186, 179-181 (1990)
ANAI,YTI(‘AI,BIO(‘HEMlSTKY
A Gel Electrophoretic Assay for Detecting Defect in Ashkenazi Jewish Carriers of Tay-Sachs Disease Shirah
Shore and Rachel
the Insertion
Myerowitz
The Laboratory of Biochemistry and Metabolism, National Institutes of Diabetes and Digestive National Institutes of Health, Building 10, Room 9N-114, Bethesda, Maryland 20892
Received
November
and Kidney
Diseases,
14,1989
MATERIALS A simple, rapid, nonradioactive assay for detecting the 4-bp insertion defect found in the &hexosaminidase a-chain gene of 70% of the Ashkenazi Jewish carriers of Tay-Sachs disease is described. In this assay, DNA derived from such carriers serves as a template for the polymerase chain reaction. Following amplification of a 159-bp fragment of exon 11 inclusive of the insertion, a portion of the product is subjected to electrophoresis in a 4% NuSieve agarose minigel. Visualization of the DNA with ethidium bromide demonstrates that heterozygote carriers for the defect display two distinct bands. In contrast, DNA from carriers of the splice junction defect, a mutation found in 30% of the Ashkenazi Jewish carriers of Tay-Sachs disease, displays only one band. iv 1990 Academic Press. Inc.
One of every thirty Ashkenazi Jews is a carrier for a severe and fatal type of Tay-Sachs disease known as the “classic” form. This represents a carrier frequency lofold higher than that of the general population. Mutation in the gene coding for the a-chain polypeptide of the lysosomal enzyme P-hexosaminidase A results in a lack of functioning enzyme and is the underlying cause of Tay-Sachs disease (1). We recently discovered that 70% of the Ashkenazi Jewish carriers of classic Tay-Sachs disease bear a 4-bp insertion in exon 11 of the a-chain gene (2). The remaining carriers from this ethnic group have a splice junction mutation at the 5’ border of intron 12 (3,4). Although carrier screening is still exclusively done via enzymatic assay, there are instances where identity of the carrier genotype may be desirable. We previously described dot blot assays for detection of the insertion (2) and splice junction (4) lesions. This report describes a rapid, simple, and inexpensive assay for the insertion defect that does not require the use of radioactivity. 0003.2697/90 $3.00 Copyright 0 1990 by Academic Press, All rights of reproduction in any form
AND
METHODS
DNA Sources DNA from fibroblast cultures GM2968 and GM515 obtained from the National Institute of General Medical Sciences Human Genetic Cell Repository (Camden, NJ), was isolated as described (5). DNA from normal and carrier Ashkenazi Jews was isolated from leukocyte pellets (6) generously provided by Eugene Grebner of Thomas Jefferson University (Philadelphia, PA). DNA from a classic Ashkenazi Jewish Tay-Sachs patient was obtained from whole blood (6) secured by Lyndon Badal of Long Island Jewish Hospital. Plasmids containing a 6-kb fragment of the normal a-chain gene encompassing exons 9-13 (7) and a similar fragment of the mutant (Ychain gene bearing the insertion (2) were isolated by alkali lysis and further purified by CsCl density gradient centrifugation (8). Assay for Carriers of the Insertion Defect Genomic DNA (1 pg) derived from cultured cells, whole blood, or leukocyte pellets was used as the initial template in the polymerase chain reaction to amplify a segment of exon 11 of the P-hexosaminidase a-chain gene that encompasses the insertion defect. The reaction was carried out for 27 cycles utilizing two 23-base primers, 5’- GTGTGGCGAGAGGATATTCCAGT - 3’ and 5’-TTCAAATGCCAGGGGTTCCACTA-3’ (Midland Certified Reagent Co.), and Tag1 polymerase along with a DNA amplification kit (Gene Amp, Perkin-Elmer Cetus) as described (2). Following amplification, the reaction mixture was extracted with an equal volume of chloroform-isoamyl alcohol (24:l). One-tenth of each sample was subjected to electrophoresis (20 V/cm) in a low-melting agarose (4% NuSieve, FMC Corp.) minigel, prepared in a borate buffer. After the bromphenol blue 179
Inc. reserved.
180
SHORE
dye reached the bottom of the gel, it was stained ethidium bromide to visualize the DNA. RESULTS
AND
AND
with
DISCUSSION
We previously described a dot blot assay for the insertion defect in exon 11 of the a-chain gene of fl-hexosaminidase (2). This assay requires amplification of a 159-bp region of exon 11 encompassing the 4-bp insertion followed by hybridization of duplicate samples with two 32P-labeled 19-base oligomers, one with a sequence complementary to normal exon 11 and the other with a sequence complementary to mutant exon 11. Prior to hybridization, one-tenth of each amplified sample is routinely subjected to electrophoresis in a 4% NuSieve lowmelting agarose gel (a matrix which effectively separates low-molecular-weight DNA fragments) to inspect the quality and quantity of the products. Amplified samples from an individual homozygous for normal exon 11 (B.W.) and from a patient homozygous for the exon 11 insertion defect (A.B.) each displayed one major band of nearly equivalent mobility that stained with ethidium (Fig. 1). These results were anticipated because we assumed that NuSieve agarose would not be capable of resolving a 4-bp size difference. [Close inspection of the gel does reveal a slight retardation of electrophoretic mobility of the patient (A.B.) sample relative to the normal one (B.W.).] Similar results were obtained following electrophoresis of amplified plasmid DNAs bearing a normal genomic a-chain fragment inclusive of exon 11 (pN)’ and the corresponding mutant genomic a-chain fragment (PM) (Fig. 1). Surprisingly, when the initial template for the polymerase chain reaction of exon 11 was DNA from an Ashkenazi Jewish carrier of the insertion mutation (S.S.), two clearly resolved bands were visible on a 4% NuSieve gel following electrophoresis of the amplified sample (Fig. 1). Similar results were obtained when DNA derived from cell culture GM515 or GM2968 was used as the template to amplify exon 11. Both of these cell types derive from Ashkenazi Jewish patients with Tay-Sachs disease who are heterozygous for the insertion defect. The other a-chain allele of GM2968 carries the splice junction lesion (2) and the second c-u-chain allele of GM515 bears a newly found single base change (manuscript in preparation). (Twenty other carriers of the insertion defect were tested and gave the double band pattern.) The data indicate that a DNA sample in which exon 11 has been amplified will display two bands upon electrophoresis in an agarose gel only when the initial DNA template used in the polymerase chain reaction is heterozygous for the insertion defect. i Abbreviations cr-chain fragment; chain fragment.
MYEROWITZ
used: pN, plasmid DNAs bearing a normal genomic pM, plasmid DNAs bearing a mutant genomic a-
FIG. 1. Agarose gel electrophoresis showing the amplification products of a segment of exon 11 from the a-chain gene of P-hexosaminidase. DNA derived from three types of Ashkenazi Jews: (i) a normal individual (B.W.), (ii) a carrier of Tay-Sachs disease (S.S.), and (iii) a patient affected with the disorder (A.B.). GM515, GM2968 and plasmid DNAs containing a normal genomic u-chain fragment inclusive of exon 11 (pN) and the corresponding mutant fragment bearing the insertion (PM) were used as templates to amplify a segment of 11 encompassing the insertion defect as described in the text. Amplification products were subjected to electrophoresis as described above. p-GEM markers (Promega) in far left lane from the bottom of the gel in base pairs: 126, 179,222, 350,396,460,517,676,1198,1605, and 2645.
These results can be explained as follows. The amplification reaction requires denaturation of duplex DNA followed by hybridization of the single-stranded species to specific short primers with subsequent synthesis of the long complementary strand (9). Initial reaction conditions, high concentrations of short primers and low concentrations of long DNA species, favor annealing of the single-stranded DNA species to the short primers rather than to the complementary single DNA strands. Therefore, following the synthesis reaction, two duplex
ELECTROPHORETIC
ASSAY
FOR
INSERTION
N N
159 159
M M
163 163
N M
159 163
v
FIG. 2. Duplex DNA products obtained from the amplification of exon 11 when the initial DNA template is heterozygous for the insertion defect. N is a 159.base segment of exon 11. M is a 163-base segment of exon 11 identical in sequence to N but including the 4-base insertion.
DEFECT
IN
JEWISH
TAY-SACHS
181
CARRIERS
that of a Tay-Sachs carrier. Electrophoresis of such an amplified sample revealed bands of a size identical to those observed after amplification of a heterozygote Ashkenazi Jewish carrier (Fig. 1). Likewise, denaturation and reannealing of this plasmid mixture without subjection to amplification should and do give a similar result (Fig. 1, pM, pN + A). The assay described above is simple and rapid because neither labeling of probes nor hybridization is required. The greatest advantage, however, is that no radioactivity need be used. ACKNOWLEDGMENT This work was supported Foundation Grant l-1071.
in part
by March
of Dimes
Birth
Defects
REFERENCES
DNA species, N-N, a 159-bp normal fragment of exon 11, and M-M, a 163-bp fragment of mutant exon 11, would be present in the amplification reaction (Fig. 2). However, as the amplification reaction proceeds, the concentration of long DNA species increases and annealing of single-stranded DNA to its complementary strand rather than to a primer can occur, allowing for the presence of a third species of DNA duplex, N-M, in the amplification reaction. The N-N duplex and M-M duplex are too close in size to be resolved by a 4% NuSieve agarose gel but the electrophoretic mobility of the N-M duplex is retarded and appears as a distinct band. The retardation may be caused by additional secondary structure due to looping out of the 4-base insertion (Fig. 2). Mixing equal amounts of the two plasmid DNAs, one containing a genomic fragment bearing normal exon 11 (pN) and the other a fragment with mutant exon 11 (PM), and subjecting this mixture to the polymerase chain reaction should mimick a genomic template heterozygote for the insertion defect and give results like
1. Sandhoff’, K., Conzelman, E., Neufeld, E. F., Kaback, M. M., and Suzuki, K. (1989) in The Metabolic Basis of Inherited Disease (&river, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., Eds.), pp. 180771809, McGraw-Hill, New York. 2. Myerowitz, R., and Costigan, F. C. (1988) J. Biol. Chem. 263, 18,587-18,589.
3. Arpaia.
E., Doubrille-Ross, A., Maler, T., Neote, Troxel, C., Stirling, J. L., Pitts, J. S., Bapat, A. M., Mahuran, D. J., Schuster, S. M., Clarke, J. A., and Gravel, R. A. (1988) Nature (London) Myerowitz, R. (1988) Proc. Natl. Acad. Sci. USA
4. 5. Maniatis,
T., Fritsch, E. F., and Sambrook, Cloning: A Laboratory Manual, Cold Spring Cold Spring Harbor, NY.
6. Bell, G. I., Karam, Sci. USA
J. H., and Rotter, 78,5759-5763.
K., Tropak, M., B., Lamhonwah, J. T. R., Lowden, 333,239-242. 85,3955-3959.
J. (1983) Molecular Harbor Laboratory,
W. J. (1981)
Proc. Natl.
Acad.
7. Prioa, R. L., and Soravia, E. (1987) J. Biol. Chem. 262, 56775681. 0. M., and Grill, L. K. (1983) Biochem. Bio8. Garger, S. J., Griffith, phys. Res. Commun. 117,835-842. 9. Mullis, K. B., and Faloona, F. A. (1987) in Methods in Enzymology (Wu, R., Ed.), Vol. 155, pp. 335-350, Academic Press, San Diego, CA.
ANAI,YTI(‘AI,BIO(‘HEMlSTKY
A Gel Electrophoretic Assay for Detecting Defect in Ashkenazi Jewish Carriers of Tay-Sachs Disease Shirah
Shore and Rachel
the Insertion
Myerowitz
The Laboratory of Biochemistry and Metabolism, National Institutes of Diabetes and Digestive National Institutes of Health, Building 10, Room 9N-114, Bethesda, Maryland 20892
Received
November
and Kidney
Diseases,
14,1989
MATERIALS A simple, rapid, nonradioactive assay for detecting the 4-bp insertion defect found in the &hexosaminidase a-chain gene of 70% of the Ashkenazi Jewish carriers of Tay-Sachs disease is described. In this assay, DNA derived from such carriers serves as a template for the polymerase chain reaction. Following amplification of a 159-bp fragment of exon 11 inclusive of the insertion, a portion of the product is subjected to electrophoresis in a 4% NuSieve agarose minigel. Visualization of the DNA with ethidium bromide demonstrates that heterozygote carriers for the defect display two distinct bands. In contrast, DNA from carriers of the splice junction defect, a mutation found in 30% of the Ashkenazi Jewish carriers of Tay-Sachs disease, displays only one band. iv 1990 Academic Press. Inc.
One of every thirty Ashkenazi Jews is a carrier for a severe and fatal type of Tay-Sachs disease known as the “classic” form. This represents a carrier frequency lofold higher than that of the general population. Mutation in the gene coding for the a-chain polypeptide of the lysosomal enzyme P-hexosaminidase A results in a lack of functioning enzyme and is the underlying cause of Tay-Sachs disease (1). We recently discovered that 70% of the Ashkenazi Jewish carriers of classic Tay-Sachs disease bear a 4-bp insertion in exon 11 of the a-chain gene (2). The remaining carriers from this ethnic group have a splice junction mutation at the 5’ border of intron 12 (3,4). Although carrier screening is still exclusively done via enzymatic assay, there are instances where identity of the carrier genotype may be desirable. We previously described dot blot assays for detection of the insertion (2) and splice junction (4) lesions. This report describes a rapid, simple, and inexpensive assay for the insertion defect that does not require the use of radioactivity. 0003.2697/90 $3.00 Copyright 0 1990 by Academic Press, All rights of reproduction in any form
AND
METHODS
DNA Sources DNA from fibroblast cultures GM2968 and GM515 obtained from the National Institute of General Medical Sciences Human Genetic Cell Repository (Camden, NJ), was isolated as described (5). DNA from normal and carrier Ashkenazi Jews was isolated from leukocyte pellets (6) generously provided by Eugene Grebner of Thomas Jefferson University (Philadelphia, PA). DNA from a classic Ashkenazi Jewish Tay-Sachs patient was obtained from whole blood (6) secured by Lyndon Badal of Long Island Jewish Hospital. Plasmids containing a 6-kb fragment of the normal a-chain gene encompassing exons 9-13 (7) and a similar fragment of the mutant (Ychain gene bearing the insertion (2) were isolated by alkali lysis and further purified by CsCl density gradient centrifugation (8). Assay for Carriers of the Insertion Defect Genomic DNA (1 pg) derived from cultured cells, whole blood, or leukocyte pellets was used as the initial template in the polymerase chain reaction to amplify a segment of exon 11 of the P-hexosaminidase a-chain gene that encompasses the insertion defect. The reaction was carried out for 27 cycles utilizing two 23-base primers, 5’- GTGTGGCGAGAGGATATTCCAGT - 3’ and 5’-TTCAAATGCCAGGGGTTCCACTA-3’ (Midland Certified Reagent Co.), and Tag1 polymerase along with a DNA amplification kit (Gene Amp, Perkin-Elmer Cetus) as described (2). Following amplification, the reaction mixture was extracted with an equal volume of chloroform-isoamyl alcohol (24:l). One-tenth of each sample was subjected to electrophoresis (20 V/cm) in a low-melting agarose (4% NuSieve, FMC Corp.) minigel, prepared in a borate buffer. After the bromphenol blue 179
Inc. reserved.
180
SHORE
dye reached the bottom of the gel, it was stained ethidium bromide to visualize the DNA. RESULTS
AND
AND
with
DISCUSSION
We previously described a dot blot assay for the insertion defect in exon 11 of the a-chain gene of fl-hexosaminidase (2). This assay requires amplification of a 159-bp region of exon 11 encompassing the 4-bp insertion followed by hybridization of duplicate samples with two 32P-labeled 19-base oligomers, one with a sequence complementary to normal exon 11 and the other with a sequence complementary to mutant exon 11. Prior to hybridization, one-tenth of each amplified sample is routinely subjected to electrophoresis in a 4% NuSieve lowmelting agarose gel (a matrix which effectively separates low-molecular-weight DNA fragments) to inspect the quality and quantity of the products. Amplified samples from an individual homozygous for normal exon 11 (B.W.) and from a patient homozygous for the exon 11 insertion defect (A.B.) each displayed one major band of nearly equivalent mobility that stained with ethidium (Fig. 1). These results were anticipated because we assumed that NuSieve agarose would not be capable of resolving a 4-bp size difference. [Close inspection of the gel does reveal a slight retardation of electrophoretic mobility of the patient (A.B.) sample relative to the normal one (B.W.).] Similar results were obtained following electrophoresis of amplified plasmid DNAs bearing a normal genomic a-chain fragment inclusive of exon 11 (pN)’ and the corresponding mutant genomic a-chain fragment (PM) (Fig. 1). Surprisingly, when the initial template for the polymerase chain reaction of exon 11 was DNA from an Ashkenazi Jewish carrier of the insertion mutation (S.S.), two clearly resolved bands were visible on a 4% NuSieve gel following electrophoresis of the amplified sample (Fig. 1). Similar results were obtained when DNA derived from cell culture GM515 or GM2968 was used as the template to amplify exon 11. Both of these cell types derive from Ashkenazi Jewish patients with Tay-Sachs disease who are heterozygous for the insertion defect. The other a-chain allele of GM2968 carries the splice junction lesion (2) and the second c-u-chain allele of GM515 bears a newly found single base change (manuscript in preparation). (Twenty other carriers of the insertion defect were tested and gave the double band pattern.) The data indicate that a DNA sample in which exon 11 has been amplified will display two bands upon electrophoresis in an agarose gel only when the initial DNA template used in the polymerase chain reaction is heterozygous for the insertion defect. i Abbreviations cr-chain fragment; chain fragment.
MYEROWITZ
used: pN, plasmid DNAs bearing a normal genomic pM, plasmid DNAs bearing a mutant genomic a-
FIG. 1. Agarose gel electrophoresis showing the amplification products of a segment of exon 11 from the a-chain gene of P-hexosaminidase. DNA derived from three types of Ashkenazi Jews: (i) a normal individual (B.W.), (ii) a carrier of Tay-Sachs disease (S.S.), and (iii) a patient affected with the disorder (A.B.). GM515, GM2968 and plasmid DNAs containing a normal genomic u-chain fragment inclusive of exon 11 (pN) and the corresponding mutant fragment bearing the insertion (PM) were used as templates to amplify a segment of 11 encompassing the insertion defect as described in the text. Amplification products were subjected to electrophoresis as described above. p-GEM markers (Promega) in far left lane from the bottom of the gel in base pairs: 126, 179,222, 350,396,460,517,676,1198,1605, and 2645.
These results can be explained as follows. The amplification reaction requires denaturation of duplex DNA followed by hybridization of the single-stranded species to specific short primers with subsequent synthesis of the long complementary strand (9). Initial reaction conditions, high concentrations of short primers and low concentrations of long DNA species, favor annealing of the single-stranded DNA species to the short primers rather than to the complementary single DNA strands. Therefore, following the synthesis reaction, two duplex
ELECTROPHORETIC
ASSAY
FOR
INSERTION
N N
159 159
M M
163 163
N M
159 163
v
FIG. 2. Duplex DNA products obtained from the amplification of exon 11 when the initial DNA template is heterozygous for the insertion defect. N is a 159.base segment of exon 11. M is a 163-base segment of exon 11 identical in sequence to N but including the 4-base insertion.
DEFECT
IN
JEWISH
TAY-SACHS
181
CARRIERS
that of a Tay-Sachs carrier. Electrophoresis of such an amplified sample revealed bands of a size identical to those observed after amplification of a heterozygote Ashkenazi Jewish carrier (Fig. 1). Likewise, denaturation and reannealing of this plasmid mixture without subjection to amplification should and do give a similar result (Fig. 1, pM, pN + A). The assay described above is simple and rapid because neither labeling of probes nor hybridization is required. The greatest advantage, however, is that no radioactivity need be used. ACKNOWLEDGMENT This work was supported Foundation Grant l-1071.
in part
by March
of Dimes
Birth
Defects
REFERENCES
DNA species, N-N, a 159-bp normal fragment of exon 11, and M-M, a 163-bp fragment of mutant exon 11, would be present in the amplification reaction (Fig. 2). However, as the amplification reaction proceeds, the concentration of long DNA species increases and annealing of single-stranded DNA to its complementary strand rather than to a primer can occur, allowing for the presence of a third species of DNA duplex, N-M, in the amplification reaction. The N-N duplex and M-M duplex are too close in size to be resolved by a 4% NuSieve agarose gel but the electrophoretic mobility of the N-M duplex is retarded and appears as a distinct band. The retardation may be caused by additional secondary structure due to looping out of the 4-base insertion (Fig. 2). Mixing equal amounts of the two plasmid DNAs, one containing a genomic fragment bearing normal exon 11 (pN) and the other a fragment with mutant exon 11 (PM), and subjecting this mixture to the polymerase chain reaction should mimick a genomic template heterozygote for the insertion defect and give results like
1. Sandhoff’, K., Conzelman, E., Neufeld, E. F., Kaback, M. M., and Suzuki, K. (1989) in The Metabolic Basis of Inherited Disease (&river, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., Eds.), pp. 180771809, McGraw-Hill, New York. 2. Myerowitz, R., and Costigan, F. C. (1988) J. Biol. Chem. 263, 18,587-18,589.
3. Arpaia.
E., Doubrille-Ross, A., Maler, T., Neote, Troxel, C., Stirling, J. L., Pitts, J. S., Bapat, A. M., Mahuran, D. J., Schuster, S. M., Clarke, J. A., and Gravel, R. A. (1988) Nature (London) Myerowitz, R. (1988) Proc. Natl. Acad. Sci. USA
4. 5. Maniatis,
T., Fritsch, E. F., and Sambrook, Cloning: A Laboratory Manual, Cold Spring Cold Spring Harbor, NY.
6. Bell, G. I., Karam, Sci. USA
J. H., and Rotter, 78,5759-5763.
K., Tropak, M., B., Lamhonwah, J. T. R., Lowden, 333,239-242. 85,3955-3959.
J. (1983) Molecular Harbor Laboratory,
W. J. (1981)
Proc. Natl.
Acad.
7. Prioa, R. L., and Soravia, E. (1987) J. Biol. Chem. 262, 56775681. 0. M., and Grill, L. K. (1983) Biochem. Bio8. Garger, S. J., Griffith, phys. Res. Commun. 117,835-842. 9. Mullis, K. B., and Faloona, F. A. (1987) in Methods in Enzymology (Wu, R., Ed.), Vol. 155, pp. 335-350, Academic Press, San Diego, CA.
