Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

A kinetic characterization of the gill V(H+)-ATPase in juvenile and adult Macrobrachium amazonicum, a diadromous palaemonid shrimp Malson N. Lucena a, Marcelo R. Pinto a, Daniela P. Garçon c, John C. McNamara b, Francisco A. Leone a,⁎ a b c

Departamento de Química, Faculdade de Filosofia, Ciências e Letras da Universidade de São Paulo, Ribeirão Preto 14040-901, SP, Brazil Departamento de Biologia, Faculdade de Filosofia, Ciências e Letras da Universidade de São Paulo, Ribeirão Preto 14040-901, SP, Brazil Departamento de Biologia Molecular, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, PB, Brazil

a r t i c l e

i n f o

Article history: Received 25 June 2014 Received in revised form 5 September 2014 Accepted 7 November 2014 Available online 15 November 2014 Keywords: V(H+)-ATPase kinetics Freshwater shrimp gill Crustacea Biochemical characterization

a b s t r a c t Novel kinetic properties of a microsomal gill V(H+)-ATPase from juvenile and adult Amazon River shrimp, Macrobrachium amazonicum, are described. While protein expression patterns are markedly different, Western blot analysis reveals a sole immunoreactive band, suggesting a single V(H+)-ATPase subunit isoform, distributed in membrane fractions of similar density in both ontogenetic stages. Immunofluorescence labeling locates the V(H+)-ATPase in the apical regions of the lamellar pillar cells in both stages in which mRNA expression of the V(H+)-ATPase B-subunit is identical. Juvenile (36.6 ± 3.3 nmol Pi min−1 mg−1) and adult (41.6 ± 1.3 nmol Pi min−1 mg−1) V(H+)-ATPase activities are similar, the apparent affinity for ATP of the adult enzyme (K0.5 = 0.21 ± 0.02 mmol L−1) being 3-fold greater than for juveniles (K0.5 = 0.61 ± 0.01 mmol L−1). The K0.5 for Mg2+ interaction with the juvenile V(H+)-ATPase (1.40 ± 0.07 mmol L−1) is ≈6-fold greater than for adults (0.26 ± 0.02 mmol L−1) while the bafilomycin A1 inhibition constant (KI) is 45.0 ± 2.3 nmol L−1 and 24.2 ± 1.2 nmol L−1, for juveniles and adults, respectively. Both stages exhibited residual bafilomycin-insensitive ATPase activity of ≈25 nmol Pi min−1 mg−1, suggesting the presence of ATPases other than the V(H+)-ATPase. These differences may reflect a long-term regulatory mechanism of V(H+)-ATPase activity, and suggest stage-specific enzyme modulation. This is the first kinetic analysis of V(H+)-ATPase activity in different ontogenetic stages of a freshwater shrimp and allows better comprehension of the biochemical adaptations underpinning the establishment of palaemonid shrimps in fresh water. © 2014 Elsevier Inc. All rights reserved.

1. Introduction The colonization of freshwater habitats from the ancestral marine environment is one of the most dramatic evolutionary transitions in the history of life on earth (Lee et al., 2011) since existence in fresh water necessitates the ability to acquire essential ions (Glenner et al., 2006). Hyperosmoregulating species that inhabit dilute media or fresh water are challenged by osmotic water influx and passive salt loss for which they actively compensate; they are also less permeable to ion loss (Kirschner, 2004; Foster et al., 2010). The gills, together with the excretory organs, are mainly responsible for ionic regulation in the Crustacea (Freire et al., 2008) and provide a selective interface across which salt is actively transported between the external environment and the internal milieu. Thus, the gills constitute a multi-functional effector organ system contributing simultaneously to osmotic, excretory, acid–base

⁎ Corresponding author at: Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto Universidade de São Paulo, Departamento de Química Avenida Bandeirantes, 3900, 14040-901 Ribeirão Preto, SP, Brazil. Tel.: +55 16 3315 3668; fax: +55 16 3315 4838. E-mail address: [email protected] (F.A. Leone).

http://dx.doi.org/10.1016/j.cbpb.2014.11.002 1096-4959/© 2014 Elsevier Inc. All rights reserved.

and respiratory homeostasis (Gilles and Péqueux, 1985; Taylor and Taylor, 1992; Péqueux, 1995; Lucu and Towle, 2003; Freire et al., 2008; Henry et al., 2012). Many enzymes and transporters are involved in ion transport by the crustacean gill such as the (Na+, K+)-ATPase, V(H+)-ATPase, carbonic + + anhydrase, and Cl−/HCO− exchangers (Tsai and Lin, 3 and Na /H 2007; Freire et al., 2008; McNamara and Faria, 2012). Of these enzymes, the evolution of function in the V(H+)-ATPase and (Na+, K+)-ATPase has been considered critical for the colonization of fresh water (Morris, 2001; Tsai and Lin, 2007). The (Na+, K+)-ATPase is restricted to the basal membrane of the gill ionocytes and provides part of the driving force for the trans-epithelial movement of monovalent ions across the gill epithelia in brachyuran Crustacea (Towle and Kays, 1986; McNamara and Torres, 1999; Lignot and Charmantier, 2001; Lucu and Towle, 2003; McNamara and Faria, 2012). In freshwater shrimps, a V(H+)-ATPase located apically in the gill pillar cell flanges may complement the intralamellar septal cell (Na+, K+)-ATPase in energizing osmoregulatory NaCl uptake from fresh water (McNamara and Lima, 1997; Faleiros et al., 2010; McNamara and Faria, 2012). The V(H+)-ATPase is also considered responsible for acid–base balance and to participate in nitrogen excretion (Weihrauch et al., 2001).

16

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

V(H+)-ATPases are membrane-associated ATP-dependent proton pumps that couple the energy released during the hydrolysis of ATP to the active transport of protons from the cytoplasm to the lumen of intracellular compartments or to the extracellular space, when located in the plasma membrane (Forgac, 2007). V(H+)-ATPases are structurally conserved, regardless of kingdom (Stevens and Forgac, 1997), and are organized into two large multi-subunit functional domains (Saroussi and Nelson, 2009; Nakanishi-Matsui et al., 2010; Toei et al., 2010). The integral V0 domain consists of six different subunits in which multiple copies of the proteolipid c subunit are organized as the c-ring. An essential glutamate residue, buried within each proteolipid c copy is reversibly protonated during proton translocation (Jefferies et al., 2008). The presence of hemi-channels in the a subunit provides proton access to the acidic glutamate residues. The peripheral V1 domain contains eight different subunits (A–H) in which three copies of the A and B subunits are alternately disposed in a ring pattern. Catalytic sites located at the A and B subunit interfaces are involved in ATP hydrolysis. Multiple stalks interconnect the V0 and V1 domains. The central stalk, formed by the D, F and d subunits is attached to the c-ring and passes through the A3B3 hexamer center. V(H+)-ATPases are enzymes that operate through a rotary mechanism resulting in unidirectional H+ transport across the membrane. ATP hydrolysis in the V1 domain drives the rotation of the central stalk causing rotation of the entire rotary assembly, which includes the D, F and d subunits and the c-ring (Imamura et al., 2003). In mammalian cells, most of the V(H+)-ATPase subunits are expressed as multiple isoforms which are often tissue-specific (Toei et al., 2010). Several complex mechanisms including the reversible dissociation of the V1 and V0 domains, the tightness of coupling between proton transport and ATP hydrolysis, and selective targeting of specific V(H+)-ATPases to different cellular membranes are involved in the regulation of V(H+)-ATPase activity in vivo (Kane, 2006; Forgac, 2007; Toei et al., 2010). Phosphorylation of the C subunit by protein kinase A causing the rapid and reversible dissociation of the V1 and V0 domains is the most well-known mechanism (Toei et al., 2010). The reversible insertion of fully assembled V(H+)-ATPase molecules resulting from A subunit phosphorylation may regulate proton transport across the apical membrane of some polarized cells (Alzamora et al., 2010; Toei et al., 2010). Reversible disulfide bond formation at subunit A catalytic sites accounting for blockage of ATP hydrolysis and modification of coupling efficiency between ATP hydrolysis and H+ translocation, apparently resulting from the presence of different subunit isoforms, also constitute possible mechanisms of V(H+)-ATPase regulation (Kawasaki-Nishi et al., 2001; Forgac, 2007; Toei et al., 2010). pH change is an important modulator of transepithelial solute transport, endocrine function, and cell growth and differentiation (Boron, 1986). While the V(H+)-ATPase may be regulated by extracellular pH, studies in crustaceans are rare (Pan et al., 2007). Gill V(H+)-ATPase activity increases in response to low and/or high salinities and may reflect increased H+ export, maintaining hemolymph acid–base regulation consequent to altered metabolic rate (Bianchini et al., 2007). The palaemonid shrimp genus Macrobrachium constitutes one of the most diverse and widespread taxons that have successfully invaded freshwater from the ancestral estuarine habitat (Murphy and Austin, 2005; Augusto et al., 2009; McNamara and Faria, 2012). However, various Macrobrachium species inhabit streams discharging into the Atlantic Ocean along the coast of São Paulo State (Brazil) and exhibit widely varying degrees of physiological adaptation to fresh water (Moreira et al., 1983; Freire et al., 2003; Freire et al., 2008; McNamara and Faria, 2012). Diadromous forms, like Macrobrachium heterochirus, Macrobrachium acanthurus and Macrobrachium olfersi, exhibit extended larval phases that require estuarine or marine waters. Hololimnetic species like Macrobrachium potiuna and Macrobrachium brasiliense inhabit continental waters in which they spend their entire life cycles (Moreira et al., 1983). The Amazon River shrimp Macrobrachium amazonicum is endemic to South America (Holthius, 1952; Odinetz-Collart and Rabelo, 1996) and

its presumptive natural distribution includes the Orinoco, Amazon, and the Paraguay/Lower Paraná river basins (Magalhães et al., 2005). This diadromous shrimp has diversified into coastal populations that inhabit rivers close to estuaries and continental populations living in rivers, lakes and other inland water bodies (Charmantier and Anger, 2011; Anger, 2013). These two groups apparently differ in external morphology and meristic characters (Pileggi and Mantelatto, 2012). Coastal populations of M. amazonicum exhibit a lengthy larval sequence dependent on brackish water for development to the post-larva. The juvenile stage then migrates back to fresh water to mature into the adult form (Moreira et al., 1986). Adult M. amazonicum are strong hyperosmotic and ionic regulators, an ability underpinned by gill (Na+, K+)-ATPase activity (Augusto et al., 2007; Faleiros et al., 2010). While a gill (Na+, K+)-ATPase has been kinetically characterized in several ontogenetic stages of M. amazonicum (Santos et al., 2007; Belli et al., 2009; Leone et al., 2012), only a single study has characterized gill V(H+)-ATPase activity (Faleiros et al., 2010), in this frequently used palaemonid shrimp model. Investigations of the effects of salinity on V(H+)-ATPase activity are also scarce (Pan et al., 2007; Tsai and Lin, 2007), and the mechanisms modulating enzyme activity in response to salinity change are as yet unknown. Most studies addressing an osmoregulatory role for the gill V(H+)ATPase in euryhaline and freshwater crustaceans have employed electrophysiological techniques (Onken and McNamara, 2002; Genovese et al., 2005). V(H+)-ATPase activity rarely has been characterized, correlation with ontogenetic development is not well investigated, and the biochemical mechanisms underlying long-term gill V(H+)-ATPase activity regulation in response to salinity change are only now being investigated. Recent studies show a substantial increase or decrease in V(H+)-ATPase B subunit mRNA expression in the gill epithelia of certain crustaceans in response to low or high salinity acclimation, respectively, suggesting alteration in transcription rates and/or mRNA stability, leading to altered rates of enzyme synthesis (Weihrauch et al., 2001; Luquet et al., 2005; Tsai and Lin, 2007; Faleiros et al., 2010). In this study, we provide an extensive kinetic characterization of V(H+)-ATPase activity in a gill microsomal fraction from juvenile and adult M. amazonicum. V(H+)-ATPase activity distribution in a sucrose density gradient and V(H+)-ATPase subunit expression are also examined. Our findings disclose a substantial increase in affinity of the enzyme for ATP, Mg2+ and bafilomycin in adults compared to juveniles, suggesting that modulation of V(H+)-ATPase activity may be stagespecific. 2. Materials and methods 2.1. Materials All solutions were prepared using Millipore MilliQ ultrapure, apyrogenic water. Tris (hydroxymethyl) amino methane (Tris), ATP di-Tris salt, pyruvate kinase (PK), phosphoenolpyruvate (PEP), NADH, N-(2-hydroxyethyl) piperazine-N′-ethanesulfonic acid (HEPES), sodium orthovanadate, lactate dehydrogenase (LDH), phosphoglycerate kinase (PGK), nitroblue tetrazolium (NBT), bafilomycin A1, diethylpyrocarbonate(DEPC) and 5-bromo-4-chloro-3-indole phosphate (BCIP) were purchased from the Sigma Chemical Company (Saint Louis, USA). Dimethyl sulfoxide (DMSO) and triethanolamine were from Merck (Darmstadt, Germany). The protease inhibitor cocktail (1 mmol L− 1 benzamidine, 5 μmol L− 1 antipain, 5 μmol L− 1 leupeptin, 1 μmol L−1 pepstatin A, and 5 μmol L−1 phenyl-methanesulfonyl-fluoride) was from Calbiochem (San Diego, USA). The V(H+)ATPase monoclonal antibody raised against the c-subunit of Dictyostelium discoideum (#224-256-2) was purchased from the Developmental Studies Hybridoma Bank (Iowa, USA); the goat polyclonal V(H+)-ATPase A1 (L-20) antibody against the 116-kDa subunit, and the donkey anti-goat IgG alkaline phosphatase conjugate were purchased from Santa Cruz Biotechnology, Inc. (Dallas, USA). The molecular

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

mass markers myosin (220 kDa), bovine serum albumin (100 kDa), glyceraldehyde dehydrogenase (60 kDa), alcohol dehydrogenase (45 kDa) and carbonic anhydrase (30 kDa) were from Sigma Chemical Company (Saint Louis, USA). All other reagents used were of the highest purity commercially available. Crystalline suspensions of LDH and PK were centrifuged at 20,000 ×g for 15 min at 4 °C in an Eppendorf 5810 refrigerated centrifuge. The pellet was resuspended in 500 μL of 50 mmol L−1 HEPES buffer, pH 7.5, transferred to a YM-10 Microcon filter and centrifuged 5 times in the above buffer until complete removal of ammonium ions (tested with the Nessler reagent). Finally, the pellet was resuspended to the original volume. The stock solution of ATP was prepared by dissolving ATP di-Tris salt in water and adjusting the pH to 7.0 with triethanolamine (d = 1.12 g mL−1). The exact concentration was established from the extinction coefficient (ε260 nm pH 7.0 = 15,400 mol L−1 cm−1) and adjusted to 100 mmol L−1. Concentrated bafilomycin A1 solution (200 μmol L−1) was prepared in DMSO. Sodium orthovanadate solution was prepared according to Gordon (1991). When necessary, enzyme solutions were concentrated on YM-10 Amicon Microcon filters. 2.2. Shrimps Amazon River prawns, M. amazonicum, were produced at the Aquaculture Center, UNESP, Jaboticabal, São Paulo, Brazil from broodstock collected in fresh water at Furo das Marinhas near Santa Bárbara do Pará (1° 13′ 25″ S; 48° 17′ 40″ W), northeastern Pará State, Brazil, in 2001 (Araújo and Valenti, 2007). Juveniles of about 5 cm length and 3 g wet weight (20 individuals/preparation, ≈ 700 μg wet gill mass) were collected from freshwater rearing tanks and held in carboys containing 32 L aerated fresh water from the rearing tank. Adult male shrimps of about 12 cm length and ≈12 g wet weight (20 individuals/ preparation, ≈ 6 g wet gill mass) were collected from freshwater ponds and maintained in carboys containing 32 L aerated pond water. Juveniles and adults were used in stage C of the intermolt cycle, confirmed by stereoscopic microscopy (Hayd et al., 2008). The juvenile is an early benthonic freshwater stage while adult shrimps are well established in fresh water and are sexually mature. 2.3. Gill dissection For each homogenate prepared, shrimps were anesthetized by chilling on crushed ice immediately before dissection and gill homogenization. After removal of the branchiostegites, the gills of juvenile and adult shrimps were rapidly dissected, diced and homogenized in a Potter homogenizer set at 600 rpm in 20 mmol L−1 imidazole buffer, pH 6.8, containing 6 mmol L−1 EDTA, 250 mmol L−1 sucrose and a protease inhibitor cocktail (20 mL buffer/g wet tissue). 2.4. Preparation of gill microsomes After centrifuging the crude extract at 20,000 ×g for 35 min at 4 °C, the supernatant was placed on crushed ice and the pellet was resuspended in an equal volume of the imidazole homogenization buffer. After further centrifugation as above, the two supernatants were gently pooled and centrifuged at 100,000 ×g for 90 min at 4 °C. The resulting pellet, containing the microsomal fraction, was homogenized in 20 mmol L−1 imidazole buffer, pH 6.8, containing 6 mmol L−1 EDTA and 250 mmol L−1 sucrose (15 mL buffer/g wet tissue). Finally, 0.5-mL aliquots were rapidly frozen in liquid nitrogen and stored at − 20 °C. No appreciable loss of V-ATPase activity was seen after two-month's storage of the microsomal enzyme prepared from the gill tissue. When required, the aliquots were thawed, placed on crushed ice and used immediately.

17

2.5. Gill ultrastructure and immunolocalization of the gill V(H+)-ATPase For ultrastructural analysis, sixth right-side gills were used. All procedures were performed according to Faleiros et al. (2010). For immunolocalization, fourth left-side gills were dissected and incubated in a fixative solution containing 2.5% p-formaldehyde in a phosphate buffered saline (PBS, 10 mmol L−1 Na2HPO4, 2 mmol L−1 KH2PO4, 137 mmol L−1 NaCl, 2.7 mmol L−1 KCl, 290 mOsm kg−1 H2O), pH 7.4, for 1 h, and then embedded in Optimal Cutting Temperature Compound. Thick cryosections (12-μm) were taken transversely to the gill lamella long-axis using a Micron HM 505E model Cryostat Microtome (Walldorf, Germany) at −20 °C and collected on gelatin-coated slides (Bloom 225). V(H+)-ATPase immunolocalization was performed using a mouse monoclonal IgG1 antibody (#224-256-2) raised against D. discoideum V(H+)-ATPase c-subunit (Journet et al., 1999). Cryosectioning was performed according to França et al. (2013). Drops of V(H+)-ATPase c-subunit antibody, diluted to 21 mg mL−1 in PBS (1:1.2), were placed on the cryosections, which were incubated for 1 h at room temperature in a humid chamber. Negative control sections were incubated in blocking solution (1% bovine serum albumin plus 0.1% gelatin in PBS) without the primary antibody. The sections were then incubated with donkey anti-mouse IgG secondary antibody conjugated with Alexa-fluor 488 diluted 1:450 in PBS for 45 min. The nuclei were stained with DAPI (diluted 1:200) in PBS for 20 min. The sections were observed and photographed using an Olympus BX-50 fluorescence microscope (Olympus America Inc., Melville, USA) equipped with a SPOT RT3 25.4 2 Mb Slider camera (SPOT Imaging Solutions Inc., Sterling Heights, USA) employing differential interference contrast microscopy and excitation/emission wavelengths of 495/ 519 nm (Alexa-fluor 488) and 358/461 nm (DAPI). 2.6. Measurement of V(H+)-ATPase activity V(H+)-ATPase activity was assayed at 25 °C using a PK/LDH coupling system (Rudolph et al., 1979) in which ATP hydrolysis was coupled to NADH oxidation according to Lucena et al. (2012). In this system, the phosphate released during ATP hydrolysis by the V(H+)-ATPase is converted to ATP while phosphoenolpyruvate is converted to pyruvate by pyruvate kinase. Pyruvate is converted to lactate concomitant with NADH oxidation. The rate of ATP hydrolysis by the V(H+)-ATPase can be estimated by monitoring NADH titers. NADH oxidation was monitored at 340 nm (ε340 nm, pH 7.5 = 6,200 mol L−1 cm−1) in a Hitachi U-3000 spectrophotometer equipped with thermostatted cell holders. Standard assay conditions for estimation of total microsomal P-ATPase activity were 50 mmol L− 1 HEPES buffer, pH 7.5, containing ATP (5 mmol L− 1 for juveniles and 2 mmol L− 1 for adults), 5 mmol L− 1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2.0 mmol L−1 PEP, 82 μg PK (49 U) and 110 μg LDH (94 U) in a final volume of 1.0 mL. Microsomal V(H+)-ATPase activity was estimated by firstly measuring total ATPase activity with 50 μmol L− 1 orthovanadate (orthovanadate-insensitive ATPase activity) and then with 50 μmol L−1 orthovanadate plus 4 μmol L− 1 bafilomycin A1 (bafilomycin-insensitive ATPase activity). The difference in activities measured without (orthovanadate-insensitive ATPase activity) and with bafilomycin A1 (bafilomycin-insensitive ATPase activity) represents the V(H+)-ATPase activity. ATPase activity was also assayed after 10 min pre-incubation at 25 °C with alamethicin (1 mg/mg protein) as a control for leaky and/or disrupted vesicles. The initial velocities were constant for at least 15 min provided that less than 5% NADH was oxidized. For each microsomal preparation, assay linearity was verified using samples containing from 5 to 50 μg protein; total microsomal protein added to the cuvette was within the linear range of the assay. Neither NADH, PEP, LDH nor PK was rate limiting over the initial course of the assay and no activity was measurable in the absence of NADH. Controls without added enzyme were also included in each experiment to quantify non-enzymatic substrate

18

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

hydrolysis. Assays of (Na+, K+)-ATPase with and without ouabain were also performed to evaluate microsomal activity (Lucena et al., 2012). Reaction rates were estimated using duplicate aliquots from the same microsomal preparation and their mean values were used to obtain the respective saturation curves. Each saturation curve for each modulator (pH, ATP, Mg2 +) of V(H+)-ATPase activity was repeated using three different microsomal homogenates (N = 3). One enzyme unit (U) is defined as the amount of enzyme that hydrolyzes 1.0 nmol of ATP per minute at 25 °C, and specific activity is given as nmol min−1 mg protein−1. 2.7. Effect of pH on V-ATPase activity The effect of pH on V-ATPase activity was assayed discontinuously at 25 °C by measuring the amount of inorganic phosphate released over the pH range of 6.5 to 8.5 according to Heinonen and Lahti (1981). The reaction media were adjusted to pH 6.5, 7.0, 7.5, 8.0 or 8.5 with concentrated Tris solution. The reaction was initiated by addition of the enzyme, stopped with 0.5 mL cold 30% TCA, and immediately centrifuged at 4000 ×g at 4 °C, followed by measurement of inorganic phosphate. 2.8. Continuous-density sucrose gradient centrifugation A 5-mg aliquot of the ATPase-rich gill microsomal fraction was layered into a 10 to 50% (w/w) continuous-density, sucrose gradient in 20 mmol L−1 imidazole buffer, pH 6.8 and centrifuged at 180,000 ×g for 3 h at 4 °C, using a PV50T2 Hitachi vertical rotor. Fractions (0.5 mL) collected from the bottom of the gradient were then assayed for orthovanadate-insensitive ATPase activity, bafilomycin-insensitive ATPase activity, protein concentration and refractive index. 2.9. SDS-PAGE and Western blot analysis SDS-PAGE was performed in 5–20% gels according to Laemmli (1970), using 2.5 μg and 120 μg protein/lane for protein staining and blotting analysis, respectively. After electrophoresis, the gel was split, one half being stained with silver nitrate and the other electroblotted using a Hoefer SE200 system employing nitrocellulose membranes according to Towbin et al. (1979). The nitrocellulose membrane was blocked for 10 h with 5% nonfat dry milk freshly prepared in 50 mmol L−1 Tris–HCl buffer, pH 8.0, containing 150 mmol L−1 NaCl and 0.1% Tween 20, with constant agitation. The membrane was incubated overnight at 25 °C in a 1:50 dilution of the goat polyclonal V(H+)-ATPase A1 (L-20) antibody. After washing 3 times in 50 mmol L−1 Tris–HCl buffer (pH 8.0) containing 150 mmol L−1 NaCl and 0.1% Tween 20, the membrane was incubated for 1 h at 25 °C in a donkey anti-goat IgG alkaline phosphatase conjugate (diluted 1: 7,500). Specific antibody incorporation was developed in 100 mmol L− 1 Tris–HCl buffer (pH 9.5) containing 100 mmol L− 1 NaCl, 5 mmol L−1 MgCl2, 0.2 mmol L−1 NBT and 0.8 mmol L−1 BCIP. Immunoblots were scanned and imported as JPG files into a commercial software package (Kodak 1D 3.6) where the immunoreaction densities were quantified and compared. Western blot analysis was repeated 3 times using different gill tissue homogenates. 2.10. Measurement of protein Protein concentration was estimated according to Read and Northcote (1981), using bovine serum albumin as the standard. 2.11. Estimation of kinetic parameters The kinetic parameters V (maximum rate), K0.5 (apparent dissociation constant of the enzyme-modulator complex), KM (Michaelis– Menten constant) and the nH value (Hill coefficient) for ATP hydrolysis were calculated using SigrafW software (Leone et al., 2005). The

apparent dissociation constant, KI, of the enzyme–inhibitor complex was estimated as described by Marks and Seeds (1978). The kinetic parameters V, KM and K0.5 are calculated values and are given as the mean ± SD from three different microsomal preparations (N = 3) of shrimps collected at different periods. SigrafW software can be obtained from http://portal.ffclrp.usp.br/sites/fdaleone/downloads. 2.12. Quantitative RT-PCR (real-time PCR) Five total RNA extractions were performed under RNAse-free conditions, using pools of gills from 4–5 juveniles or adults. Whole gills (100 mg) were placed in an Eppendorf tube containing 1 ml Trizol (Ambion RNA, Life Technologies, USA). After adding 200 μL chloroform the tube was centrifuged at 12,000 ×g for 15 min at 4 °C; 500 μL of the aqueous phase was transferred to another tube, 500 μL isopropanol was added and, after 10-min incubation at 25 °C, the homogenate was centrifuged at 12,000 ×g for 10 min at 4 °C. The pellet was dissolved in 950 μL 75% ethanol containing 0.1% DEPC and centrifuged at 7400 ×g for 5 min at 4 °C. After drying at 25 °C, the pellet was dissolved in 50 μL ultrapure water containing 0.1% DEPC and the total RNA stored at −80 °C. DNA and RNA purity was assessed from the absorbance ratio at 260 nm and 280 nm. Reverse transcription was performed using 2 μg total RNA employing a Maxima® First Strand cDNA synthesis kit (Fermentas, Synapse Biotechnology, Brazil) following the manufacturer's instructions. PCR reactions were performed in a peltier thermocycler (Biocycle Co. Ltd., Hangzhou, China). Quantitative PCR reactions were performed employing a Bio-Rad CFX96 RT thermocycler, using SsoFast™ EvaGreen® Supermix (BioRad), according to the manufacturer's instructions. The thermocycling procedure consisted of an initial step at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s each, and a final step at 60 °C for 1 min. The RPL10 gene that encodes for ribosomal protein L10 was used as an endogenous control against which the V(H+)-ATPase B-subunit mRNA expression values were normalized. Specific primers for quantifying the RPL10 and V(H+)-ATPase B subunit gene expressions in M. amazonicum gill homogenates (Table 1) were designed based on partial cDNA sequences originally obtained by Faleiros et al. (2010), employing specific primers for the M. amazonicum RPL10 (GenBank accession number GU366065) and V(H+)-ATPase gill genes (GenBank accession number GQ329699). Quantitative PCR was repeated five times for each microsomal preparation. 3. Results 3.1. Gill ultrastructure and immunolocalization of the V(H+)-ATPase The gill lamellar epithelium consists of two opposing layers of pillar cells whose cell bodies abut onto an intralamellar septum (Fig. 1). Hemolymph percolates through the narrow capillary-like lacunae between the apical pillar cell flanges and bodies and the septal cells. Juxtaposed to the fine cuticle, the pillar cell flanges contain numerous mitochondria, polyribosomes and vesicles; their electron-dense perikarya are characterized by abundant, frequently concentric RER cisternae, Golgi bodies and numerous vesicles. The electron-lucent septal cells exhibit abundant mitochondria most associated with deep, encompassing membrane invaginations. Fig. 2 shows the distribution of the V(H+)-ATPase in the gill lamellae of juvenile and adult M. amazonicum. Immunofluorescence labeling in juvenile gill lamellae shows the V(H+)-ATPase c-subunit to be distributed weakly and irregularly in the apical regions of the pillar cells, although strongly in the marginal canals (Fig. 2A and inset). In the adult gill lamellae, although the V(H+)-ATPase exhibits a patchy appearance, the distribution is associated mainly with the apical pillar cell flanges (Fig. 2B). Intense staining is seen throughout the cytoplasm of the cells lining the marginal channels (inset to Fig. 1B). The intralamellar

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

19

Table 1 Specific oligonucleotide primers used for quantitative amplification of V(H+)-ATPase B-subunit and ribosomal protein L10 cDNA from juvenile and adult Macrobrachium amazonicum gills. Primers were designed based on partial cDNA sequences obtained for the V(H+)-ATPase B-subunit (GenBank accession number GQ329699) and ribosomal protein L10 (GenBank accession number GU366065) from M. amazonicum gills (Faleiros et al., 2010). Primer

Nucleotide sequence (5′–3′)

Amplicon (bp)

V(H )-ATPase Specific sense primer V_Ma_F Specific anti-sense primer V_Ma_R

TTCCTTCTACTCGACCGGCACG TGCCAGGTAGACGTGGTTTCCC

81

Ribosomal protein L10 Specific sense primer PRL10_Ma_F Specific anti-sense primer PRL10_Ma_R

AAATGTTGTCGTGTGCTGGTGC ATTCTTACACGTGCAACCGTGC

91

+

septum shows very little signal. The negative control sections did not show non-specific fluorescence signal (data not shown). 3.2. Characterization of the gill microsomal fraction The gill orthovanadate-insensitive ATPase activities (58.9 ± 3.0 and 59.4 ± 4.0 nmol Pi min−1 mg−1, respectively) were very similar in the juveniles and adults, as were the bafilomycin-insensitive ATPase activities (25.3 ± 1.3 and 21.5 ± 1.1 nmol Pi min−1 mg−1 for juveniles and adults, respectively). No differences in ATP hydrolysis were seen with alamethicin (data not shown), confirming the presence of permeable microsomes. Clearly, all solutes had unrestricted access to the intracellular and extracellular domains of the enzyme under the assay conditions used.

3.4. SDS-PAGE and western blot analyses SDS-PAGE and Western blot analyses of gill microsomes from juvenile and adult shrimps are shown in Fig. 4. Striking differences in both protein patterns and concentrations were seen for juveniles and adults (Fig. 4A). However, the Western blot analysis identified only a single immunoreactive band of ≈ 116 kDa for the V(H+)-ATPase present in microsomal homogenates of juvenile and adult gills (Fig. 4B). Image analysis revealed very similar immunoreactive bands for the V(H+)ATPase subunit in both ontogenetic stages.

3.3. Distribution of V(H+)-ATPase activity by continuous-density sucrose gradient Fig. 3 shows the distribution of microsomal gill V(H+)-ATPase activity in juvenile and adult M. amazonicum by the continuous-density sucrose gradient centrifugation. In the juveniles (Fig. 3A), a protein peak showing a maximal activity V(H+)-ATPase activity of ≈27 U mL−1 appeared between 29% and 33% sucrose. In the adults (Fig. 3B), a protein peak showing V(H+)-ATPase activity sedimented between 28% and 34% sucrose, and contained membrane fractions with lower V(H+)ATPase activity (≈8 U mL−1).

Fig. 1. Ultrastructure of the gill epithelium in adult M. amazonicum. Beneath the fine cuticle (c), the pillar cell flanges (pf) radiate apically from the pillar cell bodies (pb) that abut on to the intralamellar septal cells (sc). The pillar cells contain abundant, often concentric RER cisternae, Golgi bodies, vesicles and polymorphic mitochondria. The intralamellar septal cells (sc) are characterized by abundant, spherical mitochondria and deep, encompassing membrane invaginations. Hemolymph (h) flows through the complex capillary spaces between the two cell types, bathing their cell membranes. Scale bar = 5 μm.

Fig. 2. Cellular distribution of the V(H+)-ATPase in gill lamellae from juvenile and adult M. amazonicum. V(H+)-ATPase c-subunit distribution in transverse cryosections of gill lamellae from juvenile and adult M. amazonicum. A — Juvenile. Immunofluorescence labeling (Alexa-fluor 488, 495/519 nm) reveals the V(H+)-ATPase c-subunit (green) to be patchily distributed in the apical pillar cell regions, and particularly in the cells forming the marginal channels (inset, arrows). B — Adult. The V(H+)-ATPase is located mainly in the apical pillar cell flanges with a strong signal in the marginal channels (inset, arrows). Nuclei (blue) were stained with DAPI. Scale bars = 50 μm.

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

40

36

30

27 18

0.004 0.003

9

0.002 0.001

10

20

30

40

20 10

% Sucrose (w/w)

45

A

[Protein] (µ g/µ L)

Specific activity, U mL

-1

20

50

3.7. Modulation of gill V(H+)-ATPase activity by Mg2+

Tube number

40

9

30 0.012 0.009

3

0.006 0.003

10

20

30

40

20 10

% Sucrose (w/w)

12

[Protein] (µ g/µ L)

Specific activity, U mL

-1

B

6

ATPase activity, over the same ATP concentration range (inset to Fig. 6A). A very similar profile was seen for modulation by ATP of the adult enzyme (Fig. 6B). However, in addition to site–site interactions, ≈ 15% greater maximum rates (V = 41.6 ± 1.3 nmol Pi min−1 mg−1) associated with a 3-fold lower K0.5 (0.21 ± 0.02 mmol L−1) were estimated (Table 2). A residual V(H+)-ATPase activity corresponding to 6 nmol Pi min−1 mg−1 was seen at ATP concentrations as low as 10−5 mol L−1. The stimulation of bafilomycin-insensitive ATPase activity reached values of ≈20 nmol Pi min−1 mg−1, representing ≈ 35% that of orthovanadate-insensitive ATPase activity (inset to Fig. 6B).

50

Tube number Fig. 3. Sucrose density gradient centrifugation of gill microsomal fractions from juvenile and adult M. amazonicum. An aliquot containing 5 mg protein was layered into a 10– 50% (w/w) continuous sucrose density gradient in 20 mmol L−1 imidazole buffer, pH 6.8, and centrifuged at 180,000 ×g for 3 h at 4 °C. Fractions (0.5 mL) were collected from the bottom of the gradient and analyzed for V-ATPase activity (□), protein concentration (▲), sucrose concentration (○), orthovanadate-insensitive ATPase activity (■) and bafilomycin-insensitive ATPase activity (◊). A — Juvenile. B — Adult.

The modulation by Mg2+ of V(H+)-ATPase activity in gill microsomes from juvenile and adult M. amazonicum is shown in Fig. 7. At a saturating ATP concentration (5 mmol L−1) with 50 μmol L−1 orthovanadate, increasing Mg2+ concentration from 10−4 to 5 × 10−3 mol L−1 stimulated the juvenile V(H+)-ATPase activity following a clear saturation curve (Fig. 7A). Maximum rate was 40.6 ± 2.4 nmol Pi min−1 mg−1 with K0.5 = 1.4 ± 0.07 mmol L−1 resulting from site–site interactions (nH = 3.9) between Mg2+ and the enzyme (Table 2). A residual ATPase activity (≈5 nmol Pi min−1 mg−1) was revealed at Mg2+ concentrations as low as 10−4 mol L−1. Bafilomycin-insensitive ATPase activity was stimulated up to ≈20 nmol Pi min−1 mg−1 (corresponding to ≈35% of orthovanadate-insensitive ATPase activity) over the same Mg2+ concentration range (inset to Fig. 7A). Mg2+ stimulation of the adult enzyme also followed a well-defined saturation curve (Fig. 7B). While enzyme affinity for Mg2+ was ≈5-fold greater (K0.5 = 0.26 ± 0.02 mmol L−1) than for juveniles, the maximum hydrolysis rate was very similar (39.8 ± 1.1 nmol Pi min−1 mg− 1, Table 2). Compared to the juvenile enzyme, residual ATPase activity was greater for the adult enzyme (≈ 17 nmol Pi min− 1 mg−1) at Mg2 + concentrations as low as 10− 5 mol L−1. The bafilomycininsensitive ATPase activity of the adult enzyme constituted ≈35% that of the orthovanadate-insensitive ATPase activity (inset to Fig. 7B).

3.5. Effect of pH on V-ATPase activity The effect of pH on the gill V(H+)-ATPase activity of juvenile and adult shrimps is shown in Fig. 5. Approximately 40 nmol Pi min−1 mg−1 was estimated at pH 7.5 for gill homogenates from both ontogenetic stages. As pH increased from 6.5 to 7.5, V(H+)-ATPase activity in the juvenile gills increased 4-fold (from ≈10 nmol Pi min−1 mg−1 to ≈40 nmol Pi min−1 mg−1), decreasing to ≈15 nmol Pi min−1 mg−1 with increasing pH up to 8.5 (Fig. 5A). Very similar results were found for the adult stage (Fig. 5B). The orthovanadate-insensitive ATPase activity of ≈60 nmol Pi min−1 mg−1 (inset to Fig. 5A) and bafilomycininsensitive ATPase activity of ≈22 nmol Pi min−1 mg−1 (inset to Fig. 5B) estimated for both ontogenetic stages suggest that the PATPase content is roughly the same for both stages.

3.6. Modulation by ATP of gill V(H+)-ATPase activity The effect of ATP concentration on V(H+)-ATPase activity in gill microsomal preparations from juvenile and adult M. amazonicum is shown in Fig. 6. At a saturating Mg2 + concentration (5 mmol L−1) with 50 μmol L−1 orthovanadate, increasing ATP concentrations from 10−5 to 5 × 10−3 mol L−1 stimulated juvenile V(H+)-ATPase activity following a well-defined saturation curve (Fig. 6A). ATP was hydrolyzed at a maximum rate of V = 36.6 ± 3.3 nmol Pi min− 1 mg− 1 with K0.5 = 0.61 ± 0.01 mmol L−1, exhibiting site–site interactions (Table 2). Further, a residual V(H+)-ATPase activity of ≈ 8 nmol Pi min− 1 mg− 1 was seen at ATP concentrations as low as 10−5 mol L−1. Bafilomycininsensitive ATPase activity was also stimulated up to 25 nmol Pi min− 1 mg− 1, corresponding to ≈ 40% of orthovanadate-insensitive

Fig. 4. SDS-PAGE and Western blot analyses of gill microsomal fractions from juvenile and adult M. amazonicum. Electrophoresis was performed in a 5–20% polyacrylamide gel using 2.5 μg and 120 μg protein/lane for protein staining and blotting analysis, respectively. A — Silver-stained gill microsomal protein. B — Western blot analysis of gill microsomal protein.

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

3.9. Expression of gill V(H+)-ATPase B-subunit mRNA

-1

40

-1

60

V(H+)-ATPase B subunit mRNA expression in the gill homogenates of juvenile and adult M. amazonicum was identical (Fig. 9).

45 30 15

30

6.5 7.0 7.5 8.0 8.5

pH

20 10 6.5

7.0

8.0

7.5

8.5

pH 60

40

-1

30

45 30 15 6.5 7.0

7.5

pH

8.0 8.5

We disclose novel kinetic properties of a microsomal gill V(H+)ATPase from juvenile and adult Amazon River shrimp, M. amazonicum. These findings constitute the first kinetic analysis of V(H+)-ATPase activity in different ontogenetic stages of a freshwater shrimp. The differences in the kinetic parameters of the enzyme between the two ontogenetic stages may reflect a long-term regulatory mechanism of V(H+)-ATPase activity, and suggest that enzyme modulation may be stage-specific. The apparent affinity for ATP of the adult gill V(H+)-ATPase (K0.5 = 0.21 ± 0.02 mmol L−1) is 3-fold greater than that of the juvenile (K0.5 = 0.61 ± 0.01 mmol L−1) while the K0.5 value for Mg2+ interaction in the juvenile (1.40 ± 0.07 mmol L− 1) is ≈ 6-fold that in the adult (0.26 ± 0.02 mmol L−1). The inhibition constants (KI) for bafilomycin in juveniles and adults were 45.0 ± 2.3 nmol L− 1 and 24.2 ± 1.2 nmol L− 1, respectively. The expression of mRNA levels

20

A 7.0

7.5

8.0

8.5

pH

30

60 45 30 15

20

5 4 3 - Log [ATP] (mol L-1)

10

5

4

- Log [ATP] (mol L-1)

3

The effect of a wide range of bafilomycin A1 concentrations on gill orthovanadate-insensitive ATPase activity in juvenile and adult M. amazonicum is shown in Fig. 8. At saturating ATP (5 mmol L−1) and Mg2+ (5 mmol L−1) concentrations, bafilomycin A1 concentrations up to 8 × 10−9 mol L−1 have little effect on orthovanadate-insensitive ATPase activity in juveniles. However, increasing bafilomycin concentrations up to 8 × 10−7 mol L−1 considerably inhibited orthovanadateinsensitive ATPase activity from ≈60 nmol Pi min−1 mg−1 to ≈ 20 nmol Pi min−1 mg−1. This profile, revealing a single titration curve, likely reflects a single bafilomycin A1 binding site (Fig. 8A). The calculated KI for bafilomycin inhibition was 45.0 ± 2.3 nmol L−1 (inset to Fig. 8A). A very similar profile was observed for bafilomycin inhibition in the adult shrimp (Fig. 8B). However, the bafilomycin A1 inhibition constant was two-fold lower (KI = 24.2 ± 1.2 nmol L−1) compared to the juvenile enzyme (inset to Fig. 8B). As seen in juveniles, a residual bafilomycininsensitive ATPase activity of ≈20 nmol Pi min−1 mg−1 was disclosed even at bafilomycin concentrations up to 4 × 10−7 mol L−1.

30 20

B

60

-1

40

nmol Pi min mg

-1

3.8. Inhibition by bafilomycin A1 of orthovanadate-insensitive ATPase activity

nmol Pi min mg

-1

-1

Fig. 5. Effect of pH on microsomal V(H+)-ATPase activity in gill tissue from juvenile and adult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPES buffer, containing ATP (5 mmol L−1 for juveniles and 2 mmol L−1 for adults), 5 mmol L−1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg protein for juveniles (A) and adults (B), respectively. Activity was also estimated as above with 4 μmol L−1 bafilomycin A1. pH was adjusted to the final value using concentrated Tris solution. Duplicate aliquots from three different gill homogenates were used. Data are the mean ± SD. Inset: orthovanadate-insensitive ATPase activity (●) and bafilomycin-insensitive ATPase activity (○).

-1

6.5

nmol Pi min mg

-1

-1

40

-1

nmol Pi min mg

-1

-1

nmol Pi min mg

-1

B

4. Discussion

nmol Pi min mg

nmol Pi min mg

-1

-1

nmol Pi min mg

A

21

45 30 15

4 5 3 - Log [ATP] (mol L-1)

10

5

4

3

- Log [ATP] (mol L-1) Fig. 6. Effect of ATP on microsomal V(H+)-ATPase activity in gill tissue from juvenile and adult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPES buffer, pH 7.5, containing 5 mmol L−1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg protein for juveniles (A) and adults (B), respectively. Activity was also estimated as above with 4 μmol L−1 bafilomycin A1. Duplicate aliquots from three different gill homogenates were used. Data are the mean ± SD. Inset: orthovanadate-insensitive ATPase activity (●) and bafilomycin-insensitive ATPase activity (○).

22

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Table 2 Kinetic parameters for the stimulation by ATP and Mg2+, and KI values for inhibition by bafilomycin A1, of V(H+)-ATPase activity in gill microsomal fractions from juvenile and adult Macrobrachium amazonicum. Effector

V (U mg−1)

K0.5 or KM (mmol L−1)

V(H+)-ATPase

ATP Mg2+ K+ Na+ NH+ 4

(Na+,K+)-ATPasea

Juvenile

Adult

Juvenile

36.6 ± 3.3 40.6 ± 2.4 – – –

41.6 ± 1.3 39.8 ± 1.1 – – –

194.4 181.3 196.5 186.8 205.9

± ± ± ± ±

Adult 9.6 7.7 10.1 9.3 9.4

133.3 139.4 137.1 126.4 194.2

nH

V(H+)-ATPase

± ± ± ± ±

6.4 6.7 7.0 6.3 8.5

(Na+,K+)-ATPasea

V(H+)-ATPase

Juvenile

Adult

Juvenile

Adult

0.61 ± 0.01 1.40 ± 0.07 – – –

0.21 ± 0.02 0.26 ± 0.02 – – –

0.18 0.51 2.35 4.06 1.88

0.21 1.03 2.02 3.00 4.76

± ± ± ± ±

0.01 0.02 0.12 0.20 0.08

± ± ± ± ±

0.01 0.05 0.10 0.15 0.23

(Na+,K+)-ATPasea

Juv.

Adult

Juv.

Adult

2.3 3.9 – – –

1.3 1.6 – – –

1.0 1.3 1.0 1.3 1.0

1.0 1.7 1.0 2.2 1.9

Bafilomycin A1 inhibition

KI (μmol L−1)

Adult 24.2 ± 1.2

Data from Leone et al. (2012).

were identical in both stages as was enzyme distribution in the pillar cell flanges and marginal canals of the gill lamellae. V(H+)-ATPase activity appears to sustain a good deal of the Na+ uptake by M. amazonicum gills when in fresh water (McNamara and Faria, 2012), although apical antiporters, such as the Na+/H+ and Na+/NH+ 4

60 45

20

3

4

- Log [MgCl2] (mol L-1)

10

4

60 45

3

30

50

1/Vc (U mg-1)x103

15

-1

30

nmol Pi min mg

-1

-1

30

-1

nmol Pi min mg

nmol Pi min mg

40

-1

A

exchangers (Towle et al., 1997), may also contribute to Na+ uptake. V(H+)-ATPase activities have been measured in anterior and posterior gills of freshwater crabs, including Eriocheir sinensis (Onken and Putzenlechner, 1995; Morris, 2001) and Dilocarcinus pagei (Weihrauch et al., 2004), and a gill V(H+)-ATPase already has been partially characterized kinetically in microsomal gill preparations of M. amazonicum (Faleiros et al., 2010) and D. pagei (Firmino et al., 2011). In contrast, V(H+)-ATPase activity is very reduced in the euryhaline blue crabs

-1

a

Juvenile 45.0 ± 2.3

40 30

15

- Log [MgCl2] (mol L-1)

20 10 20 30 40 50 -1 [Bafilomycin] (nmol L )

8

7

- Log [Bafilomycin] (mol L )

B

60

9

-1

45

15

4

3

-1

5

30

- Log [MgCl2] (mol L-1)

20

5

4

60 45 50

30 15

1/Vc (U mg-1)x103

-1

30

nmol Pi min mg

nmol Pi min-1 mg-1

40

-1

nmol Pi min mg

-1

10

A

40 30

- Log [MgCl2] (mol L-1) Fig. 7. Effect of Mg2+ on microsomal V(H+)-ATPase activity in gill tissue from juvenile and adult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPES buffer, pH 7.5, containing ATP (5 mmol L−1 for juveniles and 2 mmol L−1 for adults), 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg protein for juveniles (A) and adults (B), respectively. Activity was also estimated as above with 4 μmol L−1 bafilomycin A1. Duplicate aliquots from three different gill homogenates were used. Data are the mean ± SD. Inset: orthovanadate-insensitive ATPase activity (●) and bafilomycin-insensitive ATPase activity (○).

B

10 20 30 -1 [Bafilomycin] (nmol L )

3 10

9

8

7 -1

- Log [Bafilomycin] (mol L ) Fig. 8. Effect of bafilomycin A1 on microsomal V(H+)-ATPase activity in gill tissue from juvenile and adult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPES buffer, pH 7.5, containing ATP (5 mmol L−1 for juveniles and 2 mmol L−1 for adults), 5 mmol L−1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg protein for juveniles (A) and adults (B), respectively. Duplicate aliquots from three different gill homogenates were used. Data are the mean ± SD. Inset: Dixon plot for estimation of KI.

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Fig. 9. V(H+)-ATPase B subunit mRNA expression from juvenile and adult forms of M. amazonicum. The analysis was assayed by real time RT-PCR using SYBR Green (BioRad). The values obtained are the ratio of the value of the expression observed between the gene of interest (B subunit) in each ontogenetic stage and the value of the expression of the endogenous control (PRL10) in the same ontogenetic stage. The calculated values represent the mean ± SD (N = 3).

Callinectes danae (Masui et al., 2002) and Callinectes ornatus (Garçon et al., 2009), and in M. amazonicum after high salinity acclimation (Faleiros et al., 2010). Lee et al. (2011) have shown that the V(H+)ATPase exhibits an evolutionary shift to elevated activity in freshwater populations of the copepod Eurytemora affinis. Maximal gill V(H+)-ATPase in M. amazonicum was found at pH 7.5 independently of ontogenetic stage and is in close agreement with data for several crustaceans (Onken and Putzenlechner, 1995; Zare and Greenaway, 1998; Onken et al., 2000; Weihrauch et al., 2004; Pan et al., 2007; Firmino et al., 2011). In contrast, V(H+)-ATPase activity of the mussel Cygnea anadonta decreases considerably near pH 8.0 (Oliveira et al., 2004). V(H+)-ATPase activity in vacuoles isolated from cells cultivated at pH 7.5 is greater than at pH 4, a difference attributed to higher levels of V1 assembly in the vacuoles from cells cultivated at high pH (Paddilla-Lopez and Pearce, 2006; Diakov and Kane, 2010). The diminished V(H+)-ATPase activity at lower pH likely reflects altered c-subunit structure, occluding the proton binding sites and preventing transport (Rastogi and Girvin, 1999; Müller et al., 2002). Our findings reveal important ontogenetic differences in gill V(H+)ATPase kinetics in M. amazonicum gill microsomes, particularly with regard to the adult shrimp enzyme that exhibits unusual kinetic characteristics. Its apparent affinity for ATP is 3-fold greater than the juvenile, and 5.5- and 20-times greater, respectively, than the microsomal gill enzyme from M. amazonicum (Faleiros et al., 2010) and D. pagei (Firmino et al., 2011). The K0.5 value for Mg2+ of the adult gill V(H+)-ATPase is 5-fold less than that for the juvenile, and is 2- and 4fold less, respectively, than for M. amazonicum (Faleiros et al., 2010) and D. pagei (Firmino et al., 2011). The inhibition constant for bafilomycin A1 of the adult enzyme is 2-fold less than for the juvenile, and is 10-fold higher than previously reported for M. amazonicum (Faleiros et al., 2010), and 2.5-fold less than for D. pagei (Firmino et al., 2011). The different apparent affinities for ATP and Mg2 + of the V(H+)-ATPase from M. amazonicum gills in distinct ontogenetic stages suggest the expression of different isoenzymes that may contribute to long-term activity regulation. Although the ATP and Mg2 + binding sites are located on the V1 A and B subunits (Kawasaki-Nishi et al., 2003; Nakanishi-Matsui et al., 2010; Toei et al., 2010), the expression of different subunit isoforms may induce long-term conformational changes, affecting substrate and ion affinities. Our findings differ considerably from Faleiros et al. (2010) a fact that may be attributed to the distinct shrimp populations used. We used juvenile and adult M. amazonicum cultivated from Amazonian (Pará) broodstock while Faleiros et al. (2010) trapped wild shrimps from a small lake in northern São Paulo state. Different populations of this species exhibit distinct morphological, morphometric and osmoregulatory capabilities (Anger and Hayd, 2010; Charmantier and Anger, 2011). Gill (Na+, K+)-ATPase activity in the fiddler crab Uca formosensis is unaffected on exposure to dilute seawater (5‰S), suggesting that

23

V(H+)-ATPase may provide the driving force for Na+ uptake by generating a proton gradient that facilitates Na+ influx (Tsai and Lin, 2007). The gill V(H+)-ATPase specific activity measured here under optimal conditions is similar in juvenile and adult M. amazonicum, although gill (Na+, K+)-ATPase specific activity is 50% less in adults (Leone et al., 2012, and Table 2). However, gill V(H+)-ATPase specific activity in M. amazonicum is 50% greater than in D. pagei (Firmino et al., 2011) and previously in adult M. amazonicum (Faleiros et al., 2010), which suggests methodological differences. Since adult M. amazonicum maintain hemolymph Na+ and Cl− concentrations at ≈ 120 and ≈ 150 mmol L− 1, respectively, when in fresh water (Augusto et al., 2007), this V(H+)-ATPase activity likely drives active Na+ uptake across the gills as typically seen in strong hyperosmoregulators (Freire et al., 2008; Belli et al., 2009). Our immunofluorescence findings show the V(H+)-ATPase to be located in the apical region of the gill pillar cells in juvenile and adult M. amazonicum, as also seen in early and late juveniles (BoudourBoucheker et al., 2014). In crustaceans, the subcellular localization of the V(H+)-ATPase is variable, and the apical distribution is suggestive of adaptation to fresh water (Tsai and Lin, 2007; McNamara and Faria, 2012). In marine crabs like Scylla paramamosain, Macrophtalmus abbreviatus, Macrophtalmus banzai (Tsai and Lin, 2007) and Carcinus maenas (Weihrauch et al., 2001) the gill cells exhibit a cytosolic V(H+)-ATPase distribution, reflecting a reduced role in osmoregulation (Tsai and Lin, 2007). In M. amazonicum, the apical surface of the lamellar epithelium is highly amplified by extensive evaginations associated with mitochondria in the sub-apical cytoplasm, evidently coupled to ion uptake (Faleiros et al., 2010). Such evaginations would increase the apical membrane area available for insertion of transport proteins − like the V(H+)-ATPase and the HCO− exchanger (Faleiros et al., 3 /Cl − − 2010). In E. sinensis, Cl transport via the HCO− exchanger is 3 /Cl HCO− gradient-dependent and is complemented by a V(H+)-ATPase 3 putatively located in the apical pillar cell evaginations (Onken, 1996). The V(H+)-ATPase was densely distributed in the marginal channels of the gill lamellae in both juvenile and adult shrimps. This channel is important in the collection and distribution of hemolymph through the capillaries and lacunae across each hemi-lamella and serves as a shunt under certain conditions (McNamara and Lima, 1997). The notable presence of the enzyme in the marginal channels suggests important ion transport activity at sites in the gill epithelium other than the apical pillar cell flanges. While the B subunit of the V(H+)-ATPase is highly conserved across the animal kingdom (Weihrauch et al., 2001; Faleiros et al., 2010), various different subunit isoforms are reported for mammalian and yeast enzymes (Sun-Wada and Wada, 2010; Toei et al., 2010), and isoformspecific regulation of enzyme activity by selective targeting and regulation of the coupling efficiency of proton transport and ATP hydrolysis is also well established (Sun-Wada and Wada, 2010; Toei et al., 2010). In this regard, our findings provide the first suggestion of different V(H+)-ATPase subunit isoforms in crustaceans. Acknowledgments This investigation was supported by research grants from the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP, 2010/17534-0), Conselho de Desenvolvimento Científico e Tecnológico (CNPq, 473990/2009-1 to JCM) and Fundação de Amparo à Pesquisa do Estado do Amazonas (INCT/CNPq/FAPEAM 573976/2008-2). MNL received an undergraduate scholarship from FAPESP (2010/16115-3). DPG and MRP received post-doctoral scholarships from FAPESP (2010/ 06395-9) and CNPq (560501/2010-2) respectively. FAL (302776/ 2011-7) and JCM (300662/2009-2) received research scholarships from CNPq. We thank Nilton Rosa Alves for technical assistance. This laboratory (FAL) is integrated with the Amazon Shrimp Network (Rede de Camarão da Amazônia) and with INCT ADAPTA (Centro de Estudos de Adaptações da Biota Aquática da Amazônia).

24

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

References Alzamora, R., Thali, R.F., Gong, F., Smolak, C., Li, H., Baty, C.J., Bertrand, C.A., Auchli, Y., Brunisholz, R.A., Neumann, D., Hallows, K.R., Pastor-Soler, N.M., 2010. PKA regulates vacuolar H+ ATPse localization and activity via direct phosphorylation of the A subunit in kidney cells. J. Biol. Chem. 285, 24676–24685. Anger, K., 2013. Neotropical Macrobrachium (Caridea: Palaemonidae): on the biology, origin, and radiation of freshwater-invading shrimp. J. Crustac. Biol. 33, 151–183. Anger, K., Hayd, L., 2010. Feeding and growth in early larval shrimp Macrobrachium amazonicum from the Pantanal, southwestern Brazil. Aquat. Biol. 9, 251–261. Araújo, M.C., Valenti, W.C., 2007. Feeding habit of the Amazon River prawn Macrobrachium amazonicum larvae. Aquaculture 265, 187–193. Augusto, A., Greene, L.J., Laure, H.J., McNamara, J.C., 2007. The ontogeny of isosmotic intracellular regulation in the diadromous, freshwater palaemonid shrimps, Macrobrachium amazonicum and M. olfersi (Crustacea, Decapoda). J. Crustac. Biol. 27, 626–634. Augusto, A., Pinheiro, A.S., Greene, L.J., Laure, H.J., McNamara, J.C., 2009. Evolutionary transition to freshwater by ancestral marine palaemonids: evidence from osmoregulation of in a tide pool shrimp. Aquat. Biol. 7, 113–122. Belli, N.M., Faleiros, R.O., Firmino, K.C.S., Masui, D.C., Leone, F.A., McNamara, J.C., Furriel, R.P.M., 2009. Na, K-ATPase activity and epithelial interfaces in gills of the freshwater shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae). Comp. Biochem. Physiol. 152A, 431–439. Bianchini, A., Lauer, M.M., Pedroso, M.S., Barcarolli, I.F., Martins, S.E.G., Lima, A.F.A., Pinho, G.L.L., 2007. Osmoregulation in estuarine invertebrates: effects of metals. Comp. Biochem. Physiol. 148A, S67 Abstracts. Boron, W.F., 1986. Intracellular pH regulation in epithelial cells. Ann. Rev. Physiol. 48, 377–388. Boudour-Boucheker, N., Boulo, V., Charmantier-Daures, M., Grousset, E., Anger, K., Charmantier, G., Lorin-Nebel, C., 2014. Differential distribution of V-type H+-ATPase and Na+/K--ATPase in the branchial chamber of the palaemonid shrimp Macrobrachium amazonicum. Cell Tissue Res. 353, 87–98. Charmantier, G., Anger, K., 2011. Ontogeny of osmoregulatory patterns in the South American shrimp Macrobrachium amazonicum: loss of hypo-regulation in a landlocked population indicates phylogenetic separation from estuarine ancestors. J. Exp. Mar. Biol. Ecol. 396, 89–98. Diakov, T.T., Kane, P.M., 2010. Regulation of vacuolar proton-translocating ATPase activity and assembly by extracellular pH. J. Biol. Chem. 285, 23771–23778. Faleiros, R.O., Goldman, M.H.S., Furriel, R.P.M., McNamara, J.C., 2010. Differential adjustment in gill Na+/K+- and V-ATPase activities and transporter mRNA expression during osmoregulatory acclimation in the cinnamon shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae). J. Exp. Biol. 213, 3894–3905. Firmino, K.C.S., Faleiros, R.O., Masui, D.C., McNamara, J.C., Furriel, R.P.M., 2011. Short- and long-term, salinity-induced modulation of V-ATPase activity in the posterior gills of the true freshwater crab, Dilocarcinus pagei (Brachyura, Trichodactylidae). Comp. Biochem. Physiol. 160B, 24–31. Forgac, M., 2007. Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Mol. Cell. Biol. 8, 917–929. Foster, C., Amado, E.M., Souza, M.M., Freire, C., 2010. Do osmoregulators have lower capacity of muscle water regulation than osmoconfomers? A study on Decapod Crustaceans. J. Exp. Zool. 313A, 80–94. França, J.L., Pinto, M.R., Lucena, M.N., Garçon, D.P., Valenti, W.C., McNamara, J.C., Leone, F.A., 2013. Subcellular localization and kinetic characterization of a gill (Na+, K+)-ATPase from the giant freshwater prawn Macrobrachium rosenbergii. J. Membr. Biol. 246, 529–543. Freire, C.A., Cavassin, F., Rodrigues, E.N., Torres, A.H., McNamara, J.C., 2003. Adaptive patterns of osmotic and ionic regulation, and the invasion of fresh water by the palaemonid shrimps. Comp. Biochem. Physiol. 136A, 771–778. Freire, C.A., Onken, H., McNamara, J.C., 2008. A structure–function analysis of ion transport in crustacean gills and excretory organs. Comp. Biochem. Physiol. 151A, 272–304. Garçon, D.P., Masui, D.C., Mantelatto, F.L.M., Furriel, R.P.M., McNamara, J.C., Leone, F.A., 2009. Hemolymph ionic regulation and adjustments in gill (Na+, K+)-ATPase activity during salinity acclimation in the swimming crab Callinectes ornatus (Decapoda, Brachyura). Comp. Biochem. Physiol. 154A, 44–55. Genovese, G., Ortiz, N., Urcola, M.R., Luquet, C.M., 2005. Possible role of carbonic anhydrase, V-H+-ATPase, and Cl−/HCO− 3 exchanger in electrogenic ion transport across the gills of the euryhaline crab Neohelice granulatus. Comp. Biochem. Physiol. 142A, 362–369. Gilles, R., Péqueux, A., 1985. Ion transport in crustacean gills: physiological and ultrastructural approaches. In: Gilles, R., Gilles-Baillien, M. (Eds.), Transport Processes, Ionoand Osmoregulation, Current Comparative Approaches. Springer, Berlin, pp. 136–158. Glenner, H., Thomsen, P.F., Hebsgaard, M.B., Sørensen, M.V., Willerslev, E., 2006. The origin of insects. Science 314, 1883–1884. Gordon, J.A., 1991. Use of vanadate as protein-phosphotyrosine phosphatase inhibitor. Methods Enzymol. 201, 477–482. Hayd, L.A., Anger, K., Valenti, W.C., 2008. The moulting cycle of larval Amazon River prawn Macrobrachium amazonicum reared in the laboratory. Nauplius 16, 55–63. Heinonen, S.K., Lahti, R.J., 1981. A new and convenient colorimetric determination of inorganic orthophosphate and its application to the assay of inorganic pyrophosphatase. Anal. Biochem. 113, 313–317. Henry, R.P., Lucu, C., Onken, H., Weihrauch, D., 2012. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid–base balance, ammonia excretion, and bioaccumulation of toxic metals. Front. Physiol. 3, 1–33. Holthius, L.B., 1952. A general revision of the Palaemonidae (Crustacea, Decapoda, Natantia) of the Americas, II: the subfamily Palaemoninae, Allan Hancock Foundation publications. Occas. Pap. 12, 1–396.

Imamura, H., Nakano, M., Noji, H., Muneyuki, E., Ohkuma, S., Yoshida, M., Yokoyama, K., 2003. Proc. Natl. Acad. Sci. U. S. A. 100, 2312–2315. Jefferies, K., Cipriano, D.J., Forgac, M., 2008. Function, structure and regulation of the vacuolar (H+)-ATPases. Arch. Biochem. Biophys. 476, 33–42. Journet, A., Chapel, A., Jehan, S., Adessi, C., Freeze, H., Klein, G., Garin, J., 1999. Characterization of Dictyostelium discoideum cathepsin D: molecular cloning, gene disruption, endo-lysosomal localization and sugar modifications. J. Cell Sci. 112, 3833–3843. Kane, P.M., 2006. The where, when and how of organelle acidification by the yeast vacuolar H+-ATPase. Microbiol. Mol. Biol. Rev. 70, 177–191. Kawasaki-Nishi, S., Bowers, K., Nishi, T., Forgac, M., Stevens, T.H., 2001. The aminoterminal domain of the vacuolar proton translocating ATPase subunit controls targeting and in vivo dissociation, and the carboxyl-terminal domain affects coupling of proton transport and ATP hydrolysis. J. Biol. Chem. 276, 47411–47420. Kawasaki-Nishi, S., Nishi, T., Forgac, M., 2003. Proton translocation driven by ATP hydrolysis in V-ATPases. FEBS Lett. 545, 76–85. Kirschner, L.B., 2004. The mechanism of sodium chloride uptake in hyperregulating aquatic animals. J. Exp. Biol. 207, 1439–1452. Laemmli, U.K., 1970. Cleavage of structural proteins during assembly of head of bacteriophage-T4. Nature 227, 680–685. Lee, C.E., Kiergaard, M., Gelembiuk, G.W., Eads, B.D., Posavi, M., 2011. Pumping ions: rapid parallel evolution of ionic regulation following habitat invasions. Evolution 65, 2229–2244. Leone, F.A., Baranauskas, J.A., Furriel, R.P.M., Borin, I.A., 2005. An easy-to-use program for fitting enzyme kinetic data. Biochem. Mol. Biol. Educ. 33, 399–403. Leone, F.A., Masui, D.C., Bezerra, T.M.S., Garçon, D.P., Valenti, W.C., Augusto, A.S., McNamara, J.C., 2012. Kinetic analysis of gill (Na+, K+)-ATPase activity in selected ontogenetic stages of the Amazon River shrimp, Macrobrachium amazonicum (Decapoda, Palaemonidae): interactions at ATP- and cation-binding sites. J. Membr. Biol. 245, 201–215. Lignot, J.H., Charmantier, G., 2001. Immunolocalization of Na+, K+-ATPase in the branchial cavity during the early development of the European lobster Homarus gammarus (Crustacea, Decapoda). J. Histochem. Cytochem. 49, 1013–1023. Lucena, M.N., Garçon, D.P., Mantelatto, F.F.M., Pinto, M.R., McNamara, J.C., Leone, F.A., 2012. Hemolymph ion regulation and kinetic characteristics of the gill (Na+, K+)ATPase in the hermit crab Clibanarius vittatus (Decapoda, Anomura) acclimated to high salinity. Comp. Biochem. Biophys. 161B, 380–391. Lucu, C., Towle, D.W., 2003. (Na+, K+)-ATPase in gills of aquatic crustacea. Comp. Biochem. Physiol. 135A, 195–214. Luquet, C.M., Weihrauch, D., Senek, M., Towle, D.W., 2005. Induction of branchial ion transporter mRNA expression during acclimation to salinity change in the euryhaline crab Chasmagnathus granulatus. J. Exp. Biol. 208, 3627–3636. Magalhães, C., Bueno, S.L.S., Bond-Buckup, G., Valenti, W.C., Silva, H.L.M., Kiyohara, F., Mossolin, E.C., Rocha, S.S., 2005. Exotic species of freshwater decapod crustaceans in the state of São Paulo, Brazil: records and possible causes of their introduction. Biodivers. Conserv. 14, 1929–1945. Marks, M.J., Seeds, N.W., 1978. A heterogeneous ouabain–ATPase interaction in mouse brain. Life Sci. 23, 2735–2744. Masui, D.C., Furriel, R.P.M., McNamara, J.C., Mantelatto, F.L.M., Leone, F.A., 2002. Modulation by ammonium ions of gill microsomal (Na+, K+)-ATPase in the swimming crab Callinectes danae: a possible mechanism for regulation of ammonia excretion. Comp. Biochem. Physiol. 132C, 471–482. McNamara, J.C., Faria, S.C., 2012. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: a review. J. Comp. Physiol. 182B, 997–1014. McNamara, J.C., Lima, A.G., 1997. The route of ion water movements across the gill epithelium of the freshwater shrimp Macrobrachium olfersii (Decapoda, Palaemonidae): evidence from ultrastructural changes induced by acclimation to saline media. Biol. Bull. 192, 321–331. McNamara, J.C., Torres, A.H., 1999. Ultracytochemical location of Na+/K+-ATPase activity and effects of high salinity acclimation in gill and renal epithelia of the freshwater shrimp Macrobrachium olfersii (Crustacea, Decapoda). J. Exp. Biol. 284, 617–628. Moreira, G.S., McNamara, J.C., Shumway, S.E., Moreira, P.S., 1983. Osmoregulation and respiratory metabolism in Brazilian Macrobrachium (Decapoda, Palaemonidae). Comp. Biochem. Physiol. 74A, 57–62. Moreira, G.S., McNamara, J.C., Moreira, P.S., 1986. The effect of salinity on the upper thermal limits of survival and metamorphosis during larval development in Macrobrachium amazonicum (Heller) (Decapoda, Palaemonidae). Crustaceana 50, 231–238. Morris, S., 2001. Neuroendocrine regulation of osmoregulation and the evolution of airbreathing in decapod crustaceans. J. Exp. Biol. 204, 979–989. Müller, O., Bayer, M.J., Peters, C., Andersen, J.S., Mann, M., Mayer, A., 2002. The Vtc proteins in vacuole fusion: coupling NSF activity to V0 trans-complex formation. EMBO J. 21, 259–269. Murphy, N.P., Austin, C.M., 2005. Phylogenetic relationships of the globally distributed freshwater prawn genus Macrobrachium (Crustacea: Decapoda: Palaemonidae): biogeography, taxonomy and the convergent evolution of abbreviated larval development. Zool. Scr. 34, 187–197. Nakanishi-Matsui, M., Sekiya, M., Nakamoto, R.K., Futai, M., 2010. The mechanism of rotating proton pumping ATPases. Biochim. Biophys. Acta 1797, 1343–1352. Odinetz-Collart, O., Rabelo, H., 1996. Variation in egg size of the fresh-water prawn Macrobrachium amazonicum (Decapoda: Palaemonidae). J. Crustac. Biol. 16, 684–688. Oliveira, P.F., Lopes, I.A., Barrias, C., Rebelo da Costa, A.M., 2004. H+-ATPase of crude homogenate of the outer mantle ephitelium of Anodonta cygnea. Comp. Biochem. Physiol. 139, 425–432. Onken, H., 1996. Active and electrogenic absorption of Na+and Cl- across posterior gills of Eriocher sinensis: influence of short-term osmotic variations. J. Exp. Biol. 199, 901–910.

M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25 Onken, H., McNamara, J.C., 2002. Hyperosmoregulation in the red freshwater crab Dilocarcinus pagei (Brachyura, Trichodactylidae): structural and functional asymmetries of the posterior gills. J. Exp. Biol. 205, 167–175. Onken, H., Putzenlechner, M., 1995. A V-ATPase drives active, electrogenic and Na+- independent Cl- absorption across the gills of Eriocheir sinensis. J. Exp. Biol. 198, 767–774. Onken, H., Schobel, A., Kraft, J., Putzenlechner, M., 2000. Active NaCl absorption across split lamellae of posterior gills of the Chinese crab Eriocher sinensis: stimulation by eyestalk extract. J. Exp. Biol. 203, 1373–1381. Paddilla-Lopez, S., Pearce, D.A., 2006. Saccharomyces cerevisiae lacking Btn1p modulate vacuolar ATPase activity to regulate pH imbalance in the vacuole. J. Biol. Chem. 281, 10273–10280. Pan, L.Q., Zhang, L.J., Liu, H., 2007. Effects of salinity and pH on ion-transport enzyme activities, survival and growth of Litopenaeus vannamei postlarvae. Aquaculture 273, 711–720. Péqueux, A., 1995. Osmotic regulation in crustaceans. J. Crustac. Biol. 15, 1–60. Pileggi, L.G., Mantelatto, F.L.M., 2012. Taxonomic revision of doubtful Brazilian freshwater species of genus Macrobrachium (Decapoda, Palemonidae). Iheringia 102, 426–437. Rastogi, V.K., Girvin, M.E., 1999. Structural changes linked to proton translocation by subunit c of the ATP synthase. Nature 402, 263–268. Read, S.M., Northcote, D.H., 1981. Minimization of variation in the response to different proteins of the coomassie blue-g dye-binding assay for protein. Anal. Biochem. 116, 53–64. Rudolph, F.B., Baugher, B.W., Beissner, R.S., 1979. Techniques in coupled enzyme assays. Methods Enzymol. 63, 22–42. Santos, L.C.F., Belli, N.M., Augusto, A., Masui, D.C., Leone, F.A., McNamara, J.C., Furriel, R.P.M., 2007. Gill (Na+, K+)-ATPase in diadromous, freshwater palaemonid shrimps: speciesspecific kinetic characteristics and α-subunit expression. Comp. Biochem. Physiol. 148A, 178–188. Saroussi, S., Nelson, N., 2009. The little we know on the structure and machinery of VATPase. J. Exp. Biol. 212, 1604–1610.

25

Stevens, T.H., Forgac, M., 1997. Structure, function and regulation of the vacuolar H+ ATPase. Annu. Rev. Cell Dev. Biol. 13, 779–808. Sun-Wada, G.H., Wada, Y., 2010. Vacuolar-type proton pump ATPases: roles of subunit isoforms in physiology and pathology. Histol. Histopathol. 25, 1611–1620. Taylor, H.H., Taylor, E.W., 1992. Gills and lungs: the exchange of gases and ions. In: Harrison, F.W., Humes, A.G. (Eds.), Microscopic Anatomy of Invertebrates, Decapod Crustacea vol. 10. Wiley-Liss, New York, pp. 203–293. Toei, M., Saum, R., Forgac, M., 2010. Regulation and isoform function of the V-ATPases. Biochemistry 49, 4715–4723. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets — procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 76, 4350–4354. Towle, D.W., Kays, W.T., 1986. Basolateral localization of Na+, K+-ATPase in gill epithelium of two osmoregulating crabs, Callinectes sapidus e Carcinus maenas. J. Exp. Zool. 239, 311–318. Towle, D.W., Rushton, M.E., Heidysch, D., Magnani, J.J., Rose, M.J., Amstutz, A., Jordan, M.K., Shearer, D.W., Wu, W.S., 1997. Sodium/proton antiporter in the euryhaline crab Carcinus maenas: molecular cloning, expression and tissue distribution. J. Exp. Biol. 200, 1003–1014. Tsai, J.R., Lin, H.C., 2007. V-type H1-ATPase and Na, K-ATPase in the gills of 13 euryhaline crabs during salinity acclimation. J. Exp. Biol. 210, 620–627. Weihrauch, D., Ziegler, A., Siebers, D., Towle, D.W., 2001. Molecular characterization of Vtype H+-ATPase (B subunit) in gill of euryhaline crab and its physiological role in osmoregulatory ion uptake. J. Exp. Biol. 204, 25–37. Weihrauch, D., McNamara, J.C., Towle, D., Onken, H., 2004. Ion-motive ATPases and active transbranchial NaCl uptake in the red freshwater crab Dilocarcinus pagei (Decapoda, Trichodactylidae). J. Exp. Biol. 207, 4623–4631. Zare, S., Greenaway, P., 1998. The effect of moulting and sodium depletion on sodium transport and the activities of NaK-ATPase and V-ATPase in the freshwater crayfish Cherax destructor (Crustacea: Parastacidae). Comp. Biochem. Physiol. 119A, 739–745.