Mol Biotechnol DOI 10.1007/s12033-015-9872-3
RESEARCH
A Lentiviral Vector Expressing Desired Gene Only in Transduced Cells: An Approach for Suicide Gene Therapy Zahra Mohammadi1 • Laleh Shariati2 • Hossein Khanahmad1,3 • Mahsa Kolahdouz1 Fariborz Kianpoor4 • Jahan Afrooz Ghanbari1 • Zahra Hejazi1 • Mansoor Salehi1 • Parvaneh Nikpour1,3,5 • Mohammad Amin Tabatabaiefar1,3
•
Ó Springer Science+Business Media New York 2015
Abstract Suicide gene therapy is a therapeutic strategy, in which cell suicide inducing transgenes are introduced into target cells. Inserting a toxin-encoding gene into a lentiviral vector leads to decreased efficiency of virus production due to lethal effect of toxin on packaging cells. In this study, we designed and constructed a transfer vector to express the toxin in transduced cells but not in packaging cells. Plasmid pLenti-F/GFP was constructed by cutting out R 50 LTR-R 30 LTR fragment with the AflII restriction endonuclease from a plasmid pLenti4-GW/H1/TO-laminshRNA, followed by ligating R 50 LTR-R 30 LTR fragment, constructed by three PCR stages. The promoter and GFP CDS were inserted in opposite strand. For lentiviral production, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLenti-F/GFP plasmids (envelope, packaging, and transfer plasmids).Viral vector titers were assayed. The HEK293T cell line was transduced with this virus. PCR was performed to confirm the presence of the promoter fragment between the R and U5 in 30 LTR. The
& Hossein Khanahmad [email protected] 1
Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2
Department of Molecular Medicine, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran, Iran
3
Child Growth and Development Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
4
Department of Immunology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
5
Applied Physiology Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
lentivirus titers were approximately 2 9 105. The GFP expression was seen in 51 % of the HEK293T cells transduced with lentivirus. The PCR product size was 1440 bp confirming the promoter fragment position between the R and U5 in 30 LTR. The strategy enables us to use a broad spectrum of toxin genes in gene therapy and helps avoid the death of the packaging cells with lentiviral vectors carrying a toxin-encoding gene, thereby increasing the efficiency of viral production in packaging cells. Keywords
Lentivirus Suicide gene therapy Cancer
Introduction Gene therapy has been acknowledged to be a revolutionary technology which has the potential to cure almost all life threatening diseases the bases of which have been elucidated. A successful gene therapy procedure involves specific, efficient, and stable incorporation of a gene of interest (GOI) into the target cell [1]. Unlike the initial use of gene therapy for disease with identified molecular etiology, it has now been mostly focused on cancer which is genetic but very complex in nature [2]. The current therapies of cancer mostly involve systematic administration of therapeutic agents with serious complications. Therefore, the dosage of chemotherapeutics or radiation should be reduced well below the effective levels to avoid those side effects. Selective eradication of cancer cells is especially important in cases in which they are mixed with the healthy cells. Neither the surgical resection not radiation therapy are able to fulfill the purpose. Most of the exposed cells particularly those of reproductive, immune, and hormonal systems may be affected [3, 4]. Furthermore, the efficacy of these methodologies is often impeded by an inadequate
123
Mol Biotechnol
therapeutic index, lack of specificity, and the development of drug-resistant cell sub-populations [5]. Immunotherapy can target healthy cells when the used antibodies are of less specificity or there is cross reactivity which may lead to serious complications. In cancer gene therapy, some approaches have been taken such as mutation correction, enhancement of the immune response, RNA interference and targeted virus-mediated killing of tumor cells, and anti-angiogenic therapy [6]. Suicide gene therapy trials have shown to be more promising than other available gene therapy strategies [3]. Suicide gene therapy is a therapeutic strategy, in which a transgene can induce cell suicide upon its introduction into cancer cells [7]. The concept of ‘‘suicide genes’’ was suggested in the late 1980s for cancer gene therapy using either toxin gene therapy, in which toxic-encoding genes are transfected directly into tumor cells, or enzyme-activating prodrug therapy, in which the transgene product converts a specific prodrugs to a toxic products [5]. Important genes used in suicide gene therapy include genes encoding apoptotic factors, thymidine kinases, cytosine deaminases, intracellular antibodies, telomerases, caspases, and Dnases [3, 8]. Toxins are potent cell toxicity agents used frequently in cancer therapy. Diphtheria toxin (DT) and pseudomonas exotoxin are best examples of these agents. As regard to DT, one single molecule can kill a cell. The toxin catalyzes ADP-ribosylation of the elongation factor 2 (EF2), thereby blocking the translational machinery of target cells [9]. Targeted cell toxicity of DT has been achieved using an inducible and/or tissue-specific promoters [9–13]. An alternative method is generation of a DT-resistant HEK293 packaging cell line that can tolerate high concentration of the toxin (up to 10–7 mol/l), thereby improving the production of the adenovirus vector [14]. As another strategy, for AAV vectors carrying the DT-A gene, the TetR repressor system was used to decrease the expression in packaging cell of DTA but the viral yield was shown to be 2–3 logs lower than AAV vectors that did not carry the DT-A gene [15]. Viral vectors are known as the most effective means of delivering a therapeutic gene into human cells. Nevertheless, application of the viral-based vectors, such as adenovirus, recombinant, and AAV, for the delivery of toxic genes to a target cell has been largely impeded by the toxicity of the toxic gene [9]. Lentiviral vectors are presently the most common type used in clinical trials [16, 17]. However, placing a toxin gene in a transfer lentiviral vector is lethal for the host cell and lead to decrease in the yield of virus in packaging cells which, in turn, reduces the efficiency of gene therapy. During the lentivirus life cycle, the U3 of 50 LTR is copied from 30 LTR and U5 of 30 LTR copied from 50 LTR. Once reverse transcription occurs, the U5 of 50 LTR jumps to the R region at the 30 end of
123
the genome [16, 18]. In this study, for the first time, a lentiviral dest plasmid was designed with a CMV promoter on lagging strand between R and U5 at 50 LTR and a CDS ? poly A signal on lagging strand before 30 LTR. According to jumping in the lentivirus life cycle, the construct is able to express the GFP in transduced cells but not in packaging cells.
Materials and Methods Construction and Confirmation of pLenti-Empty Plasmid pLenti-Empty was constructed by the following steps: first cutting out R 50 LTR-R 30 LTR fragment with the AflII from a plasmid pLenti4-GW/H1/TO-laminshRNA (Invitrogen), followed by ligating R 50 LTR-R 30 LTR fragment (Insert #1) that in three consecutive PCR stages was constructed (Table 1). PCR #1 was performed on pLenti4GW/H1/TO-laminshRNA (Fig. 1a) and PCR #2 & 3 each was performed on PCR 1 & 2 products (Fig. 1b). In each step, PCR product was cleaned up using Bioneer kit (Korea) according to the manufacturer’s instructions. During the construction of this fragment, sites for four restriction endonucleases (PstI, SpeI, KpnI & AflII) were inserted to certain places as to enable us to clone other fragments later. PCR product 3 was digested with AflII followed by cleanup (Insert #1). The pLenti4-GW/H1/TO-laminshRNA was digested with AflII. The product was run on 1 % agarose gel and the plasmid backbone was extracted from the gel. To produce pLenti-Empty, the digested PCR product 3 was ligated to backbone of pLenti4-GW/H1/TOlaminshRNA using T4 DNA ligase (Ligation product #1). Escherichia coli strain TOP10F0 was obtained from Pasteur Institute of Iran and transformed by Ligation product 1 according to the chemical method of Higa and Mandel protocol. Transformed bacteria were cultured in LB agar medium containing 100 lg/ml ampicillin. After overnight culture, some colonies were picked up. The resulted clones were assessed by PCR (PCR4) and digestion with AflII (Table 1). After confirmation, the colony was cultured and pLenti-Empty was extracted using SolGentTM plasmid Mini Prep Kit (Korea) following the manufacturer’s instruction. Construction and Confirmation of pLenti-Pl/GFP PCR #5 reaction (Table 1) was performed on a lentivirus plasmid with its gfp on the opposite strand (pGFP-Endo) to amplify a sequence from the gfp gene to 50 LTR U5 (Table 1). The PCR product #5 and pLenti-Empty were digested with PstI and SpeI in separate steps. The PCR product #5 after digestion was named Insert #2. The products were run on 1 % agarose gel. The target products were extracted from the gel and ligated. (Ligation product #2).
Mol Biotechnol Table 1 Primer sequences
PCR n.
Primer sequences (50 ? 30 )
PCR #1
F: CTTCAGGTACCTTAACTAGTTATCTGCAGTACCTTTAAGAC CAATGACTTACAAG (F1) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #2
F: TTGCCTTGAGTGCTTCAGGTACCTTAACTAGTTATCTGC (F2) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #3
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #4
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: CTGCTAGAGATTTTCCACACTG (U5 Reverse backbone)
PCR #5
F: ATTACTAGTAGTAGTGTGTGCCCGTCTGTTG (SpeI U5GFP) R: ATTCTGCAGGTCGCCACCATGGTGAGC (PstI GFP)
PCR #6
F: TTGTGGCGGATCTTGAAGT (REAL GFP) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #7
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: TTAACTAGTACCGTATTACCGCCATGC (GFP SpeI)
PCR #8
F: TTGTGGCGGATCTTGAAGT (REAL GFP) R: CTGCTAGAGATTTTCCACACTG (U5 reverse strand)
The ligation product 2 was transformed to E. coli, on the remained clones, colony PCR was performed (PCR #6) (Table 1). To further confirm the pLenti-Pl/GFP, the plasmid was cut with the AflII restriction endonuclease. Construction and Confirmation of pLenti-F/GFP pGFP-Endo was digested with SpeI and KpnI to separate the CMV promoter fragment. The digested product of GFP Endo was run on 1 % agarose gel and CMV promoter fragment was extracted from the gel. pLenti-Pl/GFP was digested with SpeI and KpnI. To produce pLenti-F/GFP, the CMV promoter was ligated to the digested pLenti-Pl/ GFP using T4 DNA ligase (Ligation product #3). The ligation product 3 was transformed into E. coli and the selected clones were evaluated by PCR #7 (Table 1) and digestion with AflII.
production of recombinant lentivirus). In parallel, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLOX/EWgfp plasmids (for the production of native lentivirus), as positive control. After 16 h, the cells were analyzed for the expression of GFP using fluorescence microscopy (NikonInverted Microscope, Japan) and flow cytometry (FACS analysis-Becton, Dickinson and Company), then the media was changed to remove the transfection reagent and replaced with fresh DMEM ? 10 % FBS ? 1 % penicillin/streptomycin and incubated at 37 °C, 5 % CO2. After 24, 48, and 72 h, media were harvested from cells and pooled and stored at 4 °C. Media were centrifuged at 4500 rpm for 5 min to pellet any HEK-293T cells that were accidentally collected during harvesting. The harvested virus was stored at -70 °C. Lentiviral Titration
HEK293T Cell Line HEK293T cell line was provided by Pasteur Institute of Iran. The cells were maintained at 378 C in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, USA) containing 100 U/ml of penicillin and 100 mg/ml streptomycin, and supplemented with 10 % fetal calf or bovine serum (Sigma-Aldrich, USA). Lentivirus Packaging In the first step, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLenti-F/GFP (Transfer plasmid) using polyfect (Qiagen, Germany) (for the
Viral vector titers were assayed using NRC (National RNAi Core Facility) protocol by infection of 293T cells at different dilutions (102–106) in a 6-well plate (one mock well plus five dilutions) for every lentiviral stock (manipulated and control). After 14 days, FACS analyzes were performed for GFP expression and the percentage of cells that were GFP positive were record (Becton, Dickinson, and company). Formula for virus titer calculation was as follows: Titer = {(F 9 Cn)/V} 9 DF in which F is the frequency of GFP-positive cells determined by flow cytometry; Cn is the total number of target cells infected; V is the volume of the inoculum; and DF is the virus dilution factor.
123
Mol Biotechnol
0.5 ml of each of viruses was added. Cells were incubated for 18–20 h. The medium containing virus was removed from well and replaced with 1 ml of DMEM (Day 4 and forward). Medium was replaced every 2–3 days until GFP expression started. Cells were trypsinized, spinned, and resuspended in cold PBS for FACS analysis and the percentage of GFP-positive cells was recorded. Confirmation of the Presence of the Promoter Fragment Between the R and U5 in 30 LTR After transduction, the cells that expressed GFP were washed and DNA was extracted (Genet Bio DNA Extraction Kit, Korea) and PCR #8 was performed (Table 1).
Result Construction and Confirmation of pLenti-Empty Insert #1 was produced in three PCR reactions (Fig. 1c) and then digested with AflII. The size of PCR products 1, 2, & 3 were approximately 251, 263, and 285 bp. After digestion of pLenti4-GW/H1/TO-laminshRNA with AflII, two fragments were created: 3600 and 1600 bp. The PCR #4 was performed on the resulted clones of ligation between backbone of plasmid (3600 bp fragment) and Insert #1 and amplified a 450 bp fragment. On the other hand, after digestion of pLenti-Empty with AflII enzyme, two pieces 285 and 3600 were obtained. Construction and Confirmation of pLenti-Pl/GFP
Fig. 1 Recombinant vector construction. a pLenti4-GW/H1/TOlaminshRNA. b PCR product #1. c PCR product #3 (Insert #1). d GFP-Endo vector, e PCR product #5, f CMV promoter fragment after digestion with KpnI & SpeI, g pLenti-Pl/GFP, h pLenti-F/GFP
Insert #2 was produced after digestion of PCR #5 product with PstI and SpeI. Insert #2 contain CDS GFP, Poly A, and a section of pLenti4-GW/H1/TO-laminshRNA plasmid (Psi, PBS& U5). The size of PCR #5 product is 2900 bp (Fig. 2a). After digestion of pLenti-Empty with PstI and SpeI, the product run on 1 % agarose gel and 3885 bp fragment was extracted from the gel. The results of PCR #6 on pLentiPL/GFP clone revealed a 800 bp band. In other hand, after digestion of pLenti-PL/GFP with AflII enzyme, two pieces 3185 and 3600 are obtained.
Transduction of HEK293T Cell Line
Construction and Confirmation of pLenti-F/GFP
Approximately, 1.5 9 105 HEK293T cells were cultured in a 12-well plate and were incubated for 18–20 h at 37 °C in a humidified incubator in an atmosphere of 5 % CO2. After overnight incubation, the medium was replaced with 0.5 ml DMEM culture medium containing polybrene (Hexadimethrine bromide; Sigma #H9268), and then
The product of pGFP-Endo digestion with SpeI & KpnI was run on 1 % agarose gel, then the 600 bp fragment (CMV promoter fragment) (Insert #3) was extracted from the gel (Fig. 2b). After digestion of pLenti-Pl/GFP with SpeI & KpnI, the product was run on 1 % agarose gel and 6785 bp fragment
123
Mol Biotechnol Fig. 2 a (1) PCR product #5 that contains CDS GFP, Poly A, and a section of pLenti4-GW/ H1/TO-laminshRNA plasmid (Psi, PBS& U5), (2) 1 kb DNA Ladder. b (1) 1 kb DNA Ladder, (2) the product of pGFP Endo digestion with SpeI & KpnI (Insert #3)
was extracted from the gel. Ligation was performed between Insert #3 and 6785 bp fragment. This reaction occurred in colonies with PCR #7 product of 700 bp. In other hand, after digestion of pLenti-F/GFP with AflII enzyme, two pieces 3600 and 3185 are obtained. Lentiviral Packaging About 16 h after transfection, in the HEK293T cell line transfected with the three plasmids including psPAX2, pLenti-F/GFP, and PMD2G, the gfp gene was not found to be expressed but was found to be expressed in the HEK293T cells transfected with pLOX/CWgfp, psPAX2, and PMD2G (90 %) (Fig. 3). After the production of the lentivirus, the virus titer was calculated according to the formula. The titers obtained by GFP expression assay were approximately 3 9 105 and 2 9 105 for native and recombinant lentivirus, respectively. The GFP expression was seen in 78 and 50 % of the HEK293T cells that were transduced with native and recombinant lentivirus (Fig. 4). The PCR product 8 amplified a 1440 bp that confirmed the promoter fragment jumping and placed between the R and U5 in 30 LTR and GFP was expressed (Fig. 5).
Fig. 3 The flow cytometry of GFP expression in HEK293T cells after transfection. a The HEK293T cells were transfected with psPAX2, pLenti-F/GFP, and PMD2G. b The HEK293T cells were transfected with psPAX2, pLOX/CWgfp, and PMD2G. The horizontal axis was the fluorescence intensity of GFP
123
Mol Biotechnol
Fig. 4 The flow cytometry of GFP expression in HEK293T cells after transduction. a The HEK293T cells were transduced with native lentivirus. b The HEK293T cells were transduced with recombinant lentivirus. The horizontal axis was the fluorescence intensity of GFP
Fig. 5 PCR product #8. (1) Negative control reaction, (2) test reaction, (3) DNA ladder mix
Discussion Gene therapy is basically defined as the introduction of a normal functional copy of a defective or missing gene into the genome in order to restore normal function of the cell. Since cancer is a multi-step process with buildup of many
123
mutations during tumor evolution, correction of mutations is rather impossible [16]. Instead, gene therapy strategies with targeted killing of cancer cells are favored [16]. In suicide gene therapy, various cytotoxic genes, such as apoptotic factors or enzyme-prodrug and more recently DNases and intracellular antibodies targeting vital pathways of the cell, are delivered [7, 8, 19–21]. The result is tumor cell suicide without any negative effect on the surrounding normal cells [2]. It should be mentioned, however, that cancer cells may evolve mechanisms to resist these suicide strategies [8]. In the Suicide pro-drug approach, a vector carrying a gene such as bacterial cytosine deaminase is introduced into cancer cells. Then, the related prodrug 5-flouro cytosine is systematically delivered which is converted to cytotoxic drug, 5-fluorouracil, that kills the cancer cells. The method requires efficient transfer of the target gene followed by systematic delivery of the prodrug. As a more direct strategy, suicide toxin gene therapy can be used. Toxins are potent cytotoxic agents have the ability to kill cells efficiently, at very low concentrations and are attractive for cancer gene therapy [8, 22]. However, production of cytotoxic vectors for therapeutic gene delivery is challenging as uncontrolled cytotoxic gene expression can suppress protein synthesis and/or viability in producer cells [15]. As a possible solution, controlled transgene expression can be applied. For example, it has been reported that AAV vectors carrying the DT-A gene under control of the Tet-repressor system can be produced in HEK293 cells although the total yields are generally 2–3 logs lower than that of control AAV vectors due to promoter leakage and the consequent basal level of DT-A expression. This also demonstrates the poisonous effect of the toxin on the producer cells even at trace amounts which limits AAV vector production [15]. As an alternative solution is using tissue- or tumor-specific inducible promoters [12, 22–24]. One other solution to this dilemma is the generation of packaging cells resistant to the suicide genes. For example, Li et al. reported the generation of a DT-resistant HEK293 packaging cell line that could tolerate the toxin concentration up to 10–7 mol/l, and improved the adenovirus vector production yield [14]. In another study, this technical difficulty was resolved by the development of a DTresistant human cell line through site-directed mutagenesis of the human EF-2 gene [25]. Compounds to neutralize the effect of the suicide gene product in packaging cells have been applied in an investigation [26]. Lentiviral vectors are currently one of the most useful vectors in gene therapy experiments. They have medium capacity for transgene, and are able to transfect both dividing and non-dividing and even quiescent cells. Tissuespecific targeting through the formation of phenotypically mixed particles or pseudotypes, a process that commonly
Mol Biotechnol
occurs during viral assembly in cells infected with two or more viruses, are among other advantages of these vectors [27, 28]. Inserting a toxin-encoding gene into a lentiviral vector, which is expressed in packaging cells, would normally lead to very limited number of viral particles and the resultant decreased efficiency of gene therapy. As a result, viral vectors harboring a toxic gene must be grown under conditions that are not lethal to the host cell [22]. Given the strategies mentioned in the literature and the limitations specific to each one, it seems that specific designs which involve preventing the expression of toxin gene or pro-apoptotic factor in packaging cells would provide a proper solution for the maintenance of packaging cells and the resultant increase in the produced lentiviral titer. In this regard, we inserted the CMV promoter sequence on the lagging strand, between R and U5 sequences of the 50 LTR, and added toxin-encoding or reporter gene (gfp in this study) in the same direction as the promoter on the same strand and adjacent to (upstream of) 30 LTR. Under the circumstances, after co-transfection of the plasmid carrying the toxin-encoding gene (or gfp in our case) with two other plasmids including psPAX and PMD2G, the viral genomic RNA was transcribed from the R to R but due to the lack of an upstream promoter sequence gfp could not be expressed. Thus, the toxin or reporter encoding gene failed to be expressed in this stage, and the packaging cells remained intact. The viral particles were produced and collected from the soup on top of the cells. After transduction of target cells by the produced viral particles based on the viral life cycle [16, 18], it is expected that the promoter be positioned before the gfp cassette, through jumping process in lentiviral life cycle. Therefore, under the conditions, the toxin or reporter gene is expressed in the target cancer cells but not in packaging cells. Earlier studies have proved that presence of DU3 between the promoter and gene has no effect on gene expression [29]. The strategy described above enables us to use a broad spectrum of toxin gene in gene therapy experiments. The toxic vectors that are produced in this way can be directly toxic to the target cells upon transduction and has no need to the pro-drug administration. It helps avoid the death of the packaging cells in which lentiviral vectors carrying a toxin-encoding gene are being produced. This can also help overcome the problem of partial leakage of the inducible promoters. Given the satisfactory results of this SIN vector (SelfInactivating Lentivirus Vector), it could have other applications. In an experiment that gene expression cassette was inserted in lagging strand of DEST plasmid of lenti viral vector, the transcript of the gene was complemented with genomic RNA of the produced virus in packaging cells and
induced silencing machinery of the cell and thereby the majority of genomic RNA of the viral particle was destructed. Also, in lentiviral vectors, if there are expression cassettes on lagging strand, transcription of these genes can be complemented with viral genome, and can make dsRNA which induces silencing machine of the cell. However, with our strategy used in this study, due to the specific position of promoter in this vector, the genes on lagging strand cannot be transcribed in 293T cells and gene silencing cannot affect virus titer. Moreover, there is a hindrance in using lentiviral vector expressing zinc finger nucleases (ZFNs) or other gene editing tools like TALEN and Crispr against LTR sequence for augmenting integrase-defective lentiviral vectors (IDLVs) and targeting HIV genome in gene therapy of AIDS. Each of the ZFNs that targets HIV can be expressed and inevitably destroys transfer plasmid in packaging cells and halts the production of viral particles. To address this issue, currently, the sequences encoding ZFNs are designed in two IDLVs that are associated with gene transfer plasmid and three separate viruses should be produced to transduce the target cells 28, 30]. However, the lentiviral vector designed in this study decreases the requirement of using three lentiviral vectors for ZFNs and instead one vector can be used. Acknowledgments We are deeply grateful to all the colleagues of Department of Genetics and Molecular Biology. This work was supported by a grant from the Isfahan University of Medical Sciences. Ethical standards This article does not contain any studies with human participants or animals performed by any of the authors.
References 1. Escors, D., & Breckpot, K. (2010). Lentiviral vectors in gene therapy: their current status and future potential. Archivum Immunologiae et Therapiae Experimentalis, 58, 107–119. 2. Yazawa, K., Fisher, W. E., & Brunicardi, F. C. (2002). Current progress in suicide gene therapy for cancer. World Journal of Surgery, 26, 783–789. 3. Malecki, M. (2012). Frontiers in suicide gene therapy of cancer. Journal of Genetic Syndromes and Gene Therapy, 3, e114. 4. Salvatorelli, E., Menna, P., Cantalupo, E., Chello, M., Covino, E., Wolf, F. I., & Minotti, G. (2015). The concomitant management of cancer therapy and cardiac therapy. Biochimica et Biophysica Acta. doi:10.1016/j.bbamem.2015.01.003. 5. Springer, C. J., & Niculescu-Duvaz, I. (2000). Prodrug-activating systems in suicide gene therapy. The Journal of Clinical Investigation, 105, 1161–1167. 6. Duarte, S., Carle, G., Faneca, H., de Lima, M. C., & PierrefiteCarle, V. (2012). Suicide gene therapy in cancer: Where do we stand now? Cancer Letters, 324, 160–170. 7. Zarogoulidis, P., Darwiche, K., Sakkas, A., Yarmus, L., Huang, H., Li, Q., et al. (2013). Suicide gene therapy for cancer—current strategies. Journal of Genetic Syndromes & Gene Therapy, 4, 16849. 8. Yang, W. S., Park, S. O., Yoon, A. R., Yoo, J. Y., Kim, M. K., Yun, C. O., & Kim, C. W. (2006). Suicide cancer gene therapy
123
Mol Biotechnol
9.
10.
11.
12.
13.
14.
15.
16. 17.
18. 19.
using pore-forming toxin, streptolysin O. Molecular Cancer Therapeutics, 5, 1610–1619. Chen, H. (2012). Exploiting the intron-splicing mechanism of insect cells to produce viral vectors harboring toxic genes for suicide gene therapy. Molecular Therapy—Nucleic Acids, 1, e57. Massuda, E. S., Dunphy, E. J., Redman, R. A., Schreiber, J. J., Nauta, L. E., Barr, F. G., et al. (1997). Regulated expression of the diphtheria toxin A chain by a tumor-specific chimeric transcription factor results in selective toxicity for alveolar rhabdomyosarcoma cells. Proceedings of the National Academy of Sciences USA, 94, 14701–14706. Keyvani, K., Baur, I., & Paulus, W. (1999). Tetracycline-controlled expression but not toxicity of an attenuated diphtheria toxin mutant. Life Sciences, 64, 17124. Wang, C. Y., Li, F., Yang, Y., Guo, H. Y., Wu, C. X., & Wang, S. (2006). Recombinant baculovirus containing the diphtheria toxin A gene for malignant glioma therapy. Cancer Research, 66, 5798–5806. Kurayoshi, K., Ozono, E., Iwanaga, R., Bradford, A. P., Komori, H., & Ohtani, K. (2014). Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs. Biochemical and Biophysical Research Communications, 450, 240–246. Li, Y., McCadden, J., Ferrer, F., Kruszewski, M., Carducci, M., Simons, J., & Rodriguez, R. (2002). Prostate-specific expression of the diphtheria toxin A chain (DT-A): Studies of inducibility and specificity of expression of prostate-specific antigen promoter-driven DT-A adenoviral-mediated gene transfer. Cancer Research, 62, 2576–2582. Kohlschutter, J., Michelfelder, S., & Trepel, M. (2010). Novel cytotoxic vectors based on adeno-associated virus. Toxins (Basel), 2, 2754–2768. McTaggart, S., & Al-Rubeai, M. (2002). Retroviral vectors for human gene delivery. Biotechnology Advances, 20, 1–31. Santhosh, C. V., Tamhane, M. C., Kamat, R. H., Patel, V. V., & Mukhopadhyaya, R. (2008). A lentiviral vector with novel multiple cloning sites: Stable transgene expression in vitro and in vivo. Biochemical and Biophysical Research Communications, 371, 546–550. Freed, E. O. (2001). HIV-1 replication. Somatic Cell and Molecular Genetics, 26, 13–33. Vecil, G. G., & Lang, F. F. (2003). Clinical trials of adenoviruses in brain tumors: A review of Ad-p53 and oncolytic adenoviruses. Journal of Neuro-oncology, 65, 237–246.
123
20. Sudarshan, S., Holman, D. H., Hyer, M. L., Voelkel-Johnson, C., Dong, J. Y., & Norris, J. S. (2005). In vitro efficacy of Fas ligand gene therapy for the treatment of bladder cancer. Cancer Gene Therapy, 12, 12–18. 21. Ozawa, T., Hu, J. L., Hu, L. J., Kong, E. L., Bollen, A. W., Lamborn, K. R., & Deen, D. F. (2005). Functionality of hypoxiainduced BAX expression in a human glioblastoma xenograft model. Cancer Gene Therapy, 12, 449–455. 22. Chen, H. (2012). Exploiting the intron-splicing mechanism of insect cells to produce viral vectors harboring toxic genes for suicide gene therapy. Molecular Therapy—Nucleic Acids, 1, e57. 23. Maxwell, I. H., Maxwell, F., & Glode, L. M. (1986). Regulated expression of a diphtheria toxin A-chain gene transfected into human cells: possible strategy for inducing cancer cell suicide. Cancer Research, 46, 4660–4664. 24. Goverdhana, S., Puntel, M., Xiong, W., Zirger, J. M., Barcia, C., Curtin, J. F., et al. (2005). Regulatable gene expression systems for gene therapy applications: progress and future challenges. Molecular Therapy, 12, 189–211. 25. Wang, Z., Tang, Z., Zheng, Y., Yu, D., Spear, M., Iyer, S. R., et al. (2010). Development of a nonintegrating Rev-dependent lentiviral vector carrying diphtheria toxin A chain and human TRAF6 to target HIV reservoirs. Gene Therapy, 17, 1063–1076. 26. Young, J., Tang, Z., Yu, Q., Yu, D., & Wu, Y. (2008). Selective killing of HIV-1-positive macrophages and T cells by the Revdependent lentivirus carrying anthrolysin O from Bacillus anthracis. Retrovirology, 5, 36. 27. Vigna, E., & Naldini, L. (2000). Lentiviral vectors: Excellent tools for experimental gene transfer and promising candidates for gene therapy. The Journal of Gene Medicine, 2, 308–316. 28. Pluta, K., & Kacprzak, M. M. (2009). Use of HIV as a gene transfer vector. Acta Biochimica Polonica, 56, 531–595. 29. Ghanbari, J. A., Salehi, M., Zadeh, A. K., Zadeh, S. M., Beigi, V. B., Ahmad, H. K., et al. (2014). A preliminary step of a novel strategy in suicide gene therapy with lentiviral vector. Advanced Biomedical Research, 3, 7. 30. Matrai, J., Chuah, M. K., & VandenDriessche, T. (2010). Recent advances in lentiviral vector development and applications. Molecular Therapy, 18, 477–490.
RESEARCH
A Lentiviral Vector Expressing Desired Gene Only in Transduced Cells: An Approach for Suicide Gene Therapy Zahra Mohammadi1 • Laleh Shariati2 • Hossein Khanahmad1,3 • Mahsa Kolahdouz1 Fariborz Kianpoor4 • Jahan Afrooz Ghanbari1 • Zahra Hejazi1 • Mansoor Salehi1 • Parvaneh Nikpour1,3,5 • Mohammad Amin Tabatabaiefar1,3
•
Ó Springer Science+Business Media New York 2015
Abstract Suicide gene therapy is a therapeutic strategy, in which cell suicide inducing transgenes are introduced into target cells. Inserting a toxin-encoding gene into a lentiviral vector leads to decreased efficiency of virus production due to lethal effect of toxin on packaging cells. In this study, we designed and constructed a transfer vector to express the toxin in transduced cells but not in packaging cells. Plasmid pLenti-F/GFP was constructed by cutting out R 50 LTR-R 30 LTR fragment with the AflII restriction endonuclease from a plasmid pLenti4-GW/H1/TO-laminshRNA, followed by ligating R 50 LTR-R 30 LTR fragment, constructed by three PCR stages. The promoter and GFP CDS were inserted in opposite strand. For lentiviral production, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLenti-F/GFP plasmids (envelope, packaging, and transfer plasmids).Viral vector titers were assayed. The HEK293T cell line was transduced with this virus. PCR was performed to confirm the presence of the promoter fragment between the R and U5 in 30 LTR. The
& Hossein Khanahmad [email protected] 1
Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2
Department of Molecular Medicine, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran, Iran
3
Child Growth and Development Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
4
Department of Immunology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
5
Applied Physiology Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
lentivirus titers were approximately 2 9 105. The GFP expression was seen in 51 % of the HEK293T cells transduced with lentivirus. The PCR product size was 1440 bp confirming the promoter fragment position between the R and U5 in 30 LTR. The strategy enables us to use a broad spectrum of toxin genes in gene therapy and helps avoid the death of the packaging cells with lentiviral vectors carrying a toxin-encoding gene, thereby increasing the efficiency of viral production in packaging cells. Keywords
Lentivirus Suicide gene therapy Cancer
Introduction Gene therapy has been acknowledged to be a revolutionary technology which has the potential to cure almost all life threatening diseases the bases of which have been elucidated. A successful gene therapy procedure involves specific, efficient, and stable incorporation of a gene of interest (GOI) into the target cell [1]. Unlike the initial use of gene therapy for disease with identified molecular etiology, it has now been mostly focused on cancer which is genetic but very complex in nature [2]. The current therapies of cancer mostly involve systematic administration of therapeutic agents with serious complications. Therefore, the dosage of chemotherapeutics or radiation should be reduced well below the effective levels to avoid those side effects. Selective eradication of cancer cells is especially important in cases in which they are mixed with the healthy cells. Neither the surgical resection not radiation therapy are able to fulfill the purpose. Most of the exposed cells particularly those of reproductive, immune, and hormonal systems may be affected [3, 4]. Furthermore, the efficacy of these methodologies is often impeded by an inadequate
123
Mol Biotechnol
therapeutic index, lack of specificity, and the development of drug-resistant cell sub-populations [5]. Immunotherapy can target healthy cells when the used antibodies are of less specificity or there is cross reactivity which may lead to serious complications. In cancer gene therapy, some approaches have been taken such as mutation correction, enhancement of the immune response, RNA interference and targeted virus-mediated killing of tumor cells, and anti-angiogenic therapy [6]. Suicide gene therapy trials have shown to be more promising than other available gene therapy strategies [3]. Suicide gene therapy is a therapeutic strategy, in which a transgene can induce cell suicide upon its introduction into cancer cells [7]. The concept of ‘‘suicide genes’’ was suggested in the late 1980s for cancer gene therapy using either toxin gene therapy, in which toxic-encoding genes are transfected directly into tumor cells, or enzyme-activating prodrug therapy, in which the transgene product converts a specific prodrugs to a toxic products [5]. Important genes used in suicide gene therapy include genes encoding apoptotic factors, thymidine kinases, cytosine deaminases, intracellular antibodies, telomerases, caspases, and Dnases [3, 8]. Toxins are potent cell toxicity agents used frequently in cancer therapy. Diphtheria toxin (DT) and pseudomonas exotoxin are best examples of these agents. As regard to DT, one single molecule can kill a cell. The toxin catalyzes ADP-ribosylation of the elongation factor 2 (EF2), thereby blocking the translational machinery of target cells [9]. Targeted cell toxicity of DT has been achieved using an inducible and/or tissue-specific promoters [9–13]. An alternative method is generation of a DT-resistant HEK293 packaging cell line that can tolerate high concentration of the toxin (up to 10–7 mol/l), thereby improving the production of the adenovirus vector [14]. As another strategy, for AAV vectors carrying the DT-A gene, the TetR repressor system was used to decrease the expression in packaging cell of DTA but the viral yield was shown to be 2–3 logs lower than AAV vectors that did not carry the DT-A gene [15]. Viral vectors are known as the most effective means of delivering a therapeutic gene into human cells. Nevertheless, application of the viral-based vectors, such as adenovirus, recombinant, and AAV, for the delivery of toxic genes to a target cell has been largely impeded by the toxicity of the toxic gene [9]. Lentiviral vectors are presently the most common type used in clinical trials [16, 17]. However, placing a toxin gene in a transfer lentiviral vector is lethal for the host cell and lead to decrease in the yield of virus in packaging cells which, in turn, reduces the efficiency of gene therapy. During the lentivirus life cycle, the U3 of 50 LTR is copied from 30 LTR and U5 of 30 LTR copied from 50 LTR. Once reverse transcription occurs, the U5 of 50 LTR jumps to the R region at the 30 end of
123
the genome [16, 18]. In this study, for the first time, a lentiviral dest plasmid was designed with a CMV promoter on lagging strand between R and U5 at 50 LTR and a CDS ? poly A signal on lagging strand before 30 LTR. According to jumping in the lentivirus life cycle, the construct is able to express the GFP in transduced cells but not in packaging cells.
Materials and Methods Construction and Confirmation of pLenti-Empty Plasmid pLenti-Empty was constructed by the following steps: first cutting out R 50 LTR-R 30 LTR fragment with the AflII from a plasmid pLenti4-GW/H1/TO-laminshRNA (Invitrogen), followed by ligating R 50 LTR-R 30 LTR fragment (Insert #1) that in three consecutive PCR stages was constructed (Table 1). PCR #1 was performed on pLenti4GW/H1/TO-laminshRNA (Fig. 1a) and PCR #2 & 3 each was performed on PCR 1 & 2 products (Fig. 1b). In each step, PCR product was cleaned up using Bioneer kit (Korea) according to the manufacturer’s instructions. During the construction of this fragment, sites for four restriction endonucleases (PstI, SpeI, KpnI & AflII) were inserted to certain places as to enable us to clone other fragments later. PCR product 3 was digested with AflII followed by cleanup (Insert #1). The pLenti4-GW/H1/TO-laminshRNA was digested with AflII. The product was run on 1 % agarose gel and the plasmid backbone was extracted from the gel. To produce pLenti-Empty, the digested PCR product 3 was ligated to backbone of pLenti4-GW/H1/TOlaminshRNA using T4 DNA ligase (Ligation product #1). Escherichia coli strain TOP10F0 was obtained from Pasteur Institute of Iran and transformed by Ligation product 1 according to the chemical method of Higa and Mandel protocol. Transformed bacteria were cultured in LB agar medium containing 100 lg/ml ampicillin. After overnight culture, some colonies were picked up. The resulted clones were assessed by PCR (PCR4) and digestion with AflII (Table 1). After confirmation, the colony was cultured and pLenti-Empty was extracted using SolGentTM plasmid Mini Prep Kit (Korea) following the manufacturer’s instruction. Construction and Confirmation of pLenti-Pl/GFP PCR #5 reaction (Table 1) was performed on a lentivirus plasmid with its gfp on the opposite strand (pGFP-Endo) to amplify a sequence from the gfp gene to 50 LTR U5 (Table 1). The PCR product #5 and pLenti-Empty were digested with PstI and SpeI in separate steps. The PCR product #5 after digestion was named Insert #2. The products were run on 1 % agarose gel. The target products were extracted from the gel and ligated. (Ligation product #2).
Mol Biotechnol Table 1 Primer sequences
PCR n.
Primer sequences (50 ? 30 )
PCR #1
F: CTTCAGGTACCTTAACTAGTTATCTGCAGTACCTTTAAGAC CAATGACTTACAAG (F1) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #2
F: TTGCCTTGAGTGCTTCAGGTACCTTAACTAGTTATCTGC (F2) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #3
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #4
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: CTGCTAGAGATTTTCCACACTG (U5 Reverse backbone)
PCR #5
F: ATTACTAGTAGTAGTGTGTGCCCGTCTGTTG (SpeI U5GFP) R: ATTCTGCAGGTCGCCACCATGGTGAGC (PstI GFP)
PCR #6
F: TTGTGGCGGATCTTGAAGT (REAL GFP) R: TGAGGCTTAAGCAGTGGGTTCC (Reverse AflII)
PCR #7
F: ATACTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAGGTACC (F3) R: TTAACTAGTACCGTATTACCGCCATGC (GFP SpeI)
PCR #8
F: TTGTGGCGGATCTTGAAGT (REAL GFP) R: CTGCTAGAGATTTTCCACACTG (U5 reverse strand)
The ligation product 2 was transformed to E. coli, on the remained clones, colony PCR was performed (PCR #6) (Table 1). To further confirm the pLenti-Pl/GFP, the plasmid was cut with the AflII restriction endonuclease. Construction and Confirmation of pLenti-F/GFP pGFP-Endo was digested with SpeI and KpnI to separate the CMV promoter fragment. The digested product of GFP Endo was run on 1 % agarose gel and CMV promoter fragment was extracted from the gel. pLenti-Pl/GFP was digested with SpeI and KpnI. To produce pLenti-F/GFP, the CMV promoter was ligated to the digested pLenti-Pl/ GFP using T4 DNA ligase (Ligation product #3). The ligation product 3 was transformed into E. coli and the selected clones were evaluated by PCR #7 (Table 1) and digestion with AflII.
production of recombinant lentivirus). In parallel, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLOX/EWgfp plasmids (for the production of native lentivirus), as positive control. After 16 h, the cells were analyzed for the expression of GFP using fluorescence microscopy (NikonInverted Microscope, Japan) and flow cytometry (FACS analysis-Becton, Dickinson and Company), then the media was changed to remove the transfection reagent and replaced with fresh DMEM ? 10 % FBS ? 1 % penicillin/streptomycin and incubated at 37 °C, 5 % CO2. After 24, 48, and 72 h, media were harvested from cells and pooled and stored at 4 °C. Media were centrifuged at 4500 rpm for 5 min to pellet any HEK-293T cells that were accidentally collected during harvesting. The harvested virus was stored at -70 °C. Lentiviral Titration
HEK293T Cell Line HEK293T cell line was provided by Pasteur Institute of Iran. The cells were maintained at 378 C in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, USA) containing 100 U/ml of penicillin and 100 mg/ml streptomycin, and supplemented with 10 % fetal calf or bovine serum (Sigma-Aldrich, USA). Lentivirus Packaging In the first step, the HEK293T cell line was co-transfected with the PMD2G, psPAX2, and pLenti-F/GFP (Transfer plasmid) using polyfect (Qiagen, Germany) (for the
Viral vector titers were assayed using NRC (National RNAi Core Facility) protocol by infection of 293T cells at different dilutions (102–106) in a 6-well plate (one mock well plus five dilutions) for every lentiviral stock (manipulated and control). After 14 days, FACS analyzes were performed for GFP expression and the percentage of cells that were GFP positive were record (Becton, Dickinson, and company). Formula for virus titer calculation was as follows: Titer = {(F 9 Cn)/V} 9 DF in which F is the frequency of GFP-positive cells determined by flow cytometry; Cn is the total number of target cells infected; V is the volume of the inoculum; and DF is the virus dilution factor.
123
Mol Biotechnol
0.5 ml of each of viruses was added. Cells were incubated for 18–20 h. The medium containing virus was removed from well and replaced with 1 ml of DMEM (Day 4 and forward). Medium was replaced every 2–3 days until GFP expression started. Cells were trypsinized, spinned, and resuspended in cold PBS for FACS analysis and the percentage of GFP-positive cells was recorded. Confirmation of the Presence of the Promoter Fragment Between the R and U5 in 30 LTR After transduction, the cells that expressed GFP were washed and DNA was extracted (Genet Bio DNA Extraction Kit, Korea) and PCR #8 was performed (Table 1).
Result Construction and Confirmation of pLenti-Empty Insert #1 was produced in three PCR reactions (Fig. 1c) and then digested with AflII. The size of PCR products 1, 2, & 3 were approximately 251, 263, and 285 bp. After digestion of pLenti4-GW/H1/TO-laminshRNA with AflII, two fragments were created: 3600 and 1600 bp. The PCR #4 was performed on the resulted clones of ligation between backbone of plasmid (3600 bp fragment) and Insert #1 and amplified a 450 bp fragment. On the other hand, after digestion of pLenti-Empty with AflII enzyme, two pieces 285 and 3600 were obtained. Construction and Confirmation of pLenti-Pl/GFP
Fig. 1 Recombinant vector construction. a pLenti4-GW/H1/TOlaminshRNA. b PCR product #1. c PCR product #3 (Insert #1). d GFP-Endo vector, e PCR product #5, f CMV promoter fragment after digestion with KpnI & SpeI, g pLenti-Pl/GFP, h pLenti-F/GFP
Insert #2 was produced after digestion of PCR #5 product with PstI and SpeI. Insert #2 contain CDS GFP, Poly A, and a section of pLenti4-GW/H1/TO-laminshRNA plasmid (Psi, PBS& U5). The size of PCR #5 product is 2900 bp (Fig. 2a). After digestion of pLenti-Empty with PstI and SpeI, the product run on 1 % agarose gel and 3885 bp fragment was extracted from the gel. The results of PCR #6 on pLentiPL/GFP clone revealed a 800 bp band. In other hand, after digestion of pLenti-PL/GFP with AflII enzyme, two pieces 3185 and 3600 are obtained.
Transduction of HEK293T Cell Line
Construction and Confirmation of pLenti-F/GFP
Approximately, 1.5 9 105 HEK293T cells were cultured in a 12-well plate and were incubated for 18–20 h at 37 °C in a humidified incubator in an atmosphere of 5 % CO2. After overnight incubation, the medium was replaced with 0.5 ml DMEM culture medium containing polybrene (Hexadimethrine bromide; Sigma #H9268), and then
The product of pGFP-Endo digestion with SpeI & KpnI was run on 1 % agarose gel, then the 600 bp fragment (CMV promoter fragment) (Insert #3) was extracted from the gel (Fig. 2b). After digestion of pLenti-Pl/GFP with SpeI & KpnI, the product was run on 1 % agarose gel and 6785 bp fragment
123
Mol Biotechnol Fig. 2 a (1) PCR product #5 that contains CDS GFP, Poly A, and a section of pLenti4-GW/ H1/TO-laminshRNA plasmid (Psi, PBS& U5), (2) 1 kb DNA Ladder. b (1) 1 kb DNA Ladder, (2) the product of pGFP Endo digestion with SpeI & KpnI (Insert #3)
was extracted from the gel. Ligation was performed between Insert #3 and 6785 bp fragment. This reaction occurred in colonies with PCR #7 product of 700 bp. In other hand, after digestion of pLenti-F/GFP with AflII enzyme, two pieces 3600 and 3185 are obtained. Lentiviral Packaging About 16 h after transfection, in the HEK293T cell line transfected with the three plasmids including psPAX2, pLenti-F/GFP, and PMD2G, the gfp gene was not found to be expressed but was found to be expressed in the HEK293T cells transfected with pLOX/CWgfp, psPAX2, and PMD2G (90 %) (Fig. 3). After the production of the lentivirus, the virus titer was calculated according to the formula. The titers obtained by GFP expression assay were approximately 3 9 105 and 2 9 105 for native and recombinant lentivirus, respectively. The GFP expression was seen in 78 and 50 % of the HEK293T cells that were transduced with native and recombinant lentivirus (Fig. 4). The PCR product 8 amplified a 1440 bp that confirmed the promoter fragment jumping and placed between the R and U5 in 30 LTR and GFP was expressed (Fig. 5).
Fig. 3 The flow cytometry of GFP expression in HEK293T cells after transfection. a The HEK293T cells were transfected with psPAX2, pLenti-F/GFP, and PMD2G. b The HEK293T cells were transfected with psPAX2, pLOX/CWgfp, and PMD2G. The horizontal axis was the fluorescence intensity of GFP
123
Mol Biotechnol
Fig. 4 The flow cytometry of GFP expression in HEK293T cells after transduction. a The HEK293T cells were transduced with native lentivirus. b The HEK293T cells were transduced with recombinant lentivirus. The horizontal axis was the fluorescence intensity of GFP
Fig. 5 PCR product #8. (1) Negative control reaction, (2) test reaction, (3) DNA ladder mix
Discussion Gene therapy is basically defined as the introduction of a normal functional copy of a defective or missing gene into the genome in order to restore normal function of the cell. Since cancer is a multi-step process with buildup of many
123
mutations during tumor evolution, correction of mutations is rather impossible [16]. Instead, gene therapy strategies with targeted killing of cancer cells are favored [16]. In suicide gene therapy, various cytotoxic genes, such as apoptotic factors or enzyme-prodrug and more recently DNases and intracellular antibodies targeting vital pathways of the cell, are delivered [7, 8, 19–21]. The result is tumor cell suicide without any negative effect on the surrounding normal cells [2]. It should be mentioned, however, that cancer cells may evolve mechanisms to resist these suicide strategies [8]. In the Suicide pro-drug approach, a vector carrying a gene such as bacterial cytosine deaminase is introduced into cancer cells. Then, the related prodrug 5-flouro cytosine is systematically delivered which is converted to cytotoxic drug, 5-fluorouracil, that kills the cancer cells. The method requires efficient transfer of the target gene followed by systematic delivery of the prodrug. As a more direct strategy, suicide toxin gene therapy can be used. Toxins are potent cytotoxic agents have the ability to kill cells efficiently, at very low concentrations and are attractive for cancer gene therapy [8, 22]. However, production of cytotoxic vectors for therapeutic gene delivery is challenging as uncontrolled cytotoxic gene expression can suppress protein synthesis and/or viability in producer cells [15]. As a possible solution, controlled transgene expression can be applied. For example, it has been reported that AAV vectors carrying the DT-A gene under control of the Tet-repressor system can be produced in HEK293 cells although the total yields are generally 2–3 logs lower than that of control AAV vectors due to promoter leakage and the consequent basal level of DT-A expression. This also demonstrates the poisonous effect of the toxin on the producer cells even at trace amounts which limits AAV vector production [15]. As an alternative solution is using tissue- or tumor-specific inducible promoters [12, 22–24]. One other solution to this dilemma is the generation of packaging cells resistant to the suicide genes. For example, Li et al. reported the generation of a DT-resistant HEK293 packaging cell line that could tolerate the toxin concentration up to 10–7 mol/l, and improved the adenovirus vector production yield [14]. In another study, this technical difficulty was resolved by the development of a DTresistant human cell line through site-directed mutagenesis of the human EF-2 gene [25]. Compounds to neutralize the effect of the suicide gene product in packaging cells have been applied in an investigation [26]. Lentiviral vectors are currently one of the most useful vectors in gene therapy experiments. They have medium capacity for transgene, and are able to transfect both dividing and non-dividing and even quiescent cells. Tissuespecific targeting through the formation of phenotypically mixed particles or pseudotypes, a process that commonly
Mol Biotechnol
occurs during viral assembly in cells infected with two or more viruses, are among other advantages of these vectors [27, 28]. Inserting a toxin-encoding gene into a lentiviral vector, which is expressed in packaging cells, would normally lead to very limited number of viral particles and the resultant decreased efficiency of gene therapy. As a result, viral vectors harboring a toxic gene must be grown under conditions that are not lethal to the host cell [22]. Given the strategies mentioned in the literature and the limitations specific to each one, it seems that specific designs which involve preventing the expression of toxin gene or pro-apoptotic factor in packaging cells would provide a proper solution for the maintenance of packaging cells and the resultant increase in the produced lentiviral titer. In this regard, we inserted the CMV promoter sequence on the lagging strand, between R and U5 sequences of the 50 LTR, and added toxin-encoding or reporter gene (gfp in this study) in the same direction as the promoter on the same strand and adjacent to (upstream of) 30 LTR. Under the circumstances, after co-transfection of the plasmid carrying the toxin-encoding gene (or gfp in our case) with two other plasmids including psPAX and PMD2G, the viral genomic RNA was transcribed from the R to R but due to the lack of an upstream promoter sequence gfp could not be expressed. Thus, the toxin or reporter encoding gene failed to be expressed in this stage, and the packaging cells remained intact. The viral particles were produced and collected from the soup on top of the cells. After transduction of target cells by the produced viral particles based on the viral life cycle [16, 18], it is expected that the promoter be positioned before the gfp cassette, through jumping process in lentiviral life cycle. Therefore, under the conditions, the toxin or reporter gene is expressed in the target cancer cells but not in packaging cells. Earlier studies have proved that presence of DU3 between the promoter and gene has no effect on gene expression [29]. The strategy described above enables us to use a broad spectrum of toxin gene in gene therapy experiments. The toxic vectors that are produced in this way can be directly toxic to the target cells upon transduction and has no need to the pro-drug administration. It helps avoid the death of the packaging cells in which lentiviral vectors carrying a toxin-encoding gene are being produced. This can also help overcome the problem of partial leakage of the inducible promoters. Given the satisfactory results of this SIN vector (SelfInactivating Lentivirus Vector), it could have other applications. In an experiment that gene expression cassette was inserted in lagging strand of DEST plasmid of lenti viral vector, the transcript of the gene was complemented with genomic RNA of the produced virus in packaging cells and
induced silencing machinery of the cell and thereby the majority of genomic RNA of the viral particle was destructed. Also, in lentiviral vectors, if there are expression cassettes on lagging strand, transcription of these genes can be complemented with viral genome, and can make dsRNA which induces silencing machine of the cell. However, with our strategy used in this study, due to the specific position of promoter in this vector, the genes on lagging strand cannot be transcribed in 293T cells and gene silencing cannot affect virus titer. Moreover, there is a hindrance in using lentiviral vector expressing zinc finger nucleases (ZFNs) or other gene editing tools like TALEN and Crispr against LTR sequence for augmenting integrase-defective lentiviral vectors (IDLVs) and targeting HIV genome in gene therapy of AIDS. Each of the ZFNs that targets HIV can be expressed and inevitably destroys transfer plasmid in packaging cells and halts the production of viral particles. To address this issue, currently, the sequences encoding ZFNs are designed in two IDLVs that are associated with gene transfer plasmid and three separate viruses should be produced to transduce the target cells 28, 30]. However, the lentiviral vector designed in this study decreases the requirement of using three lentiviral vectors for ZFNs and instead one vector can be used. Acknowledgments We are deeply grateful to all the colleagues of Department of Genetics and Molecular Biology. This work was supported by a grant from the Isfahan University of Medical Sciences. Ethical standards This article does not contain any studies with human participants or animals performed by any of the authors.
References 1. Escors, D., & Breckpot, K. (2010). Lentiviral vectors in gene therapy: their current status and future potential. Archivum Immunologiae et Therapiae Experimentalis, 58, 107–119. 2. Yazawa, K., Fisher, W. E., & Brunicardi, F. C. (2002). Current progress in suicide gene therapy for cancer. World Journal of Surgery, 26, 783–789. 3. Malecki, M. (2012). Frontiers in suicide gene therapy of cancer. Journal of Genetic Syndromes and Gene Therapy, 3, e114. 4. Salvatorelli, E., Menna, P., Cantalupo, E., Chello, M., Covino, E., Wolf, F. I., & Minotti, G. (2015). The concomitant management of cancer therapy and cardiac therapy. Biochimica et Biophysica Acta. doi:10.1016/j.bbamem.2015.01.003. 5. Springer, C. J., & Niculescu-Duvaz, I. (2000). Prodrug-activating systems in suicide gene therapy. The Journal of Clinical Investigation, 105, 1161–1167. 6. Duarte, S., Carle, G., Faneca, H., de Lima, M. C., & PierrefiteCarle, V. (2012). Suicide gene therapy in cancer: Where do we stand now? Cancer Letters, 324, 160–170. 7. Zarogoulidis, P., Darwiche, K., Sakkas, A., Yarmus, L., Huang, H., Li, Q., et al. (2013). Suicide gene therapy for cancer—current strategies. Journal of Genetic Syndromes & Gene Therapy, 4, 16849. 8. Yang, W. S., Park, S. O., Yoon, A. R., Yoo, J. Y., Kim, M. K., Yun, C. O., & Kim, C. W. (2006). Suicide cancer gene therapy
123
Mol Biotechnol
9.
10.
11.
12.
13.
14.
15.
16. 17.
18. 19.
using pore-forming toxin, streptolysin O. Molecular Cancer Therapeutics, 5, 1610–1619. Chen, H. (2012). Exploiting the intron-splicing mechanism of insect cells to produce viral vectors harboring toxic genes for suicide gene therapy. Molecular Therapy—Nucleic Acids, 1, e57. Massuda, E. S., Dunphy, E. J., Redman, R. A., Schreiber, J. J., Nauta, L. E., Barr, F. G., et al. (1997). Regulated expression of the diphtheria toxin A chain by a tumor-specific chimeric transcription factor results in selective toxicity for alveolar rhabdomyosarcoma cells. Proceedings of the National Academy of Sciences USA, 94, 14701–14706. Keyvani, K., Baur, I., & Paulus, W. (1999). Tetracycline-controlled expression but not toxicity of an attenuated diphtheria toxin mutant. Life Sciences, 64, 17124. Wang, C. Y., Li, F., Yang, Y., Guo, H. Y., Wu, C. X., & Wang, S. (2006). Recombinant baculovirus containing the diphtheria toxin A gene for malignant glioma therapy. Cancer Research, 66, 5798–5806. Kurayoshi, K., Ozono, E., Iwanaga, R., Bradford, A. P., Komori, H., & Ohtani, K. (2014). Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs. Biochemical and Biophysical Research Communications, 450, 240–246. Li, Y., McCadden, J., Ferrer, F., Kruszewski, M., Carducci, M., Simons, J., & Rodriguez, R. (2002). Prostate-specific expression of the diphtheria toxin A chain (DT-A): Studies of inducibility and specificity of expression of prostate-specific antigen promoter-driven DT-A adenoviral-mediated gene transfer. Cancer Research, 62, 2576–2582. Kohlschutter, J., Michelfelder, S., & Trepel, M. (2010). Novel cytotoxic vectors based on adeno-associated virus. Toxins (Basel), 2, 2754–2768. McTaggart, S., & Al-Rubeai, M. (2002). Retroviral vectors for human gene delivery. Biotechnology Advances, 20, 1–31. Santhosh, C. V., Tamhane, M. C., Kamat, R. H., Patel, V. V., & Mukhopadhyaya, R. (2008). A lentiviral vector with novel multiple cloning sites: Stable transgene expression in vitro and in vivo. Biochemical and Biophysical Research Communications, 371, 546–550. Freed, E. O. (2001). HIV-1 replication. Somatic Cell and Molecular Genetics, 26, 13–33. Vecil, G. G., & Lang, F. F. (2003). Clinical trials of adenoviruses in brain tumors: A review of Ad-p53 and oncolytic adenoviruses. Journal of Neuro-oncology, 65, 237–246.
123
20. Sudarshan, S., Holman, D. H., Hyer, M. L., Voelkel-Johnson, C., Dong, J. Y., & Norris, J. S. (2005). In vitro efficacy of Fas ligand gene therapy for the treatment of bladder cancer. Cancer Gene Therapy, 12, 12–18. 21. Ozawa, T., Hu, J. L., Hu, L. J., Kong, E. L., Bollen, A. W., Lamborn, K. R., & Deen, D. F. (2005). Functionality of hypoxiainduced BAX expression in a human glioblastoma xenograft model. Cancer Gene Therapy, 12, 449–455. 22. Chen, H. (2012). Exploiting the intron-splicing mechanism of insect cells to produce viral vectors harboring toxic genes for suicide gene therapy. Molecular Therapy—Nucleic Acids, 1, e57. 23. Maxwell, I. H., Maxwell, F., & Glode, L. M. (1986). Regulated expression of a diphtheria toxin A-chain gene transfected into human cells: possible strategy for inducing cancer cell suicide. Cancer Research, 46, 4660–4664. 24. Goverdhana, S., Puntel, M., Xiong, W., Zirger, J. M., Barcia, C., Curtin, J. F., et al. (2005). Regulatable gene expression systems for gene therapy applications: progress and future challenges. Molecular Therapy, 12, 189–211. 25. Wang, Z., Tang, Z., Zheng, Y., Yu, D., Spear, M., Iyer, S. R., et al. (2010). Development of a nonintegrating Rev-dependent lentiviral vector carrying diphtheria toxin A chain and human TRAF6 to target HIV reservoirs. Gene Therapy, 17, 1063–1076. 26. Young, J., Tang, Z., Yu, Q., Yu, D., & Wu, Y. (2008). Selective killing of HIV-1-positive macrophages and T cells by the Revdependent lentivirus carrying anthrolysin O from Bacillus anthracis. Retrovirology, 5, 36. 27. Vigna, E., & Naldini, L. (2000). Lentiviral vectors: Excellent tools for experimental gene transfer and promising candidates for gene therapy. The Journal of Gene Medicine, 2, 308–316. 28. Pluta, K., & Kacprzak, M. M. (2009). Use of HIV as a gene transfer vector. Acta Biochimica Polonica, 56, 531–595. 29. Ghanbari, J. A., Salehi, M., Zadeh, A. K., Zadeh, S. M., Beigi, V. B., Ahmad, H. K., et al. (2014). A preliminary step of a novel strategy in suicide gene therapy with lentiviral vector. Advanced Biomedical Research, 3, 7. 30. Matrai, J., Chuah, M. K., & VandenDriessche, T. (2010). Recent advances in lentiviral vector development and applications. Molecular Therapy, 18, 477–490.
