Biosensors and Bioelectronics 64 (2015) 505–510
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A dumbell probe-mediated rolling circle amplification strategy for highly sensitive transcription factor detection Chunxiang Li a, Xiyang Qiu a, Zhaohui Hou b,n, Keqin Deng a,n a Key Laboratory of Theoretical Organic Chemistry and Function Molecule, Ministry of Education, School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201, PR China b School of Chemistry and Chemical Engineering, Hunan Institute of Science and Technology, Yueyang 414006, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 9 August 2014 Received in revised form 21 September 2014 Accepted 23 September 2014 Available online 26 September 2014
Highly sensitive detection of transcription factors (TF) is essential to proteome and genomics research as well as clinical diagnosis. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, quantitative, and inexpensive detection of TF. The strategy consists of a hairpin DNA probe containing a TF binding sequence for target TF, a dumbbell-shaped probe, a primer DNA probe designed partly complementary to hairpin DNA probe, and a dumbbell probe. In the presence of target TF, the binding of the TF with hairpin DNA probe will prohibit the hybridization of the primer DNA probe with the “stem” and “loop” region of the hairpin DNA probe, then the unhybridized region of the primer DNA will hybridize with dumbbell probe, subsequently promote the ligation reaction and the rolling circle amplification (RCA), finally, the RCA products are quantified via the fluorescent intensity of SYBR Green I (SG). Using TATA-binding protein (TBP) as a model transcription factor, the proposed assay system can specifically detect TBP with a detection limit as low as 40.7 fM, and with a linear range from 100 fM to 1 nM. Moreover, this assay related DNA probe does not involve any modification and the whole assay proceeds in one tube, which makes the assay simple and low cost. It is expected to become a powerful tool for bioanalysis and clinic diagnostic application. & 2014 Published by Elsevier B.V.
Keywords: Transcription factor detection Rolling circle amplification TATA-binding protein
1. Introduction Transcription factors are proteins that bind to specific DNA sequences, thereby control the transcription of genetic information from DNA to messenger RNA (Latchman, 1997). Transcription factors are essential for the regulation of gene expression and confirmed to be the largest family of human proteins. There are approximately 2600 proteins in the human genome (approximately 10% of genes in the genome) that contain DNA-binding domains, and most of them are presumed to function as transcription factors (Babu et al., 2004). Transcription factors play critical roles in the regulation of a variety of essential cellular processes, such as cell development, differentiation, and growth (Lee and Young, 2000). Furthermore, the changes in expression level of some transcription factors has been confirmed to closely connect with multiple aspects of oncogenesis (Baldwin, 2001; Libermann and Zerbini, 2006; Wolf et al., 2005). Therefore, quantitative protein detection of n
Corresponding authors. E-mail addresses: [email protected] (Z. Hou), [email protected] (K. Deng). http://dx.doi.org/10.1016/j.bios.2014.09.068 0956-5663/& 2014 Published by Elsevier B.V.
transcription factors plays an important part in clinical diagnosis and biomedical research. Many powerful traditional techniques have been developed for transcription factors detection. They include DNase footprinting assay (Galas and Schmitz, 1978), electrophoretic mobility shift assay (EMSA) (Garner and Revzin, 1981), Western blots, and enzyme-linked immunosorbent assay (ELISA) (Burnette, 1981; Engvall and Perlmann, 1971). However, these methods such as DNase footprinting assay, EMSA, Western blots are usually time-consuming and laborious with the involvement of either radioisotopes or fluorescence labels and are not adaptable to assays requiring high throughput (Zhang et al., 2012). Furthermore, they cannot achieve quantitative analysis of protein expression. ELISA is a widely used quantitative detection method for protein and other analytes. While it needs expensive antibodies against each target protein, which elevates the analysis cost. Therefore, it is highly desirable to develop robust methods for simple, cost-effective, and sensitive detection of transcription factors. Recent years, a broad class of fluorescence-based approaches have emerged, including fluorescence polarization assays, “molecular beacon” based assays, protein–DNA FRET assays (Giannetti et al., 2006; Liu et al., 2012; Lundblad et al., 1996; Moellering et al., 2009). In comparison to conventional methods, fluorescence
506
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
detection is convenient and sensitive. It allows the homogeneous assay of DNA-binding proteins in solution. Nowadays, the rolling circle amplification (RCA) technique has gained considerable attention in nucleic acid and protein determination (Cheng et al., 2010; Ge et al., 2014; He et al., 2014; Ji et al., 2012; Konry et al., 2011; Zhuang et al., 2014). In a typical RCA, a circular template is isothermally amplified by Phi29 DNA polymerase. The DNA amplification proceeds in a linear model, resulting in a long repeated DNA sequences complementary to the circular template. Thus, the amplified fragment which contains thousands of tandem repeats serves as a signal amplifier for the ultrasensitive detection of specific targets. In this work, we developed a fluorescence-based strategy for the detection of transcription factor by integrating TF–DNA interaction (Zhang et al., 2012), ligation reaction, and dumbbell probemediated RCA (D-RCA) strategy (Wang et al., 2008; Zhou et al., 2010). Here, TATA-binding protein (TBP), a transcription factor that binds specifically to a DNA sequence called the TATA box, was used as a target model to demonstrate our strategy. The proposed TF detection system consisted of three components: a hairpin-like TF binding probe (TFBP) with a hanging single DNA sequence and a TF binding sequence integrated at the stem of the hairpin (it was used as target recognition element), an amplification primer, and a dumbbell-probe used for RCA. Introduction of TF protein hindered the hybridization of TFBP with the R-primer because of the formation of TF–TFBP complex, and then the 3-terminal of the R-primer would hybridize with the dumbbell-probe, resulting in the reaction of ligation-RCA. The detection system offers two major advantages over other reported schemes. First, the designed homogeneous assay scheme is simple and suitable for high throughput TF analysis. Second, dumbbell-probe mediated RCA strategy allows us to achieve large dynamic range and femtomolar sensitivity.
buffer (100 mM Tris acetate pH 7.5, 20 mM MgCl2, 375 mM potassium glutamate, 25% glycerol, and 0.5 mg/mL BSA). The TBP and TBP-probe binding reaction was allowed to proceed for 5–60 min at room temperature. Then 1 μL of 0.5 μM R-primer was added to the mixture and incubated at 30 °C for 5–50 min, resulting solution I. 2.3. Ligation reaction For ligation reaction, the prepared solution I was mixed with 20 μL of a reaction mixture containing 10–120 nM dumbell-probe, 0.5 mM ATP, 10 units of T4 DNA ligase, 3 μL of 10 Tango buffer, and water. The reaction mixture was incubated at 30 °C for 15 min to generate circularized dumbell probes, resulting solution II. 2.4. RCA reaction For RCA reaction, adding Phi29 DNA polymerase (5 U/μL, 4 μL), dNTPs (10 mM, 1 μL), 0.6 μL of 10 Tango buffer into solution II to obtain the RCA reaction solution (35.6 μL). The RCA reaction proceeded for 15–180 min to generate RCA products. The resulting mixture was incubated at 65 °C for 10 min to inactivate the polymerase. 2.5. Measurement of fluorescent spectra The RCA amplification product was mixed with 10 μl 10 SG dye (Invitrogen) and diluted to final volume of 200 μl with 10 mM PBS (pH 7.3). The fluorescent spectra were measured using a spectrofluorophotometer (F-4600, Hitachi, Japan). The excitation wavelength was 497 nm, and the spectra were recorded between 520 and 610 nm. The fluorescence emission intensity was measured at 530 nm.
2. Experimental
3. Results and discussion
2.1. Reagents and materials
3.1. Design of the TF sensor
The sequences of the sensing probe were designed by mfold web server (http//mfold.rna.albany.edu) and synthesized by Sango Biotechnology Co., Ltd. (Shanghai, China). They are listed in Table 1. The 5′ end of the dumbbell-probe is phosphorylated. TBP was purchased from ProteinOne Inc. (Maryland, USA). Phi29 DNA Polymerase, dNTPs, T4 DNA ligase, the universe buffer, and 10 tango buffer were provided by Thermo Fisher Scientific Inc. (Massachusetts, USA). SYBR Green I was obtained from Invitrogen Inc. (California, USA). All other reagents were of analytical reagents grade. All aqueous solutions were prepared with ultrapure water (Z18.3 M, Milli-Q, Millipore).
The strategy is shown in Scheme 1. First, TF binding probe (TFBP) which was designed as a hairpin structure with a hanging single DNA sequence and a TATA box integrated at the stem was dissolved in the buffer. Then the target protein TBP was added and bound to the stem region. The mixture was then incubated with R-primer. Only 5-terminal of R-primer hybridized with the hanging single DNA of the TFBP for the reason of TBP binding on hairpin stem. After incubation, dumbell-probe and ligase, phi29 DNA polymerase was added successively. Ligation and isothermally amplification was carried out in turn. Then RCA products were analyzed via fluorescence from SYBR Green I (SG). On the contrary, in the absence of the target TF, R-primer would form the complementary double-stranded DNA with TFBP, the hybridization of 3-terminal of R-primer with dumbell-probe was thus blocked, and the following ligation and RCA could not proceed, resulting in a low fluorescence signal.
2.2. Transcription factor–DNA binding TBP solution (2 μL) at a certain concentration was mixed with 1 μL of 0.5 μM TBP-probe, 5 μL of H2O, and 2 μL of 5 TBP binding Table 1 Oligonucleotides used in the experiments. Name
Sequence (5′ to 3′)
Dumbell-probe TBP-probe R-primer
p-GCTACACTTCATTCTactctcgtcacgCTTGGACTGAcgtgacgagagtCTTTAGCTTATCAG GTATAAAGAGCTACACTTCATCTTTATACAGTCATCACGCTCCGCTCTC GAGAGCGGAGCGTGATGACTGTATAAAGATGAAGTGTAGCCTGATAAGCT
The bold letters indicate the stem sequences of the TBP-probe (it is also the TBP binding site). The italic letters indicate the complementary bases between TBP-probe and R-primer. The underlined letters indicate the complementary bases between dumbell-probe and R-primer. The lowercase letters represent the stem sequences of the dumbell-probe.
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
507
Scheme 1. Schematic illustration of dumbell probe-mediated rolling circle amplification strategy for transcription factor detection. (a) Without TBP, RCA cannot proceed and (b) in the presence of TBP, ligation and RCA can proceed in turn resulting in a detectable fluorescence signal.
3.2. Optimization the concentration of TFBP and R-primer and dumbell-probe From the designed strategy, when there was no target TF, the TFBP would hybridize with R-primer and lose the chance to trigger the L-RCA, consequently no amplified signal arose. Therefore, in order to minimize the background fluorescence, the molar ratio of TFBP to R-primer was controlled at 1:1. In theory, on the one side, the higher concentration of dumbbell-probe will improve the ligation efficiency; on the other side, TF binding probe (TFBP) and dumbbell-probe both have duplex region, SG can intercalate into the region, and thus causing the raising background. Therefore, in order to improve the signal/background ratio of RCA, it is necessary to optimize the dumbbell-probe concentration. Given a defined concentration (50 nM) of TFBP and R-primer, the concentration of dumbbell-probe was optimized (Fig. 1). We observed that RCA signals increased along with the concentration increment of Dumbbell-probe from 1 to 100 nM. When the concentration of the dumbbell-probe was under 30 nM, fluorescent signals for low-concentration targets (100 fM–1 pM) were almost indistinguishable from the background, resulting poor sensitivity. Moreover, when the concentration of the dumbbellprobe was more than 60 nM (for example 120 nM), it was difficult to quantify TF concentrations for the significantly increased background. Taken those factors into account, a concentration of 60 nM of dumbbell-probe was chosen in this assay system. 3.3. Optimization the incubation time of TBP with TBP-probe The binding of TBP to TBP-probe is the first step of the designed system. In order to get the accurate assay results, sufficient incubation time should be given to make sure that the reaction completely finished. To achieve the desirable analytical characteristics (the largest signal and the minimum test time), the incubation time of TBP with TBP-probe was investigated. As shown in Fig. 2, the fluorescence intensity increased with the increased incubation time. When the incubation time was more than 30 min, the fluorescence intensity did not increase anymore; therefore the
Fig. 1. The concentration effect of the dumbbell probe on background/signal. The concentrations of dumbbell-probe varied from 10 nM to 120 nM. The incubation time of TBP with TBP-probe and TBP-probe with R-primer was 60 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation (n¼ 4).
incubation time of 30 min was selected for the following experiments. 3.4. Optimization the incubation time of TBP-probe with R-primer The complete hybridization between TBP-probe and R-primer is the prerequisite of the ligation in the next step. On the one hand, TBP: TBP-probe complexes should be completely hybridized with R-primer to make sure that the specific ligation reaction can be triggered. On the other hand, uncombined TBP-probe should be completely annealed to R-primer to prevent the nonspecific ligation. For these reasons, we optimized the incubation time of TBP-probe and R-primer. Fig. 3 shows that, in the presence of TBP and without TBP, the fluorescence intensity tends towards stability while the incubation time is more than 20 min. As a result, after introducing R-primer, the incubation time was chosen as 20 min.
508
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
Fig. 2. The incubation time effect of TBP with TBP-probe on fluorescence signals. The concentration of dumbbell-probe was 60 nM. The concentration of TBP was 10 pM. The incubation time of TBP-probe with R-primer was 60 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation calculated from four independent experiments.
Fig. 4. Time responses of fluorescence intensity of the sensing system with different concentrations of TBP. The concentration of dumbbell-probe was 60 nM. The incubation time of TBP with TBP-probe and TBP-probe with R-primer was 30 min and 20 min respectively. The ligation reactions were performed at 30 °C for 15 min. Error bars represent the standard deviation (n¼ 4).
3.6. Analytical performance of protein detection
Fig. 3. The incubation time effect of hybridization between TBP-probe and R-primer on fluorescence signals. The concentration of dumbbell-probe was 60 nM. The incubation time of TBP with TBP-probe was 30 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation calculated from four independent experiments.
To evaluate the performance of the present strategy to quantify target protein, a series of different concentrations of TBP were tested, and the fluorescence intensity at 530 nm was used to obtain the calibration curve. As shown in Fig. 5, the fluorescence intensity was linear with the concentration of TBP in the range from 100 fM to 1 nM. When further increasing the concentration of TBP, the fluorescence intensity data points were beyond the linear response range. The regression equation was F¼209.7lgC 228.3 with a correlation coefficient of 0.998, where F and C represent the fluorescence intensity and the concentration of target protein, respectively. The detection limit was estimated as 40.7 fM, which was calculated based on the triple standard deviation from the mean of blanks (meanþ 3 SD) and the regression equation. Table 2 compares the performances of the proposed method with those of some previous assay method for sensing TF. The results revealed that the sensitivity of the present assay was about 1–5 orders of magnitude higher than that of most previous assay
3.5. Optimization of RCA time According to the literature reports, the selected incubation time for RCA reaction varied from 5 min to 6 h (Cho et al., 2005; Jonstrup et al., 2006; Xiang et al., 2013; Zhou et al., 2010). To optimize the incubation time for the RCA polymerization step, we performed the RCA from 15 min to 180 min and set the target protein at four different concentrations. As shown in Fig. 4, a nearly linear relationship was observed between incubation time and signal. A lower concentration of target protein resulted that fluorescence signal reached its maximum value in a longer time. When the target protein at the lowest concentration (100 fM), it took 165 min for fluorescence signal to reach its maximum value, but the fluorescence signal increased only 6.9% from 90 min to 180 min. The increase of fluorescence signals were less than 4% when the concentration of target protein were above 1 pM from 90 min to 180 min. By weighing both the sensitivity and the total assay time, 90 min was selected for the RCA incubation time.
Fig. 5. Fluorescence spectra of sensing system with different concentrations of target protein. The concentration of TBP was 0, 10, 100, 150, 250, 400 fM and 1, 3.3 pM and 1, 10 nM respectively from bottom to top. The inset was the linear relationship between the fluorescence (at 530 nM) and the target concentration. Error bars represent the standard deviation (n¼ 4).
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
509
Table 2 Comparison of analytical performance of different methods for determination of transcription factors. Method/technique
Detection limit
Linear range
References
Dumbell probe-mediated rolling circle amplification strategy Gold nanoparticle-catalyzed silver enhancement Isothermal exponential amplification reaction (EXPAR)-based colorimetric assay Electrochemiluminescence biosensor Based on amplifying fluorescent conjugated polymer Sandwich assay Electrochemical, structure-switching biosensor Gold nanoparticle-based colorimetric biosensing strategy
100 fM 0.1 pM 3.8 pM 0.02 nM 0.1 nM 0.7 nM 4 nM 10 nM
100 fM–1 nM 1 pM–50.85 pM 5 pM–2 nM 0.2 nM–100 nM 0.1 nM–1 nM 0.7 nM–16.8 nM 4 nM–121 nM 10 nM–120 nM
This work Pan et al. (2008) Zhang et al. (2012) Wang et al. (2012) Liu et al. (2013) Fang et al. (2012) Bonham et al. (2012) Ou et al. (2010)
method (Bonham et al., 2012; Fang et al., 2012; Liu et al., 2013; Ou et al., 2010; Wang et al., 2012; Zhang et al., 2012). Furthermore, the linear dynamic range of the proposed strategy spanned 4 orders of magnitude, which was 10–1000 fold wider than the values obtained in those reported methods (Bonham et al., 2012; Fang et al., 2012; Liu et al., 2013; Ou et al., 2010; Pan et al., 2008; Wang et al., 2012; Zhang et al., 2012).
Table 3 Recovery of TBP assay at different concentrations. Sample
Added
Found
Recovery
RSD (%)
1 2 3
10 pM 275 pM 1 nM
9.61 pM 284.06 pM 1.07 nM
96.1 103.3 107
5.6 4.6 5.9
3.7. Detection specificity and reproducibility To investigate the selectivity of the proposed transcription factor detection system for TBP detection, we challenged the system with the TBP and several nontarget proteins such as BSA, IgG, NF-kB, HAS, Mb, Hb. The results obtained are shown in Fig. 6. As can be seen, compared with the value of more than 800 au upon 100 pM target protein, the fluorescence intensity corresponding to the nontarget proteins (10 nM) was very low even though their concentration was 100 folds than that of target protein. The measured data clearly demonstrated that the fluorescence signal was specifically triggered by the target protein binding. To test the reproducibility of the present method, TBP at several concentrations in the linear detection range (10 pM, 275 pM, 1 nM) was measured. The maximum value of the relative standard deviations was not more than 6.0% (n ¼3), indicating that the proposed detection system could offer a satisfactory reproducibility for transcription factor detection. To evaluate the reliability of the proposed method, the recovery experiments for several samples at various concentrations were carried out, where each sample was detected three times. The data given in Table 3 showed that the recovery was between 96.1% and 107% with an average relative standard derivation of 5.4%,
indicating that the proposed system could offer an acceptable recovery for TBP detection.
4. Conclusion In conclusion, we have introduced a ligation reaction and dumbbell probe-mediated RCA (D-RCA) strategy for the quantitative detection of transcription factors. This homogeneous assay system does not require any expensive chemical modified DNA probe, and offers an enhanced and specific signal by merging the amplification ability of D-RCA protocol with the specific recognition of hairpin probe to transcription factor. The proposed assay system not only displayed excellent analytical characteristics such as wide linear dynamic range, low detection limit, and high specificity, but also exhibited satisfying reproducibility and reliability. Additionally, it is a universal solution for transcription factor detection. By substituting the protein binding sequence in the hairpin detection probe, this method can be easily expanded for the measurement of other transcription factors. Moreover, benefited from its homogeneous assay system and one tube reaction protocol and lower cost, the proposed assay strategy is expected to become a powerful tool for high throughput bioanalysis and clinic diagnostic application.
Acknowledgements This work was financially supported by the National Natural Science Foundation of China (nos. 21471052, 51272075, and 51238002), Science and Technology Project of Hunan Provincial Science and Technology Department (2014FJ3048).
References
Fig. 6. Detection selectivity of the sensing system. The concentration of BSA, IgG, NF-kB, HAS, Mb, Hb was 10 nM for each, and the concentration of TBP was 100 pM. Error bars represent the standard deviation calculated from four independent experiments.
Babu, M.M., Luscombe, N.M., Aravind, L., Gerstein, M., Teichmann, S.A., 2004. Curr. Opin. Struct. Biol. 14 (3), 283–291. Baldwin, A.S., 2001. J. Clin. Invest. 107 (3), 241–246. Bonham, A.J., Hsieh, K., Ferguson, B.S., Vallée-Bélisle, A., Ricci, F., Soh, H.T., Plaxco, K. W., 2012. J. Am. Chem. Soc. 134 (7), 3346–3348. Burnette, W.N., 1981. Anal. Biochem. 112 (2), 195–203. Cheng, W., Yan, F., Ding, L., Ju, H., Yin, Y., 2010. Anal. Chem. 82 (8), 3337–3342. Cho, E.J., Yang, L.T., Levy, M., Ellington, A.D., 2005. J. Am. Chem. Soc. 127 (7), 2022–2023. Engvall, E., Perlmann, P., 1971. Immunochemistry 8 (9), 871–874.
510
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
Fang, Z., Zhang, W., Ge, C., Liu, J., Lie, P., Zeng, L., 2012. Analyst 137 (18), 4127–4130. Galas, D.J., Schmitz, A., 1978. Nucl. Acids. Res. 5 (9), 3157–3170. Garner, M.M., Revzin, A., 1981. Nucl. Acids. Res. 9 (13), 3047–3060. Ge, J., Zhang, L.-L., Liu, S.-J., Yu, R.-Q., Chu, X., 2014. Anal. Chem. 86 (3), 1808–1815. Giannetti, A., Citti, L., Domenici, C., Tedeschi, L., Baldini, F., Wabuyele, M.B., Vo-Dinh, T., 2006. Sens. Actuator B – Chem. 113 (2), 649–654. He, P., Liu, L., Qiao, W., Zhang, S., 2014. Chem. Commun. 50 (12), 1481–1484. Ji, H., Yan, F., Lei, J., Ju, H., 2012. Anal. Chem. 84 (16), 7166–7171. Jonstrup, S.P., Koch, J., Kjems, J., 2006. RNA 12 (9), 1747–1752. Konry, T., Smolina, I., Yarmush, J.M., Irimia, D., Yarmush, M.L., 2011. Small 7 (3), 395–400. Latchman, D.S., 1997. Int. J. Biochem. Cell Biol. 29 (12), 1305–1312. Lee, T.I., Young, R.A., 2000. Annu. Rev. Genet. 34 (1), 77–137. Libermann, T.A., Zerbini, L.F., 2006. Curr. Gene Ther. 6 (1), 17–33. Liu, J.-J., Song, X.-R., Wang, Y.-W., Chen, G.-N., Yang, H.-H., 2012. Nanoscale 4 (12), 3655–3659. Liu, X., Ouyang, L., Cai, X., Huang, Y., Feng, X., Fan, Q., Huang, W., 2013. Biosens. Bioelectron. 41 (15), 218–224. Lundblad, J.R., Laurance, M., Goodman, R.H., 1996. Mol. Endocrinol. 10 (6), 607–612.
Moellering, R.E., Cornejo, M., Davis, T.N., Bianco, C.D., Aster, J.C., Blacklow, S.C., Kung, A.L., Gilliland, D.G., Verdine, G.L., Bradner, J.E., 2009. Nature 462 (7270), 182–188. Ou, L.-J., Jin, P.-Y., Chu, X., Jiang, J.-H., Yu, R.-Q., 2010. Anal. Chem. 82 (14), 6015–6024. Pan, Q., Zhang, R., Bai, Y., He, N., Lu, Z., 2008. Anal. Biochem. 375 (2), 179–186. Wang, J., Zhao, W.-W., Li, X.-R., Xu, J.-J., Chen, H.-Y., 2012. Chem. Commun. 48 (51), 6429–6431. Wang, L., Luo, Y.-Z., Zhang, L., Jiao, X.-M., Wang, M.-B., Fan, Y.-L., 2008. Nucl. Acids Res. 36 (22) e149–e149. Wolf, D., Wolf, A.M., Rumpold, H., Fiegl, H., Zeimet, A.G., Muller-Holzner, E., Deibl, M., Gastl, G., Gunsilius, E., Marth, C., 2005. Clin. Cancer Res. 11 (23), 8326–8331. Xiang, Y., Deng, K., Xia, H., Yao, C., Chen, Q., Zhang, L., Liu, Z., Fu, W., 2013. Biosens. Bioelectron. 49 (0), 442–449. Zhang, Y., Hu, J., Zhang, C.-y., 2012. Anal. Chem. 84 (21), 9544–9549. Zhou, Y.T., Huang, Q., Gao, J.M., Lu, J.X., Shen, X.Z., Fan, C.H., 2010. Nucl. Acids Res. 38, 15. Zhuang, J., Lai, W., Chen, G., Tang, D., 2014. Chem. Commun. 50 (22), 2935–2938.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A dumbell probe-mediated rolling circle amplification strategy for highly sensitive transcription factor detection Chunxiang Li a, Xiyang Qiu a, Zhaohui Hou b,n, Keqin Deng a,n a Key Laboratory of Theoretical Organic Chemistry and Function Molecule, Ministry of Education, School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201, PR China b School of Chemistry and Chemical Engineering, Hunan Institute of Science and Technology, Yueyang 414006, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 9 August 2014 Received in revised form 21 September 2014 Accepted 23 September 2014 Available online 26 September 2014
Highly sensitive detection of transcription factors (TF) is essential to proteome and genomics research as well as clinical diagnosis. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, quantitative, and inexpensive detection of TF. The strategy consists of a hairpin DNA probe containing a TF binding sequence for target TF, a dumbbell-shaped probe, a primer DNA probe designed partly complementary to hairpin DNA probe, and a dumbbell probe. In the presence of target TF, the binding of the TF with hairpin DNA probe will prohibit the hybridization of the primer DNA probe with the “stem” and “loop” region of the hairpin DNA probe, then the unhybridized region of the primer DNA will hybridize with dumbbell probe, subsequently promote the ligation reaction and the rolling circle amplification (RCA), finally, the RCA products are quantified via the fluorescent intensity of SYBR Green I (SG). Using TATA-binding protein (TBP) as a model transcription factor, the proposed assay system can specifically detect TBP with a detection limit as low as 40.7 fM, and with a linear range from 100 fM to 1 nM. Moreover, this assay related DNA probe does not involve any modification and the whole assay proceeds in one tube, which makes the assay simple and low cost. It is expected to become a powerful tool for bioanalysis and clinic diagnostic application. & 2014 Published by Elsevier B.V.
Keywords: Transcription factor detection Rolling circle amplification TATA-binding protein
1. Introduction Transcription factors are proteins that bind to specific DNA sequences, thereby control the transcription of genetic information from DNA to messenger RNA (Latchman, 1997). Transcription factors are essential for the regulation of gene expression and confirmed to be the largest family of human proteins. There are approximately 2600 proteins in the human genome (approximately 10% of genes in the genome) that contain DNA-binding domains, and most of them are presumed to function as transcription factors (Babu et al., 2004). Transcription factors play critical roles in the regulation of a variety of essential cellular processes, such as cell development, differentiation, and growth (Lee and Young, 2000). Furthermore, the changes in expression level of some transcription factors has been confirmed to closely connect with multiple aspects of oncogenesis (Baldwin, 2001; Libermann and Zerbini, 2006; Wolf et al., 2005). Therefore, quantitative protein detection of n
Corresponding authors. E-mail addresses: [email protected] (Z. Hou), [email protected] (K. Deng). http://dx.doi.org/10.1016/j.bios.2014.09.068 0956-5663/& 2014 Published by Elsevier B.V.
transcription factors plays an important part in clinical diagnosis and biomedical research. Many powerful traditional techniques have been developed for transcription factors detection. They include DNase footprinting assay (Galas and Schmitz, 1978), electrophoretic mobility shift assay (EMSA) (Garner and Revzin, 1981), Western blots, and enzyme-linked immunosorbent assay (ELISA) (Burnette, 1981; Engvall and Perlmann, 1971). However, these methods such as DNase footprinting assay, EMSA, Western blots are usually time-consuming and laborious with the involvement of either radioisotopes or fluorescence labels and are not adaptable to assays requiring high throughput (Zhang et al., 2012). Furthermore, they cannot achieve quantitative analysis of protein expression. ELISA is a widely used quantitative detection method for protein and other analytes. While it needs expensive antibodies against each target protein, which elevates the analysis cost. Therefore, it is highly desirable to develop robust methods for simple, cost-effective, and sensitive detection of transcription factors. Recent years, a broad class of fluorescence-based approaches have emerged, including fluorescence polarization assays, “molecular beacon” based assays, protein–DNA FRET assays (Giannetti et al., 2006; Liu et al., 2012; Lundblad et al., 1996; Moellering et al., 2009). In comparison to conventional methods, fluorescence
506
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
detection is convenient and sensitive. It allows the homogeneous assay of DNA-binding proteins in solution. Nowadays, the rolling circle amplification (RCA) technique has gained considerable attention in nucleic acid and protein determination (Cheng et al., 2010; Ge et al., 2014; He et al., 2014; Ji et al., 2012; Konry et al., 2011; Zhuang et al., 2014). In a typical RCA, a circular template is isothermally amplified by Phi29 DNA polymerase. The DNA amplification proceeds in a linear model, resulting in a long repeated DNA sequences complementary to the circular template. Thus, the amplified fragment which contains thousands of tandem repeats serves as a signal amplifier for the ultrasensitive detection of specific targets. In this work, we developed a fluorescence-based strategy for the detection of transcription factor by integrating TF–DNA interaction (Zhang et al., 2012), ligation reaction, and dumbbell probemediated RCA (D-RCA) strategy (Wang et al., 2008; Zhou et al., 2010). Here, TATA-binding protein (TBP), a transcription factor that binds specifically to a DNA sequence called the TATA box, was used as a target model to demonstrate our strategy. The proposed TF detection system consisted of three components: a hairpin-like TF binding probe (TFBP) with a hanging single DNA sequence and a TF binding sequence integrated at the stem of the hairpin (it was used as target recognition element), an amplification primer, and a dumbbell-probe used for RCA. Introduction of TF protein hindered the hybridization of TFBP with the R-primer because of the formation of TF–TFBP complex, and then the 3-terminal of the R-primer would hybridize with the dumbbell-probe, resulting in the reaction of ligation-RCA. The detection system offers two major advantages over other reported schemes. First, the designed homogeneous assay scheme is simple and suitable for high throughput TF analysis. Second, dumbbell-probe mediated RCA strategy allows us to achieve large dynamic range and femtomolar sensitivity.
buffer (100 mM Tris acetate pH 7.5, 20 mM MgCl2, 375 mM potassium glutamate, 25% glycerol, and 0.5 mg/mL BSA). The TBP and TBP-probe binding reaction was allowed to proceed for 5–60 min at room temperature. Then 1 μL of 0.5 μM R-primer was added to the mixture and incubated at 30 °C for 5–50 min, resulting solution I. 2.3. Ligation reaction For ligation reaction, the prepared solution I was mixed with 20 μL of a reaction mixture containing 10–120 nM dumbell-probe, 0.5 mM ATP, 10 units of T4 DNA ligase, 3 μL of 10 Tango buffer, and water. The reaction mixture was incubated at 30 °C for 15 min to generate circularized dumbell probes, resulting solution II. 2.4. RCA reaction For RCA reaction, adding Phi29 DNA polymerase (5 U/μL, 4 μL), dNTPs (10 mM, 1 μL), 0.6 μL of 10 Tango buffer into solution II to obtain the RCA reaction solution (35.6 μL). The RCA reaction proceeded for 15–180 min to generate RCA products. The resulting mixture was incubated at 65 °C for 10 min to inactivate the polymerase. 2.5. Measurement of fluorescent spectra The RCA amplification product was mixed with 10 μl 10 SG dye (Invitrogen) and diluted to final volume of 200 μl with 10 mM PBS (pH 7.3). The fluorescent spectra were measured using a spectrofluorophotometer (F-4600, Hitachi, Japan). The excitation wavelength was 497 nm, and the spectra were recorded between 520 and 610 nm. The fluorescence emission intensity was measured at 530 nm.
2. Experimental
3. Results and discussion
2.1. Reagents and materials
3.1. Design of the TF sensor
The sequences of the sensing probe were designed by mfold web server (http//mfold.rna.albany.edu) and synthesized by Sango Biotechnology Co., Ltd. (Shanghai, China). They are listed in Table 1. The 5′ end of the dumbbell-probe is phosphorylated. TBP was purchased from ProteinOne Inc. (Maryland, USA). Phi29 DNA Polymerase, dNTPs, T4 DNA ligase, the universe buffer, and 10 tango buffer were provided by Thermo Fisher Scientific Inc. (Massachusetts, USA). SYBR Green I was obtained from Invitrogen Inc. (California, USA). All other reagents were of analytical reagents grade. All aqueous solutions were prepared with ultrapure water (Z18.3 M, Milli-Q, Millipore).
The strategy is shown in Scheme 1. First, TF binding probe (TFBP) which was designed as a hairpin structure with a hanging single DNA sequence and a TATA box integrated at the stem was dissolved in the buffer. Then the target protein TBP was added and bound to the stem region. The mixture was then incubated with R-primer. Only 5-terminal of R-primer hybridized with the hanging single DNA of the TFBP for the reason of TBP binding on hairpin stem. After incubation, dumbell-probe and ligase, phi29 DNA polymerase was added successively. Ligation and isothermally amplification was carried out in turn. Then RCA products were analyzed via fluorescence from SYBR Green I (SG). On the contrary, in the absence of the target TF, R-primer would form the complementary double-stranded DNA with TFBP, the hybridization of 3-terminal of R-primer with dumbell-probe was thus blocked, and the following ligation and RCA could not proceed, resulting in a low fluorescence signal.
2.2. Transcription factor–DNA binding TBP solution (2 μL) at a certain concentration was mixed with 1 μL of 0.5 μM TBP-probe, 5 μL of H2O, and 2 μL of 5 TBP binding Table 1 Oligonucleotides used in the experiments. Name
Sequence (5′ to 3′)
Dumbell-probe TBP-probe R-primer
p-GCTACACTTCATTCTactctcgtcacgCTTGGACTGAcgtgacgagagtCTTTAGCTTATCAG GTATAAAGAGCTACACTTCATCTTTATACAGTCATCACGCTCCGCTCTC GAGAGCGGAGCGTGATGACTGTATAAAGATGAAGTGTAGCCTGATAAGCT
The bold letters indicate the stem sequences of the TBP-probe (it is also the TBP binding site). The italic letters indicate the complementary bases between TBP-probe and R-primer. The underlined letters indicate the complementary bases between dumbell-probe and R-primer. The lowercase letters represent the stem sequences of the dumbell-probe.
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
507
Scheme 1. Schematic illustration of dumbell probe-mediated rolling circle amplification strategy for transcription factor detection. (a) Without TBP, RCA cannot proceed and (b) in the presence of TBP, ligation and RCA can proceed in turn resulting in a detectable fluorescence signal.
3.2. Optimization the concentration of TFBP and R-primer and dumbell-probe From the designed strategy, when there was no target TF, the TFBP would hybridize with R-primer and lose the chance to trigger the L-RCA, consequently no amplified signal arose. Therefore, in order to minimize the background fluorescence, the molar ratio of TFBP to R-primer was controlled at 1:1. In theory, on the one side, the higher concentration of dumbbell-probe will improve the ligation efficiency; on the other side, TF binding probe (TFBP) and dumbbell-probe both have duplex region, SG can intercalate into the region, and thus causing the raising background. Therefore, in order to improve the signal/background ratio of RCA, it is necessary to optimize the dumbbell-probe concentration. Given a defined concentration (50 nM) of TFBP and R-primer, the concentration of dumbbell-probe was optimized (Fig. 1). We observed that RCA signals increased along with the concentration increment of Dumbbell-probe from 1 to 100 nM. When the concentration of the dumbbell-probe was under 30 nM, fluorescent signals for low-concentration targets (100 fM–1 pM) were almost indistinguishable from the background, resulting poor sensitivity. Moreover, when the concentration of the dumbbellprobe was more than 60 nM (for example 120 nM), it was difficult to quantify TF concentrations for the significantly increased background. Taken those factors into account, a concentration of 60 nM of dumbbell-probe was chosen in this assay system. 3.3. Optimization the incubation time of TBP with TBP-probe The binding of TBP to TBP-probe is the first step of the designed system. In order to get the accurate assay results, sufficient incubation time should be given to make sure that the reaction completely finished. To achieve the desirable analytical characteristics (the largest signal and the minimum test time), the incubation time of TBP with TBP-probe was investigated. As shown in Fig. 2, the fluorescence intensity increased with the increased incubation time. When the incubation time was more than 30 min, the fluorescence intensity did not increase anymore; therefore the
Fig. 1. The concentration effect of the dumbbell probe on background/signal. The concentrations of dumbbell-probe varied from 10 nM to 120 nM. The incubation time of TBP with TBP-probe and TBP-probe with R-primer was 60 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation (n¼ 4).
incubation time of 30 min was selected for the following experiments. 3.4. Optimization the incubation time of TBP-probe with R-primer The complete hybridization between TBP-probe and R-primer is the prerequisite of the ligation in the next step. On the one hand, TBP: TBP-probe complexes should be completely hybridized with R-primer to make sure that the specific ligation reaction can be triggered. On the other hand, uncombined TBP-probe should be completely annealed to R-primer to prevent the nonspecific ligation. For these reasons, we optimized the incubation time of TBP-probe and R-primer. Fig. 3 shows that, in the presence of TBP and without TBP, the fluorescence intensity tends towards stability while the incubation time is more than 20 min. As a result, after introducing R-primer, the incubation time was chosen as 20 min.
508
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
Fig. 2. The incubation time effect of TBP with TBP-probe on fluorescence signals. The concentration of dumbbell-probe was 60 nM. The concentration of TBP was 10 pM. The incubation time of TBP-probe with R-primer was 60 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation calculated from four independent experiments.
Fig. 4. Time responses of fluorescence intensity of the sensing system with different concentrations of TBP. The concentration of dumbbell-probe was 60 nM. The incubation time of TBP with TBP-probe and TBP-probe with R-primer was 30 min and 20 min respectively. The ligation reactions were performed at 30 °C for 15 min. Error bars represent the standard deviation (n¼ 4).
3.6. Analytical performance of protein detection
Fig. 3. The incubation time effect of hybridization between TBP-probe and R-primer on fluorescence signals. The concentration of dumbbell-probe was 60 nM. The incubation time of TBP with TBP-probe was 30 min. The ligation reactions were performed at 30 °C for 15 min, and RCA at 30 °C for 2 h. Error bars represent the standard deviation calculated from four independent experiments.
To evaluate the performance of the present strategy to quantify target protein, a series of different concentrations of TBP were tested, and the fluorescence intensity at 530 nm was used to obtain the calibration curve. As shown in Fig. 5, the fluorescence intensity was linear with the concentration of TBP in the range from 100 fM to 1 nM. When further increasing the concentration of TBP, the fluorescence intensity data points were beyond the linear response range. The regression equation was F¼209.7lgC 228.3 with a correlation coefficient of 0.998, where F and C represent the fluorescence intensity and the concentration of target protein, respectively. The detection limit was estimated as 40.7 fM, which was calculated based on the triple standard deviation from the mean of blanks (meanþ 3 SD) and the regression equation. Table 2 compares the performances of the proposed method with those of some previous assay method for sensing TF. The results revealed that the sensitivity of the present assay was about 1–5 orders of magnitude higher than that of most previous assay
3.5. Optimization of RCA time According to the literature reports, the selected incubation time for RCA reaction varied from 5 min to 6 h (Cho et al., 2005; Jonstrup et al., 2006; Xiang et al., 2013; Zhou et al., 2010). To optimize the incubation time for the RCA polymerization step, we performed the RCA from 15 min to 180 min and set the target protein at four different concentrations. As shown in Fig. 4, a nearly linear relationship was observed between incubation time and signal. A lower concentration of target protein resulted that fluorescence signal reached its maximum value in a longer time. When the target protein at the lowest concentration (100 fM), it took 165 min for fluorescence signal to reach its maximum value, but the fluorescence signal increased only 6.9% from 90 min to 180 min. The increase of fluorescence signals were less than 4% when the concentration of target protein were above 1 pM from 90 min to 180 min. By weighing both the sensitivity and the total assay time, 90 min was selected for the RCA incubation time.
Fig. 5. Fluorescence spectra of sensing system with different concentrations of target protein. The concentration of TBP was 0, 10, 100, 150, 250, 400 fM and 1, 3.3 pM and 1, 10 nM respectively from bottom to top. The inset was the linear relationship between the fluorescence (at 530 nM) and the target concentration. Error bars represent the standard deviation (n¼ 4).
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
509
Table 2 Comparison of analytical performance of different methods for determination of transcription factors. Method/technique
Detection limit
Linear range
References
Dumbell probe-mediated rolling circle amplification strategy Gold nanoparticle-catalyzed silver enhancement Isothermal exponential amplification reaction (EXPAR)-based colorimetric assay Electrochemiluminescence biosensor Based on amplifying fluorescent conjugated polymer Sandwich assay Electrochemical, structure-switching biosensor Gold nanoparticle-based colorimetric biosensing strategy
100 fM 0.1 pM 3.8 pM 0.02 nM 0.1 nM 0.7 nM 4 nM 10 nM
100 fM–1 nM 1 pM–50.85 pM 5 pM–2 nM 0.2 nM–100 nM 0.1 nM–1 nM 0.7 nM–16.8 nM 4 nM–121 nM 10 nM–120 nM
This work Pan et al. (2008) Zhang et al. (2012) Wang et al. (2012) Liu et al. (2013) Fang et al. (2012) Bonham et al. (2012) Ou et al. (2010)
method (Bonham et al., 2012; Fang et al., 2012; Liu et al., 2013; Ou et al., 2010; Wang et al., 2012; Zhang et al., 2012). Furthermore, the linear dynamic range of the proposed strategy spanned 4 orders of magnitude, which was 10–1000 fold wider than the values obtained in those reported methods (Bonham et al., 2012; Fang et al., 2012; Liu et al., 2013; Ou et al., 2010; Pan et al., 2008; Wang et al., 2012; Zhang et al., 2012).
Table 3 Recovery of TBP assay at different concentrations. Sample
Added
Found
Recovery
RSD (%)
1 2 3
10 pM 275 pM 1 nM
9.61 pM 284.06 pM 1.07 nM
96.1 103.3 107
5.6 4.6 5.9
3.7. Detection specificity and reproducibility To investigate the selectivity of the proposed transcription factor detection system for TBP detection, we challenged the system with the TBP and several nontarget proteins such as BSA, IgG, NF-kB, HAS, Mb, Hb. The results obtained are shown in Fig. 6. As can be seen, compared with the value of more than 800 au upon 100 pM target protein, the fluorescence intensity corresponding to the nontarget proteins (10 nM) was very low even though their concentration was 100 folds than that of target protein. The measured data clearly demonstrated that the fluorescence signal was specifically triggered by the target protein binding. To test the reproducibility of the present method, TBP at several concentrations in the linear detection range (10 pM, 275 pM, 1 nM) was measured. The maximum value of the relative standard deviations was not more than 6.0% (n ¼3), indicating that the proposed detection system could offer a satisfactory reproducibility for transcription factor detection. To evaluate the reliability of the proposed method, the recovery experiments for several samples at various concentrations were carried out, where each sample was detected three times. The data given in Table 3 showed that the recovery was between 96.1% and 107% with an average relative standard derivation of 5.4%,
indicating that the proposed system could offer an acceptable recovery for TBP detection.
4. Conclusion In conclusion, we have introduced a ligation reaction and dumbbell probe-mediated RCA (D-RCA) strategy for the quantitative detection of transcription factors. This homogeneous assay system does not require any expensive chemical modified DNA probe, and offers an enhanced and specific signal by merging the amplification ability of D-RCA protocol with the specific recognition of hairpin probe to transcription factor. The proposed assay system not only displayed excellent analytical characteristics such as wide linear dynamic range, low detection limit, and high specificity, but also exhibited satisfying reproducibility and reliability. Additionally, it is a universal solution for transcription factor detection. By substituting the protein binding sequence in the hairpin detection probe, this method can be easily expanded for the measurement of other transcription factors. Moreover, benefited from its homogeneous assay system and one tube reaction protocol and lower cost, the proposed assay strategy is expected to become a powerful tool for high throughput bioanalysis and clinic diagnostic application.
Acknowledgements This work was financially supported by the National Natural Science Foundation of China (nos. 21471052, 51272075, and 51238002), Science and Technology Project of Hunan Provincial Science and Technology Department (2014FJ3048).
References
Fig. 6. Detection selectivity of the sensing system. The concentration of BSA, IgG, NF-kB, HAS, Mb, Hb was 10 nM for each, and the concentration of TBP was 100 pM. Error bars represent the standard deviation calculated from four independent experiments.
Babu, M.M., Luscombe, N.M., Aravind, L., Gerstein, M., Teichmann, S.A., 2004. Curr. Opin. Struct. Biol. 14 (3), 283–291. Baldwin, A.S., 2001. J. Clin. Invest. 107 (3), 241–246. Bonham, A.J., Hsieh, K., Ferguson, B.S., Vallée-Bélisle, A., Ricci, F., Soh, H.T., Plaxco, K. W., 2012. J. Am. Chem. Soc. 134 (7), 3346–3348. Burnette, W.N., 1981. Anal. Biochem. 112 (2), 195–203. Cheng, W., Yan, F., Ding, L., Ju, H., Yin, Y., 2010. Anal. Chem. 82 (8), 3337–3342. Cho, E.J., Yang, L.T., Levy, M., Ellington, A.D., 2005. J. Am. Chem. Soc. 127 (7), 2022–2023. Engvall, E., Perlmann, P., 1971. Immunochemistry 8 (9), 871–874.
510
C. Li et al. / Biosensors and Bioelectronics 64 (2015) 505–510
Fang, Z., Zhang, W., Ge, C., Liu, J., Lie, P., Zeng, L., 2012. Analyst 137 (18), 4127–4130. Galas, D.J., Schmitz, A., 1978. Nucl. Acids. Res. 5 (9), 3157–3170. Garner, M.M., Revzin, A., 1981. Nucl. Acids. Res. 9 (13), 3047–3060. Ge, J., Zhang, L.-L., Liu, S.-J., Yu, R.-Q., Chu, X., 2014. Anal. Chem. 86 (3), 1808–1815. Giannetti, A., Citti, L., Domenici, C., Tedeschi, L., Baldini, F., Wabuyele, M.B., Vo-Dinh, T., 2006. Sens. Actuator B – Chem. 113 (2), 649–654. He, P., Liu, L., Qiao, W., Zhang, S., 2014. Chem. Commun. 50 (12), 1481–1484. Ji, H., Yan, F., Lei, J., Ju, H., 2012. Anal. Chem. 84 (16), 7166–7171. Jonstrup, S.P., Koch, J., Kjems, J., 2006. RNA 12 (9), 1747–1752. Konry, T., Smolina, I., Yarmush, J.M., Irimia, D., Yarmush, M.L., 2011. Small 7 (3), 395–400. Latchman, D.S., 1997. Int. J. Biochem. Cell Biol. 29 (12), 1305–1312. Lee, T.I., Young, R.A., 2000. Annu. Rev. Genet. 34 (1), 77–137. Libermann, T.A., Zerbini, L.F., 2006. Curr. Gene Ther. 6 (1), 17–33. Liu, J.-J., Song, X.-R., Wang, Y.-W., Chen, G.-N., Yang, H.-H., 2012. Nanoscale 4 (12), 3655–3659. Liu, X., Ouyang, L., Cai, X., Huang, Y., Feng, X., Fan, Q., Huang, W., 2013. Biosens. Bioelectron. 41 (15), 218–224. Lundblad, J.R., Laurance, M., Goodman, R.H., 1996. Mol. Endocrinol. 10 (6), 607–612.
Moellering, R.E., Cornejo, M., Davis, T.N., Bianco, C.D., Aster, J.C., Blacklow, S.C., Kung, A.L., Gilliland, D.G., Verdine, G.L., Bradner, J.E., 2009. Nature 462 (7270), 182–188. Ou, L.-J., Jin, P.-Y., Chu, X., Jiang, J.-H., Yu, R.-Q., 2010. Anal. Chem. 82 (14), 6015–6024. Pan, Q., Zhang, R., Bai, Y., He, N., Lu, Z., 2008. Anal. Biochem. 375 (2), 179–186. Wang, J., Zhao, W.-W., Li, X.-R., Xu, J.-J., Chen, H.-Y., 2012. Chem. Commun. 48 (51), 6429–6431. Wang, L., Luo, Y.-Z., Zhang, L., Jiao, X.-M., Wang, M.-B., Fan, Y.-L., 2008. Nucl. Acids Res. 36 (22) e149–e149. Wolf, D., Wolf, A.M., Rumpold, H., Fiegl, H., Zeimet, A.G., Muller-Holzner, E., Deibl, M., Gastl, G., Gunsilius, E., Marth, C., 2005. Clin. Cancer Res. 11 (23), 8326–8331. Xiang, Y., Deng, K., Xia, H., Yao, C., Chen, Q., Zhang, L., Liu, Z., Fu, W., 2013. Biosens. Bioelectron. 49 (0), 442–449. Zhang, Y., Hu, J., Zhang, C.-y., 2012. Anal. Chem. 84 (21), 9544–9549. Zhou, Y.T., Huang, Q., Gao, J.M., Lu, J.X., Shen, X.Z., Fan, C.H., 2010. Nucl. Acids Res. 38, 15. Zhuang, J., Lai, W., Chen, G., Tang, D., 2014. Chem. Commun. 50 (22), 2935–2938.
