservative structure sites of SODs among different species. Despite further studies should be addressed for characterizing the antibacterial mechanism of MnSOD, we clearly demonstrated that the MnSOD from S. broughtonii was an immune-relevant molecule in this study. Previous studies suggested that the recombinant MnSODs possessed high enzyme activity under a wide range of temperature and pH condition, however, the optimum temperature and pH were slight different among species [9,17,33]. This study detected the optimum temperature range for high enzyme activity of SbMnSOD was from 30 C to 60 C, which was appropriate for MnSOD of H. discus discus and Laternula elliptica [9,29], while the optimum pH value range was from 2.2 to 3.0, which was lower than that of H. discus discus from 3.5 to 6.5 [9]. In conclusion, the MnSOD cDNA with length of 1003 bp including an ORF of 696 bp which encoded 232 aa was cloned from the S. broughtonii and the predicted protein showed common features with MnSODs of many other mollusks reported. In addition, this study highlights the immunocompetence of SbMnSOD via showing its response to the bacterial challenge and capacity of inhibiting bacterial growth. This is the first report on the MnSOD from S. broughtonii, opening a new insight into immune roles of SbMnSOD. Acknowledgments This study was supported by Natural Science Foundation of Shandong Province (No. ZR2013CQ047), National Infrastructure of Fishery Germplasm Resources Programme (2060503-01), and Science and Technology Development Program of Shandong Province (2014GHY115031). References [1] T. Amo, H. Atomi, T. Imanaka, Biochemical properties and regulated gene expression of the superoxide dismutase from the facultatively aerobic hyperthermophile Pyrobaculum calidifontis, J. Bacteriol. 185 (21) (2003) 6340e6347. [2] Y. Bao, L. Li, F. Xu, G. Zhang, Intracellular copper/zinc superoxide dismutase from bay scallop Argopecten irradians: its gene structure, mRNA expression and recombinant protein, Fish Shellfish Immunol. 27 (2) (2009) 210e220.
[3] C. Bowler, T. Alliotte, M. Van den Bulcke, G. Bauw, J. Vandekerckhove, M. Van Montagu, et al., A plant manganese superoxide dismutase is efficiently imported and correctly processed by yeast mitochondria, Proc. Natl. Acad. Sci. U. S. A. 86 (9) (1989) 3237e3241. [4] W. Cheng, Y.H. Tung, C.H. Liu, J.C. Chen, Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii, Fish Shellfish Immunol. 20 (4) (2006) 438e449. [5] Y.S. Cho, S.Y. Lee, I.C. Bang, D.S. Kim, Y.K. Nam, Genomic organization and mRNA expression of manganese superoxide dismutase (Mn-SOD) from Hemibarbus mylodon (Teleostei, Cypriniformes), Fish Shellfish Immunol. 27 (4) (2009) 571e576. [6] Ting-ting Deng, Jing Li, Geng Ma, et al., Identification of the function of superoxide dismutase gene from Dunaliella salina in SOD deleted strain K12, J. Sichuan Univ. 1 (44) (2007) 176e180. [7] C. Dong, G. Li, Z. Li, H. Zhu, M. Zhou, Z. Hu, Molecular cloning and expression analysis of an Mn-SOD gene from Nelumbo nucifera, Appl. Biochem. Biotechnol. 158 (3) (2009) 605e614. [8] Y.H. Dong, Transcriptome Analysis Using 454 Pyrosequencing and Cloning and Expression of Growth-related Genes for the Blood Clam T. granosa, Ocean University of China, Qingdao, 2012. [9] P.M. Ekanayake, H.S. Kang, M. De Zyosa, Y. Jee, Y.H. Lee, J. Lee, Molecular cloning and characterization of Mn-superoxide dismutase from disk abalone (Haliotis discus discus), Comp. Biochem. Physiol. B Biochem. Mol. Biol. 145 (3e4) (2006) 318e324. [10] I. Fridovich, Superoxide radical and superoxide dismutases, Annu. Rev. Biochem. 64 (1995) 97e112. [11] G.A. Gomez-Anduro, C.V. Barillas-Mury, A.B. Peregrino-Uriarte, L. Gupta, T. Gollas-Galvan, J. Hernandez-Lopez, et al., The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression, Dev. Comp. Immunol. 30 (10) (2006) 893e900. [12] R.M. Lebovitz, H. Zhang, H. Vogel, et al., Neurodegeneration, myocardial injury, and perinatal death in mitochondria superoxide dismutase-deficient mice, Med. Sci. 93 (1996) 9782e9787. mez-Anduro, C.V. Barillas-Mury, A.B. Peregrino-Uriarte, L. Gupta, [13] G.A. Go n, J. Herna ndez-Lo pez, G. Yepiz-Plascencia, et al., The cytosolic T. Gollas-Galva manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression, Dev. Comp. Immunol. 30 (10) (2006) 893e900. [14] M. Gonzalez, B. Romestand, J. Fievet, A. Huvet, M. Lebart, Y. Gueguen, et al., Evidence in oyster of a plasma extracellular superoxide dismutase which binds LPS, Biochem. Biophys. Res. Commun. 338 (2) (2005) 1089e1097. [15] Y. Jung, T.S. Nowak, S.M. Zhang, L.A. Hertel, E.S. Loker, C.M. Adema, Manganese superoxide dismutase from Biomphalaria glabrata, J. Invertebr. Pathol. 90 (1) (2005) 59e63. € € Ates¸, et al., Analysis of _ Benli, H. Ozyurt, [16] G. Kalkan, H.Y. Seçkin, Y. Bas¸, I. O. manganese superoxide dismutase (MnSOD Ala-9Val) and glutathione peroxidase (GPx1 Pro 198 Leu) gene polymorphisms in psoriasis, Arch. Dermatol. Res. 306 (3) (2014) 253e258. [17] C.F. Ken, C.C. Lee, K.J. Duan, C.T. Lin, Unusual stability of manganese superoxide dismutase from a new species, Tatumella ptyseos ct: its gene structure, expression, and enzyme properties, Protein Expr. Purif. 40 (1) (2005) 42e50. [18] F.J. Kim, H.P. Kim, Y.C. Hah, J.H. Roe, Differential expression of superoxide dismutases containing Ni and Fe/Zn in Streptomyces coelicolor, Eur. J. Biochem. 241 (1) (1996) 178e185. [19] K.Y. Kim, S.Y. Lee, Y.S. Cho, I.C. Bang, K.H. Kim, D.S. Kim, et al., Molecular characterization and mRNA expression during metal exposure and thermal stress of copper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotis discus discus, Fish Shellfish Immunol. 23 (5) (2007) 1043e1059. [20] C. Li, J. He, X. Su, T. Li, A manganese superoxide dismutase in blood clam Tegillarca granosa: molecular cloning, tissue distribution and expression analysis, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 159 (1) (2011) 64e70. [21] M. Li, L. Zhu, C.Y. Zhou, S. Sun, Y.J. Fan, Z.M. Zhuang, Molecular characterization and expression of a novel big defensin (Sb-BDef1) from ark shell, Scapharca broughtonii, Fish Shellfish Immunol. 33 (5) (2012) 1167e1173. [22] Y. Li, T.T. Huang, E.J. Carlson, S. Melov, P.C. Ursell, J.L. Olson, et al., Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase, Nat. Genet. 11 (4) (1995) 376e381. [23] Y.C. Lin, B. Vaseeharan, J.C. Chen, Identification of the extracellular copperezinc superoxide dismutase (ecCuZnSOD) gene of the mud crab Scylla serrata and its expression following beta-glucan and peptidoglycan injections, Mol. Immunol. 45 (5) (2008) 1346e1355. [24] Y. Lin, F.F. Lee, C. Wu, J. Chen, Molecular cloning and characterization of a cytosolic manganese superoxide dismutase (cytMnSOD) and mitochondrial manganese superoxide dismutase (mtMnSOD) from the kuruma shrimp Marsupenaeus japonicus, Fish Shellfish Immunol. 28 (1) (2010) 143e150. [25] S.L. Liu, K.S. Mai, The progress of studies on molluscs immunological system and mechanism e a review, Acta Oceanol. Sin. 25 (2) (2003) 95e105. [26] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method, Methods 25 (4) (2001) 402e408. [27] J.M. McCord, Superoxide radical: controversies, contradictions, and paradoxes, Proc. Soc. Exp. Biol. Med. 209 (2) (1995) 112e117.
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665 [28] A. Orbea, H.D. Fahimi, M.P. Cajaraville, Immunolocalization of four antioxidant enzymes in digestive glands of mollusks and crustaceans and fish liver, Histochem. Cell Biol. 114 (5) (2000) 393e404. [29] H. Park, I.Y. Ahn, J.K. Lee, S.C. Shin, J. Lee, E.J. Choy, Molecular cloning, characterization, and the response of manganese superoxide dismutase from the Antarctic bivalve Laternula elliptica to PCB exposure, Fish Shellfish Immunol. 27 (3) (2009) 522e528. [30] C. Sun, L. Hu, S. Liu, Z. Gao, S. Zhang, Functional analysis of domain of unknown function (DUF) 1943, DUF1944 and von Willebrand factor type D domain (VWD) in vitellogenin2 in zebrafish, Dev. Comp. Immunol. 41 (4) (2013) 469e476. [31] B. Wu, Z. Liu, L. Zhou, G. Ji, A. Yang, Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity, Dev. Comp. Immunol. 49 (2) (2015) 249e258. [32] N. Xu, S. Zhang, Identification, expression and bioactivity of a chitotriosidaselike homolog in amphioxus: dependence of enzymatic and antifungal activities on the chitin-binding domain, Mol. Immunol. 51 (1) (2012) 57e65. [33] K. Yamamoto, P. Zhang, N. He, Y. Wang, Y. Aso, Y. Banno, et al., Molecular and biochemical characterization of manganese-containing superoxide dismutase
[34]
[35]
[36]
[37]
[38]
665
from the silkworm, Bombyx mori, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 142 (4) (2005) 403e409. C. Yao, A. Wang, W. Wang, R. Sun, Purification and partial characterization of Mn superoxide dismutase from muscle tissue of the shrimp Macrobrachium nipponense, Aquaculture 241 (1e4) (2004) 621e631. H.D. Youn, E.J. Kim, J.H. Roe, Y.C. Hah, S.O. Kang, A novel nickel-containing superoxide dismutase from Streptomyces spp, Biochem. J. 318 (Pt 3) (1996) 889e896. W.F. Yue, J.M. Liu, J.T. Sun, G.L. Li, X.H. Li, X.F. Wu, et al., Immunity promotion and proteomic identification in mice upon exposure to manganese superoxide dismutase expressed in silkworm larvae, J. Proteome Res. 6 (5) (2007) 1875e1881. Q. Zhang, F. Li, B. Wang, J. Zhang, Y. Liu, Q. Zhou, et al., The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: cloning, distribution and expression, Dev. Comp. Immunol. 31 (5) (2007) 429e440. Z.W. Zhang, Z. Li, H.W. Liang, L. Li, X.Z. Luo, G.W. Zou, Molecular cloning and differential expression patterns of copper/zinc superoxide dismutase and manganese superoxide dismutase in Hypophthalmichthys molitrix, Fish Shellfish Immunol. 30 (2) (2011) 473e479.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
A manganese superoxide dismutase (MnSOD) from ark shell, Scapharca broughtonii: Molecular characterization, expression and immune activity analysis Libing Zheng a, b, Biao Wu a, *, Zhihong Liu a, Jiteng Tian a, Tao Yu c, Liqing Zhou a, Xiujun Sun a, Aiguo Yang a a
Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, Shandong, PR China College of Fisheries and Life Science, Shanghai Ocean University, 999 Huchenghuan Road, Pudong New District, Shanghai 201306, PR China c Changdao Enhancement and Experiment Station, Chinese Academy of Fishery Sciences, 1 Haibin Road, Changdao 265800, Shandong, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 January 2015 Received in revised form 28 April 2015 Accepted 4 May 2015 Available online 15 May 2015
Manganese superoxide dismutase (MnSOD) is one of the key members of the antioxidant defense enzyme family, however, data regarding to the immune function of MnSOD in mollusks still remain limited now. In this study, a full-length MnSOD cDNA was identified by rapid amplification of cDNA ends (RACE) method from cDNA library of ark shell Scapharca broughtonii (termed SbMnSOD). The cDNA contained an open reading frame (ORF) of 696 bp which encoded a polypeptide of 232 amino acids, a 50 UTR with length of 32 bp and a 30 -UTR of 275 bp. Four putative amino acid residues (His-57, His-105, Asp190 and His-194) responsible for manganese coordination were located in the most highly conserved regions of SbMnSOD and the signature sequence (DVWEHAYY) also existed in SbMnSOD. The deduced amino acid sequence of SbMnSOD shared high homology to MnSOD from other species. All those data revealed that the SbMnSOD was a novel member of the MnSOD family. The mRNA expression profiles of SbMnSOD in tissues of foot, gill, mantle, adductor muscle, hemocytes and hepatopancreas analyzed by quantitative real-time PCR (qRT-PCR) suggested the mRNA transcripts of SbMnSOD distributed in all the examined tissues. Importantly, Vibrio anguillarum challenge resulted in the increased expression of SbMnSOD mRNA with a regular change trend in all examined tissues, indicating SbMnSOD actively participated in the immune response process. What's more, further analysis on the antibacterial activity of the recombinant SbMnSOD showed that the fusion protein could remarkably inhibit growth of both Gram-positive and Gram-negative bacteria. The present results clearly suggested that SbMnSOD was an acute phase protein involved in the immune reaction in S. broughtonii. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Scapharca broughtonii MnSOD Gene expression Antibacterial activity Enzyme activity
1. Introduction During normal cell metabolism, especially under the condition of pathogeny or environmental stress, the living organisms will produce and accumulate reactive oxygen species (ROS), such as superoxide anion (O2.), hydroxyl radical ($OH), which can be harmful to the membrane lipids, DNA and some enzymes. To prevent the oxidative damage, organisms can clean the redundant ROS by initiating a complex antioxidant system. The superoxide dismutase (SOD) is a sort of important metalloenzyme to clear the ROS
* Corresponding author. Tel.: þ86 532 85811982. E-mail addresses: [email protected], [email protected] (B. Wu). http://dx.doi.org/10.1016/j.fsi.2015.05.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
in the organisms by catalyzing ROS to form harmless molecular oxygen and hydrogen peroxide [10,27], and it can enhance phagocyte defense capacity and immune function [36]. So far, several types of SOD have been identified according to the metal cofactors and three predominant types, Mn-SOD, Fe-SOD, and Cu/ZnSOD, were mostly reported in many species [1,3,18,35]. Among those SODs, manganese superoxide dismutase (MnSOD), primarily found in prokaryotes and eukaryotic mitochondrion, played an important role in eliminating toxicity of ROS, and has been found to be involved in immune response induced by bacteria [4,15], virus infection [37] and toxic chemical exposure [19], and so on. It was found that the salt tolerance, radiation proof and cold resistance of SOD-deficient Escherichia coli had been apparently improved after being transfected recombinant MnSOD gene [6]. In
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
addition, the mice would die of myocardial infarction and neurotrophy in several days once the MnSOD gene was knocked out [12,22]. Due to the importance of MnSOD, many other studies on MnSOD have also been carried out [7,16,24]. Mollusks mainly rely on the innate immune system to protect them against invaders due to the lack of the adaptive immune system. In addition, the water where mollusks dwell in is generally an open environment containing various pathogens and hazardous substance, which may cause much immune response to generate much oxygen free radical [25]. Therefore, as effective materials for degrading ROS, SODs are very important in the mollusks immune process. Up to date, MnSODs were identified and cloned in several mollusks such as Tegillarca granosa (ADC34695), Argopecten irradians (ACU00737), Patinopecten yesoensis (AHX22598.1), Azumapecten farreri (AFN29183.1) and so on. The ark shell, Scapharca broughtonii, belonging to Mollusca, Bivalve, Arcoida, is an important marine economic bivalve. In the recent years, it has become one of the most popular farming mollusks in North China due to its high economic value. To our knowledge, despite many studies on MnSOD in mollusks have been carried out, the data about the gene characteristics and protein activity of MnSOD from S. broughtonii are still lacking until now. Herein, the main objectives of the present study were to: 1) clone the gene of MnSOD from S. broughtonii (denoted as SbMnSOD); 2) investigate the tissues expression profiles of SbMnSOD and the dynamic change after challenged by Vibrio anguillarum; 3) express, purify the fusion protein SbMnSOD and test its antibacterial activity; 5) obtain the optimal temperature and pH of recombinant SbMnSOD for high enzymatic activity. 2. Materials and methods 2.1. Animals, bacterial challenge and tissues collection The healthy ark shells S. broughtonii, averaging 55 mm in shell length, were collected from Nanshan aquatic product market (Qingdao, Shandong Province, China), and acclimatized in aerated seawater at 20 C for a week before processing. For the bacterial challenge experiment, ark shells were randomly divided into challenge and control groups. The bacterial challenge group was treated by injecting with 50 ml of Gramnegative bacterium V. anguillarum suspended in PBS (OD600 ¼ 0.4, 1 OD ¼ 5 108 bacteria/ml, pH ¼ 7.4) into the adductor muscle, while the control group was injected with 50 ml PBS (pH ¼ 7.4, 0.1 mM) instead. All processed ark shells were then returned to the initial seawater. Six tissues (foot, mantle, gill, adductor muscle, hemocytes and hepatopancreas) of three random individuals in each group were sampled at 0, 4, 8, 12, 24, 32 and 64 h after injection for total RNA isolation, respectively. All tissues were dissected to liquid nitrogen and then stored at 80 C until used. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from the six tissues (as mentioned above) using Guanidine Thiocyanate methods described as Dong [8] with slight modification. Briefly, samples were dissociated in solution D (4 M Guanidine Thiocyanate, 17 mM Sodium lauroyl inosine acid and 25 mM sodium citrate) and b-mercaptoethanol, then extracted by Chloroform/Isoamyl alcohol (24:1) and Phenol water to eliminate proteins, precipitated with Isopropyl alcohol and sodium acetate and successively washed by 75% ethanol. RNaseFree DNase I (Promega) was added into the extracted RNA to eliminate genome DNA contamination according to the manufacturer's instruction. The quality, purity and integrity of RNA were tested by spectrophotometer (A260/A280) and agarose gel
657
electrophoresis. First-strand cDNA was synthesized using SMARTer™ RACE Amplification Kit (TaKaRa) according to the protocol of the manufacturer. 2.3. Cloning of MnSOD cDNA To obtain the full-length cDNA of MnSOD, the primers Sb5R and Sb3F (Table 1) were designed by primer premier 5.0 based on the known sequence in the transcriptome library for the rapid amplification ends (RACE). The RACE experiments were carried out using SMARTer™ RACE Amplification Kit (TaKaRa) according to the manufacturer's instructions. The RACE was performed in a 50 ml of reaction volume, containing 30 or 50 -RACE cDNA 2.5 ml, PCR-Grade water 34.5 ml, 10 advantage two PCR buffer 5.0 ml, dNTP Mix (10 mM) 1.0 ml, UPM 5.0 ml, Sb3F or Sb5R (10 mM) 1.0 ml. The PCR was taken out as following: 3 min at 94 C, 30 cycles of 94 C for 30 s, 68 C for 30 s, and 72 C for 2 min. All the amplified target products were gel-purified (Clontech) and then cloned into pMD18-T simple vector (TaKaRa) according to the provided instruction. The vectors were transformed into the competent E. coli Top10 cells, and after that, recombinants were identified by resistance selection in Kanamycin-containing LB plates. The single clones were picked for sequencing, and then the sequences amplified correctly were assembled with the known sequence by SeqMan to yield the full-length cDNA of MnSOD in S. broughtonii. 2.4. Sequence analysis The open reading frame (ORF) and amino acid sequence were inferred from SbMnSOD cDNA using the software DNAStar 7.0 and the protein motif feature was predicted by Simple Modular Architecture Research Tool (http://smart.embl-heidelberg.de/). The homologs were analyzed by the Blastp program available on the website of National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/blast). Multiple alignments of SbMnSOD were performed using the software DNAMan 8.0. A phylogenetic tree was constructed using the Neighbor-Joining method by Mega 5.0 based on the putative amino acid sequence and the tree topology was tested using bootstrap of 1000 replications. The prediction of glycosylation site was deduced by NetNglyc 1.0. 2.5. Tissue-specific expression of SbMnSOD mRNA The expression of SbMnSOD in different tissues and its dynamic changes after V. anguillarum challenge were determined by quantitative Real-time PCR (qRT-PCR) performed at an ABI PCR machine (Applied Biosystems 7500). A pair of specific primers (Q-F/Q-R in Table 1) was designed by primer premier 5.0 to amplify a certain product from cDNA, and b-actin gene of ark shell was used as an internal control [21]. The templates of cDNA were synthesized from the total RNAs from six tissues (as mentioned above) using PrimerScript™ RT reagent kit (TaKaRa) with Oligo (dT) and random 6 mers primers following the manufacturer's protocol, and the quality was detected by b-actin gene. The qRT-PCR amplifications were performed in a 20 ml reaction volume, containing 10 ml SYBR Premix Ex Taq_II (2) (TaKaRa), 0.4 ml ROX Reference Dye II (50), 0.4 ml of each primer (10 mM), 2.0 ml of 1:5 diluted cDNA, and 7.2 ml of PCR-grade water. The qRT-PCR profile was 95 C for 2 min followed by 38 cycles at 95 C for 5 s, 60 C for 34 s. The analysis of dissociation curves after thermocycling was performed to confirm the amplification specificity of SbMnSOD and b-actin. The expression level of the SbMnSOD relative to the b-actin gene was quantified by the 2DDCt method [26]. Reaction of each sample was carried out in triplicates and all the data were given in terms of
658
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665 Table 1 The primers used in this study. Primers
Sequence (50 e30 )
10 Universal Primer A Mix (UPM) Sb3F Sb5R b-actin-F b-actin-R Q-F Q-R P-F P-R T7-F T7-R
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT0 CTAATACGACTCACTATAGGGC CCTGAGTCCAAACGGCGGAGGCGAG TCCTAACCATCCCCATCCAGAACCC GGTTACACTTTCACCACCACAG ACCGGAAGTTTCCATACCTAAGA GATGGGGATGGTTAGGA CAGGACGCACATTCTTG CCGGAATTCATGCTGTCTGCA CCGCTCGAGTGAAGCCTGTTT TAATACGACTCACTATAGGG GCTAGTTATTGCTCAGCGG
relative mRNA expressed level as means ± SD (standard deviation of the means). The blank sample with minimal DCт value was used as the calibrator. Differences were considered significant at p < 0.05, highly significant at p < 0.01. 2.6. Construction of expression vector and expression of recombinant SbMnSOD Specific primers P-F and P-R (Table 1) for amplifying the ORF of SbMnSOD were designed by primer premier 5.0. EcoR I and Xho I sites (underlined) were introduced into the primers, respectively. The PCR profile was performed and products were sub-cloned into pEASY-T1 cloning vector and then transformed into Trans 5a Chemically Competent Cells (TransGen Biotech). The plasmids containing target fragments were extracted from Competent Cells and then digested with enzymes EcoR I and Xho I (TaKaRa), and so did expression vector pET-28a (þ) (Novagen). The digested PCR products were then sub-cloned into the pET-28a (þ), and then recombinant plasmids pET-28a (þ)-SbMnSOD were transformed into the host Competent Cells E. coli BL21 (DE3). The recombinant strains were coated on a LuriaeBertani agar plate containing 100 mg/ml of kanamycin, and incubated overnight at 37 C. Single bacterial colonies were picked for sequencing with T7 promoter and T7 terminator primers (Table 1) in BGI Company to confirm the correctness of the inserted fragment. The bacterial colony with right sequences was chosen to be cultured in LB broth containing 100 mg/ml kanamycin at 37 C until culture medium reached OD600 value of 0.6e0.7. 1 mM isopropyl b-D-thiogalacto-pyranoside (IPTG) was added to induce the recombinant protein expression. The culture was kept at 37 C for 3 h at 200 rpm, and then the bacterial cells were collected by centrifuging at 5000g for 10 min, resuspended in PBS, tested by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSePAGE). 2.7. Purification and refolding of recombinant protein The purification and refolding of recombinant protein were performed as described previously by Refs. [32,30]; respectively. After induction, the E. coli cells were harvested by centrifuging at 4 C. The bacterium was successively washed twice, and suspended with inclusion body solution buffer (25 mM TriseHCl, 50 mM NaCl, 5 mM EDTA, 0.3 mg/ml lysozyme, 2%Triton-X, pH 7.5), sonicated on ice with ultrasonic cell disruptor and then centrifuged. The precipitate was washed twice with the inclusion body purgation buffer (50 mM TriseHCl, 100 mM NaCl, 2 M urea, 1.0% Triton X-100, and 0.5 mM EDTA; pH 8.0), the purified inclusion bodies were finally obtained. After dissolution overnight of inclusion bodies in a solution containing 100 mM TriseHCl, 500 mM NaCl, 8 M urea, 10 mM imidazole, pH 7.4, they were concentrated using a Millipore ultrafiltration tube to collect the final supernatant.
The recombinant protein was purified based on its His-tag by using a Ni2þ-NTA column. 3-fold column volume of binding buffer was added to balance pH value, then the supernatant was added to the column and flowed at a flow rate of 1.0 ml/min. Subsequently, the column was successively washed with binding buffer and wash buffer (100 mM TriseHCl, 500 mM NaCl, 20 mM imidazole, 8 M urea, pH 7.4). Finally, the bound protein was eluted using Elution buffer (100 mM Tris, 500 mM NaCl, 250 mM imidazole, 8 M urea, pH 7.4) and collected into 1.5 ml centrifuge tubes. The purified protein was diluted with elution buffer and transferred into a pretreated dialysis bag, and refolded by dialyzing successively with PBS containing 6 M urea, 5 mM DTT and 1 mM EDTA (pH 7.4), for 12 h; PBS containing 4 M urea, 0.2 mM GSSG, 2 mM GSH and 1 mM EDTA (pH 7.4) for 12 h; PBS containing 2 M urea, 0.5 mM GSSG, 1 mM GSH, 1 mM EDTA and 5% glycerol (pH 7.4) for 12 h and PBS containing 1 mM GSSG, 1 mM GSH, 1 mM EDTA and 5% glycerol (pH 7.4), for 12 h; and PBS (pH 7.4) for 12 h at 4 C. During all the dialysis process, the liquid was slowly stirred with a magnetic stirrer in the refrigerator. The final protein solution was centrifuged and the supernatant was really refolded protein. The protein was electrophoresed with 15% SDSePAGE, following stained with Coomassie brilliant blue R-250 and the concentration of purified protein was determined by the Bicinchoninic acid method using bovine serum albumin (BSA) as the standard. 2.8. Western blotting analysis The recombinant protein was boiled for 8 min, separated by 15% SDSePAGE gel, and then transferred to a PVDF (polyvinylidene fluoride) membrane by half dry transfer printing method for western blotting analysis. The membrane was successively incubated by the anti-His mouse monoclonal antibody (diluted 1:2000) and the goat anti-mouse IgG (H þ L) horseradish peroxidaseconjugated antibody (diluted 1:5000), which were used as the primary antibody and the secondary antibody in the process, respectively. The transformed stripe was dyed with HRB-DAB Kit (Thermo) according to the instruction. 2.9. Antibacterial activity of recombinant SbMnSOD The experiment was carried out as previously described by Wu et al. [31]. To test the antibacterial activity of recombinant protein, Gram-negative bacterium E. coli and Gram-positive bacteria Staphylococcus aureus, Micrococcus leteus were employed in this experiment. These bacteria at logarithmic-phase were collected by centrifuging at 5000g for 10 min, suspended with PBS, and the concentration was adjusted to 2 107 cells/ml. The recombinant protein SbMnSOD was gradient diluted to 100 mg/ml and 50 mg/ml, respectively. Then 300 ml bacteria solution and 300 ml diluted recombinant SbMnSOD were mixed thoroughly and subsequently
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
divided into three duplicates, 200 ml mixture in each well of Elisa Plate, and incubated at 37 C for 12 h to read absorbance value at 630 nm every hour, while PBS replaced protein liquid as control. 2.10. Analysis of thermostability of recombinant SbMnSOD In order to test the effect of temperature on enzyme activity of recombinant SbMnSOD, the thermostability experiment was carried out. The assay was conducted as described by Bao et al. [2] with slight modification. Briefly, 30 ml (242 mg/ml) purified recombinant protein was mixed with 30 ml PBS (0.1 mM, pH 7.4), and placed in condition of different temperature gradient which ranged from 10 C to 90 C with a gap of 10 C for 15 min, respectively. The protein was replaced by ddH2O as the blank control group. The enzyme activity was tested using T-SOD kit (Nanjing Jiancheng) by reading the absorbance value at 630 nm of each plate well. There were three duplicates in each group. The enzyme activity of the group with the largest enzyme activity was set as the 100%, and enzyme activity of other groups was the percentage accounting in the largest enzyme activity. 2.11. pH stability of recombinant enzyme SbMnSOD The enzyme activity of rSbMnSOD under different pH conditions was tested in the study. The assay was conducted as described by Bao et al. Ref. [2] with slight modification. The pH buffers with a concentration of 0.2 M Citric Acidesodium citrate (pH 2.2 and 3.0), NaAceHAc (pH 3.9 and 5.0), TriseHCl (pH 7.4 and 9.0), glycineeNaOH (pH 10.0 and 12.0) were prepared, respectively. 30 ml (242 mg/ml) purified protein was mixed adequately with 30 ml different pH values buffer, respectively, and then incubated for 70 min at 25 C. After incubation treatment, the mixtures were immediately transferred to ice and successively the enzyme activity was measured as the method described above. The recombinant protein was replaced by ddH2O in each group as the control. 3. Results 3.1. Characteristics of SbMnSOD cDNA sequence The full length cDNA of SbMnSOD was firstly cloned by RT-PCR and RACE method (GenBank Accession No. KP280005). The assembled cDNA was 1003 bp in length, containing a 50 -untranslated region (UTR) of 32 bp, a 30 -UTR of 275 bp, and an ORF of 696 bp which encoded 232 amino acids. The predicted protein molecular weight (Mw) was 25.67 kDa and the estimated theoretical isoelectric point (pI) was 7.13. Four putative amino acid residues (His-57, His-105, Asp-190 and His-194) responsible for manganese coordination were located in the most highly conserved regions in SbMnSOD. And the signature sequence (DVWEHAYY) also existed. SignalP analysis indicated that there was a signal peptide at the N-terminal of deduced amino acid, and three glycosylation sites were located at the position of 104 (NHST), 144 (NATV) and 160 (NPTS), respectively. All those are shown in Fig. 1.
659
Crassostrea gigas (ABZ90958) (66%), respectively; In addition to those mollusks, the SbMnSOD protein also shared high identity with other species as Callinectes sapidus, Charybdis feriata, Danio rerio and Mus musculus, and so on. In short, the deduced amino acid of SbMnSOD owned high conserved sequences with those from other species (Fig. 2). The phylogenetic tree constructed using the amino acid sequences of MnSOD from 19 representative species showed that this phylogenetic tree had two large clusters (Fig. 3). All the selected MnSOD from mollusks clustered together, while S. broughtonii had the closest relationship with T. granosa. SbMnSOD clustered together firstly with that of T. granosa, and then clustered with those from bivalve and gastropods, which formed the sister cluster with the MnSOD from vertebrates, which indicated the MnSOD cluster was mainly in accordance with the traditional classification. 3.3. SbMnSOD expression in different tissues The relative expression values of SbMnSOD/b-actin in hepatopancreas were considered as the reference group. The expression profile of SbMnSOD in different tissues of normal individuals is shown in Fig. 4. From this figure, it can be seen that the SbMnSOD gene expressed in all examined tissues as hemocytes, foot, gill, mantle, adductor muscle and hepatopancreas, and the expression levels were different among those tissues. The expression of SbMnSOD gene in hemocytes was the highest with 424.29-fold comparing to the control, followed by foot, gill, mantle and adductor muscle. 3.4. Expression of the SbMnSOD transcript after bacterial challenge The dynamic changes of the SbMnSOD transcript in examined tissues of S. broughtonii after V. anguillarum challenge are shown in Fig. 5. As shown in the figure, the response of SbMnSOD gene in all tested tissues to bacterial challenge had similar variation tendency, which showed remarkable up-regulation to the peak and then declined to the normal level. However, the expression profile in different tissues showed different degree lags of time. During the 16 h post-challenge, the expression level went up gradually and reached the peak in hemocytes, gill, foot, and mantle, and the relative transcription level of the SbMnSOD in these four tissues increased 4.97, 2.81, 4.63 and 3.90-fold, respectively. And the peaking time was of high asynchrony, the earliest one was at 8 h after injection in the adductor muscle (7.52-fold) while the last one was 24 h in hepatopancreas (3.79-fold). After reaching the peak, the relative expression level fell down, however, there was a second expression peak in adductor muscle and hemocytes at 32 h after challenge, with the expression values were 3.59-fold (p < 0.05), 2.99-fold (p < 0.05), respectively. Generally, SbMnSOD mRNA expression level fell back to initial level in all tissues after 64 h. These data showed that bacterial challenge caused a significant change in SbMnSOD expression, indicating an involvement of SbMnSOD in the acute phase response in S. broughtonii.
3.2. Homology and phylogenetic analysis of SbMnSOD
3.5. Expression, purification and validation of recombinant SbMnSOD
The homology analysis performed using Blastp program in NCBI indicated that deduced amino acid sequence of SbMnSOD shared relatively high similarity with MnSOD proteins from other species. The highest identity was shared with T. granosa (ADC34695) to 91%, and followed by other mollusks as A. irradians (ACU00737) (76%), P. yesoensis (AHX22598.1) (74%), A. farreri (AFN29183.1) (73%), Ruditapes philippinarum (AFN29183.1) (68%), Haliotis discus hannai (ABF67504) (68%), Crassostrea hongkongensis (AFN29183) (66%),
The recombinant expression vectors including pET-28a (þ)-SbMnSOD were constructed and transformed into the E. coli BL21 (DE3). The rSbMnSOD was purified through the Ni-NTA resin column after 1.0 mM IPTG induction for 3 h. The SDSePAGE analysis indicated that there was an apparent protein band with the molecular weight of about 30 kDa compared to the control without induction, and the band well matched the expected size of rSbMnSOD. Further analysis by western-blotting showed that the
660
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 1. Nucleotide sequence and deduced amino acid sequence of MnSOD from S. broughtonii (SbMnSOD). The start codon (ATG) and stop codon (TAG) are boxed. The polyadenylation signal sequence (ATTAAA) and the poly (A) tail are underlined with the wave line, respectively. The signal peptide is shaded. The signature sequence DVWEAYY is marked with dotted line. Four putative amino acid residues responsible for manganese coordination are showed by bold red color. The glycosylation sites are underlined. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Multiple alignment of the amino acid sequence of the SbMnSOD with those from other animals: T. granosa (ADC34695), A. farreri (AFN29183), M. yessoensis (BAE78580), H. discus hannai (ABF67504), A. irradians (ACU00737), C. gigas (ABZ90958), M. rosenbergii (ABU55005), Salmo salar (ACN12619), D. rerio (NP_956270), H. sapiens (AAP34410). MnSOD signature sequence (DVWEHAYY) is marked by frame and the amino acids responsible for combination with the metal are marked by triangle.
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
661
Fig. 3. The phylogenetic tree constructed by MEGA 5.0 software using the amino acid sequences of MnSOD proteins from representative species. C. sapidus (AF264029_1), Litopenaeus vannamei (ABC59527), Marsupenaeus japonicus (BAB85211), A. farreri (AFN29183), D. rerio (NP_956270), M. yessoensis (BAE78580), H. discus discus (ABF67504), A. irradians (ACU00737), C. gigas (ABZ90958), M. rosenbergii (AAY79405), S. salar (ACN12619), D. rerio (NP_956270), H. sapiens (AAP34410), Xenopus laevis (NP_001083968), M. musculus (NP_038699), Gallus gallus (AF329270_1), C. feriata (AAD01640), T. granosa (ADC34695), Saccharomyces cerevisiae (NC_001142.9). The numbers on each branch suggested the bootstrap values (%) for 1000 replications, the bars represent the distance.
expressed protein could interact with anti-His tag mouse monoclonal antibody. All the data indicated that the protein SbMnSOD was successfully expressed and purified (Fig. 6). 3.6. Antibacterial activity of recombinant SbMnSOD As shown in Fig. 7, the growth curves of Gram-negative bacterium E. coli and the Gram-positive bacteria S. aureus and M. leteus incubated with rSbMnSOD appeared similar variation tendency. Compared to the PBS groups, the growth of all three strains bacteria in treated groups was limited by the recombinant protein. Within the 3e4 h, the three strains bacteria propagated rapidly, then kept in a mild trend in the following hours. This revealed that the rSbMnSOD showed a broad-spectrum antibacterial activity against both Gram-negative and Gram-positive bacteria. 3.7. Optimal temperature
Fig. 4. Expression profile of SbMnSOD in different tissues. The mRNA expression of SbMnSOD and b-actin was measured in six tissues and the relative expression values of SbMnSOD/b-actin in hepatopancreas were considered as the reference group. The relative expression level of SbMnSOD was determined by 2DDCt for each group and the results were shown as means ± SD (n ¼ 3). The columns with different letters indicated extremely significance (p < 0.01) between groups. F: Foot, G: Gill, M: Mantle, He: Hepatopancreas, A: Adductor muscle, Ha: Hemocytes.
The thermostability of refolded recombinant protein at different temperatures was tested. As shown in Fig. 8, the enzyme activity of recombinant SbMnSOD at 10 and 20 C was at a low level (35%), followed by a sharp increasing to a high level at 30 C, and the higher activity maintained from 30 C to 60 C, and the highest activity was 100% at 50 C, and then dropped immediately to 25% when the temperature reached 70 C. However, 9.6% enzyme
662
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 5. SbMnSOD mRNA expression after V. anguillarum challenge in six tissues. The mRNA expression of SbMnSOD and b-actin was detected at 0, 4, 8, 16, 24, 32 and 64 h in treatment and control groups following challenge, respectively. The relative SbMnSOD expression level as exhibited by 2DDCt was determined for each group and the values were shown as means ± SD (n ¼ 3). Two asterisks indicate highly significant differences (p < 0.01), one asterisk indicates significant differences (p < 0.05).
activity still available at 90 C. This suggested that the appropriate temperature to obtain optimal enzyme activity was ranged from 30 C to 60 C, which the enzyme activity kept over 93%. So the rSbMnSOD was heat-resistant. 3.8. Optimal pH The effect of pH on the enzyme activity of recombinant protein is shown in Fig. 9. As presented in this figure, the enzyme activity presented a downtrend manner along with the increasing of the pH values from 2.2 to 12, with the highest activity appeared at the pH value of 2 while the lowest at 12 (12.29%). All these data indicated that the purified recombinant SbMnSOD owned higher enzyme activity in the acidic condition than in alkaline condition. 4. Discussion SODs play an important role in antioxidant defense pathways during the response process [23,28,34]. Compared to other species,
the studies of SODs in aquatic organisms were still in the fledging period, especially in mollusks [9,11,15]. MnSOD was an important enzyme to prevent aquatic organism against diseases, so intensive studies on molecular mechanism and protein characteristic of MnSOD could be of great help for mollusk breeding. In recent years, more and more researches about the characterization of MnSOD and its roles in antioxidant or immune defense have been reported. Li et al. [20] cloned the MnSOD from blood calm T. granosa (TgMnSOD) which could be induced by heavy metal, and obtained its polyclonal antibodies. MnSOD gene from Pacific white shrimp Litopenaeus vannamei was also identified and its mRNA expression increased in hemocytes after infection with WSSV [13]. Those results revealed that MnSODs were involved in the immune reactions in invertebrates, especially when the organisms faced an excessive oxidative stress caused by the invasion of pathogen like bacteria and viruses. In the present study, a full-length cDNA of MnSOD was firstly identified and characterized from ark shell S. broughtonii. The deduced amino acids sequence had a signal peptide, which hinted
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
663
Fig. 8. The enzyme activity changes of recombinant protein SbMnSOD at different temperatures. The activity was test at nine temperature points ranged from 10 to 90 C with a gap of 10 C. Each point in the graph presents the mean ± SD (n ¼ 3). T: temperature.
Fig. 6. Expression and purification of the recombinant protein with Ni-NTA resin affinity chromatography. M: protein molecular standard (TransGen Biotech); Lane 1, total cellular extracts from E. coli BL21 containing recombinant plasmid before IPTG induction; Lane 2, IPTG-induced recombinant protein; Lane 3, the supernatant after ultrasonication; Lane 4, the inclusion body after ultrasonication; Lane 5, the purified recombinant fusion protein (about 30 kDa); Lane 6, western blotting of recombinant protein.
SbMnSOD obtained was likely located in mitochondrial matrix, and the SbMnSOD owned several common features including high conserved sequences and signature sequence DVWEHAYY. All those data indicated that the isolated cDNA was indeed coded for a canonical MnSOD from S. broughtonii. The SbMnSOD transcript had the wide-range distribution in the body, which was highly in agreement with MnSOD expression profile in other animals like T.
granosa [20], L. vannamei [13], M. rosenbergii [4], Hemibarbus mylodon [5], Hypophthalmichthys molitrix [38]. The upregulation of SbMnSOD transcripts with a similar trend in all the tested tissues showed an acute phase response in the bacterial challenge in S. broughtonii. It is of interest to note the immune role of SbMnSOD. Firstly, like other immune factors as Sb-BDef1 [21], PyVg [31]. To further study the properties of MnSOD protein, the recombinant SbMnSOD was expressed, purified and tested successively. The predicted molecular weight of recombinant SbMnSOD was calculated to be 25.67 kDa, which was highly closed to those protein of MnSODs from other organisms like M. rosenbergii [4], Fenneropenaeus chinensis [37]. The recombinant SbMnSOD could remarkably inhibit the growth of gram-negative E. coli and gram-positive S. aureus and M. leteus, which intuitively demonstrated the SbMnSOD was an immune-relevant molecule. Although previous studies have showed that Cu/ZnSOD from oyster C. gigas (Cg-EcSOD) possessed
Fig. 7. The growth curves of E. coli, S. aureus and M. leteus after incubating with different diluted concentration of recombinant protein SbMnSOD, respectively. The X and Y-axis represented time and absorbance values at 630 nm, respectively. Each point in the graph presents the mean ± SD (n ¼ 3).
664
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665
Fig. 9. The enzyme activity change of recombinant protein SbMnSOD in different pH conditions. The pH gradient ranged from 2.2 to 12, and the highest enzyme activity was set as 100% at pH 2.2. Each point in the graph presents the mean ± SD (n ¼ 3).
an LPS-binding motif found in the endotoxin receptor CD14 which displayed an affinity to E. coli and with LPS [14], the reports on antibacterial activity of SbMnSOD were limited. It is thus inferred that the anti-bacterial activation of SbMnSOD may rely on the conservative structure sites of SODs among different species. Despite further studies should be addressed for characterizing the antibacterial mechanism of MnSOD, we clearly demonstrated that the MnSOD from S. broughtonii was an immune-relevant molecule in this study. Previous studies suggested that the recombinant MnSODs possessed high enzyme activity under a wide range of temperature and pH condition, however, the optimum temperature and pH were slight different among species [9,17,33]. This study detected the optimum temperature range for high enzyme activity of SbMnSOD was from 30 C to 60 C, which was appropriate for MnSOD of H. discus discus and Laternula elliptica [9,29], while the optimum pH value range was from 2.2 to 3.0, which was lower than that of H. discus discus from 3.5 to 6.5 [9]. In conclusion, the MnSOD cDNA with length of 1003 bp including an ORF of 696 bp which encoded 232 aa was cloned from the S. broughtonii and the predicted protein showed common features with MnSODs of many other mollusks reported. In addition, this study highlights the immunocompetence of SbMnSOD via showing its response to the bacterial challenge and capacity of inhibiting bacterial growth. This is the first report on the MnSOD from S. broughtonii, opening a new insight into immune roles of SbMnSOD. Acknowledgments This study was supported by Natural Science Foundation of Shandong Province (No. ZR2013CQ047), National Infrastructure of Fishery Germplasm Resources Programme (2060503-01), and Science and Technology Development Program of Shandong Province (2014GHY115031). References [1] T. Amo, H. Atomi, T. Imanaka, Biochemical properties and regulated gene expression of the superoxide dismutase from the facultatively aerobic hyperthermophile Pyrobaculum calidifontis, J. Bacteriol. 185 (21) (2003) 6340e6347. [2] Y. Bao, L. Li, F. Xu, G. Zhang, Intracellular copper/zinc superoxide dismutase from bay scallop Argopecten irradians: its gene structure, mRNA expression and recombinant protein, Fish Shellfish Immunol. 27 (2) (2009) 210e220.
[3] C. Bowler, T. Alliotte, M. Van den Bulcke, G. Bauw, J. Vandekerckhove, M. Van Montagu, et al., A plant manganese superoxide dismutase is efficiently imported and correctly processed by yeast mitochondria, Proc. Natl. Acad. Sci. U. S. A. 86 (9) (1989) 3237e3241. [4] W. Cheng, Y.H. Tung, C.H. Liu, J.C. Chen, Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii, Fish Shellfish Immunol. 20 (4) (2006) 438e449. [5] Y.S. Cho, S.Y. Lee, I.C. Bang, D.S. Kim, Y.K. Nam, Genomic organization and mRNA expression of manganese superoxide dismutase (Mn-SOD) from Hemibarbus mylodon (Teleostei, Cypriniformes), Fish Shellfish Immunol. 27 (4) (2009) 571e576. [6] Ting-ting Deng, Jing Li, Geng Ma, et al., Identification of the function of superoxide dismutase gene from Dunaliella salina in SOD deleted strain K12, J. Sichuan Univ. 1 (44) (2007) 176e180. [7] C. Dong, G. Li, Z. Li, H. Zhu, M. Zhou, Z. Hu, Molecular cloning and expression analysis of an Mn-SOD gene from Nelumbo nucifera, Appl. Biochem. Biotechnol. 158 (3) (2009) 605e614. [8] Y.H. Dong, Transcriptome Analysis Using 454 Pyrosequencing and Cloning and Expression of Growth-related Genes for the Blood Clam T. granosa, Ocean University of China, Qingdao, 2012. [9] P.M. Ekanayake, H.S. Kang, M. De Zyosa, Y. Jee, Y.H. Lee, J. Lee, Molecular cloning and characterization of Mn-superoxide dismutase from disk abalone (Haliotis discus discus), Comp. Biochem. Physiol. B Biochem. Mol. Biol. 145 (3e4) (2006) 318e324. [10] I. Fridovich, Superoxide radical and superoxide dismutases, Annu. Rev. Biochem. 64 (1995) 97e112. [11] G.A. Gomez-Anduro, C.V. Barillas-Mury, A.B. Peregrino-Uriarte, L. Gupta, T. Gollas-Galvan, J. Hernandez-Lopez, et al., The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression, Dev. Comp. Immunol. 30 (10) (2006) 893e900. [12] R.M. Lebovitz, H. Zhang, H. Vogel, et al., Neurodegeneration, myocardial injury, and perinatal death in mitochondria superoxide dismutase-deficient mice, Med. Sci. 93 (1996) 9782e9787. mez-Anduro, C.V. Barillas-Mury, A.B. Peregrino-Uriarte, L. Gupta, [13] G.A. Go n, J. Herna ndez-Lo pez, G. Yepiz-Plascencia, et al., The cytosolic T. Gollas-Galva manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression, Dev. Comp. Immunol. 30 (10) (2006) 893e900. [14] M. Gonzalez, B. Romestand, J. Fievet, A. Huvet, M. Lebart, Y. Gueguen, et al., Evidence in oyster of a plasma extracellular superoxide dismutase which binds LPS, Biochem. Biophys. Res. Commun. 338 (2) (2005) 1089e1097. [15] Y. Jung, T.S. Nowak, S.M. Zhang, L.A. Hertel, E.S. Loker, C.M. Adema, Manganese superoxide dismutase from Biomphalaria glabrata, J. Invertebr. Pathol. 90 (1) (2005) 59e63. € € Ates¸, et al., Analysis of _ Benli, H. Ozyurt, [16] G. Kalkan, H.Y. Seçkin, Y. Bas¸, I. O. manganese superoxide dismutase (MnSOD Ala-9Val) and glutathione peroxidase (GPx1 Pro 198 Leu) gene polymorphisms in psoriasis, Arch. Dermatol. Res. 306 (3) (2014) 253e258. [17] C.F. Ken, C.C. Lee, K.J. Duan, C.T. Lin, Unusual stability of manganese superoxide dismutase from a new species, Tatumella ptyseos ct: its gene structure, expression, and enzyme properties, Protein Expr. Purif. 40 (1) (2005) 42e50. [18] F.J. Kim, H.P. Kim, Y.C. Hah, J.H. Roe, Differential expression of superoxide dismutases containing Ni and Fe/Zn in Streptomyces coelicolor, Eur. J. Biochem. 241 (1) (1996) 178e185. [19] K.Y. Kim, S.Y. Lee, Y.S. Cho, I.C. Bang, K.H. Kim, D.S. Kim, et al., Molecular characterization and mRNA expression during metal exposure and thermal stress of copper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotis discus discus, Fish Shellfish Immunol. 23 (5) (2007) 1043e1059. [20] C. Li, J. He, X. Su, T. Li, A manganese superoxide dismutase in blood clam Tegillarca granosa: molecular cloning, tissue distribution and expression analysis, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 159 (1) (2011) 64e70. [21] M. Li, L. Zhu, C.Y. Zhou, S. Sun, Y.J. Fan, Z.M. Zhuang, Molecular characterization and expression of a novel big defensin (Sb-BDef1) from ark shell, Scapharca broughtonii, Fish Shellfish Immunol. 33 (5) (2012) 1167e1173. [22] Y. Li, T.T. Huang, E.J. Carlson, S. Melov, P.C. Ursell, J.L. Olson, et al., Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase, Nat. Genet. 11 (4) (1995) 376e381. [23] Y.C. Lin, B. Vaseeharan, J.C. Chen, Identification of the extracellular copperezinc superoxide dismutase (ecCuZnSOD) gene of the mud crab Scylla serrata and its expression following beta-glucan and peptidoglycan injections, Mol. Immunol. 45 (5) (2008) 1346e1355. [24] Y. Lin, F.F. Lee, C. Wu, J. Chen, Molecular cloning and characterization of a cytosolic manganese superoxide dismutase (cytMnSOD) and mitochondrial manganese superoxide dismutase (mtMnSOD) from the kuruma shrimp Marsupenaeus japonicus, Fish Shellfish Immunol. 28 (1) (2010) 143e150. [25] S.L. Liu, K.S. Mai, The progress of studies on molluscs immunological system and mechanism e a review, Acta Oceanol. Sin. 25 (2) (2003) 95e105. [26] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method, Methods 25 (4) (2001) 402e408. [27] J.M. McCord, Superoxide radical: controversies, contradictions, and paradoxes, Proc. Soc. Exp. Biol. Med. 209 (2) (1995) 112e117.
L. Zheng et al. / Fish & Shellfish Immunology 45 (2015) 656e665 [28] A. Orbea, H.D. Fahimi, M.P. Cajaraville, Immunolocalization of four antioxidant enzymes in digestive glands of mollusks and crustaceans and fish liver, Histochem. Cell Biol. 114 (5) (2000) 393e404. [29] H. Park, I.Y. Ahn, J.K. Lee, S.C. Shin, J. Lee, E.J. Choy, Molecular cloning, characterization, and the response of manganese superoxide dismutase from the Antarctic bivalve Laternula elliptica to PCB exposure, Fish Shellfish Immunol. 27 (3) (2009) 522e528. [30] C. Sun, L. Hu, S. Liu, Z. Gao, S. Zhang, Functional analysis of domain of unknown function (DUF) 1943, DUF1944 and von Willebrand factor type D domain (VWD) in vitellogenin2 in zebrafish, Dev. Comp. Immunol. 41 (4) (2013) 469e476. [31] B. Wu, Z. Liu, L. Zhou, G. Ji, A. Yang, Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity, Dev. Comp. Immunol. 49 (2) (2015) 249e258. [32] N. Xu, S. Zhang, Identification, expression and bioactivity of a chitotriosidaselike homolog in amphioxus: dependence of enzymatic and antifungal activities on the chitin-binding domain, Mol. Immunol. 51 (1) (2012) 57e65. [33] K. Yamamoto, P. Zhang, N. He, Y. Wang, Y. Aso, Y. Banno, et al., Molecular and biochemical characterization of manganese-containing superoxide dismutase
[34]
[35]
[36]
[37]
[38]
665
from the silkworm, Bombyx mori, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 142 (4) (2005) 403e409. C. Yao, A. Wang, W. Wang, R. Sun, Purification and partial characterization of Mn superoxide dismutase from muscle tissue of the shrimp Macrobrachium nipponense, Aquaculture 241 (1e4) (2004) 621e631. H.D. Youn, E.J. Kim, J.H. Roe, Y.C. Hah, S.O. Kang, A novel nickel-containing superoxide dismutase from Streptomyces spp, Biochem. J. 318 (Pt 3) (1996) 889e896. W.F. Yue, J.M. Liu, J.T. Sun, G.L. Li, X.H. Li, X.F. Wu, et al., Immunity promotion and proteomic identification in mice upon exposure to manganese superoxide dismutase expressed in silkworm larvae, J. Proteome Res. 6 (5) (2007) 1875e1881. Q. Zhang, F. Li, B. Wang, J. Zhang, Y. Liu, Q. Zhou, et al., The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: cloning, distribution and expression, Dev. Comp. Immunol. 31 (5) (2007) 429e440. Z.W. Zhang, Z. Li, H.W. Liang, L. Li, X.Z. Luo, G.W. Zou, Molecular cloning and differential expression patterns of copper/zinc superoxide dismutase and manganese superoxide dismutase in Hypophthalmichthys molitrix, Fish Shellfish Immunol. 30 (2) (2011) 473e479.
