A comparison of high- and low-virulence Flavobacterium columnare strains reveals differences in iron acquisition components and responses to iron restriction.

doi:10.1111/jfd.12343

Journal of Fish Diseases 2015

A comparison of high- and low-virulence Flavobacterium columnare strains reveals differences in iron acquisition components and responses to iron restriction B H Beck1, C Li2, B D Farmer1, L M Barnett1, M D Lange1 and E Peatman2 1 U.S. Department of Agriculture, Agricultural Research Service, Harry K. Dupree Stuttgart National Aquaculture Research Center, Stuttgart, AR, USA 2 School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL, USA

Abstract

Flavobacterium columnare, the causative agent of columnaris disease causes substantial mortality worldwide in numerous freshwater finfish species. Due to its global significance, an improved understanding of the factors that contribute to virulence is urgently needed. In a laboratory challenge, we found that significantly greater mortality was observed in channel catfish Ictalurus punctatus (Rafinesque) challenged with isolate LSU-066-04 (LSU) as compared to fish challenged with isolate LV-359-01 (LV). Strikingly, mortality was 100% in LSU-challenged fish, with all fish dying within the first 24 h after challenge, while mortality in the LV-challenged group was significantly lower with 26.7% of fish dying on days 1–4 post-challenge. There were no differences in initial bacterial adhesion between the isolates at 1–2 h post-challenge; however, by 4 h LSU-challenged fish had a greater bacterial load on the gill. Next, to better understand this variation in virulence, we examined transcriptional and functional attributes related to iron acquisition. The isolates were differentially sensitive to iron restriction both in vitro and in vivo and the basal expression of TonB family member genes and a ferroxidase gene differed significantly. Our findings provide new insight into iron uptake and pathogen Correspondence B H Beck, USDA/ARS, Harry K. Dupree– Stuttgart National Aquaculture Research Center, Post Office Box 1050, Stuttgart, AR 72160 USA (e-mail: [email protected]) This article is not subject to United States copyright law. Ó 2015 John Wiley & Sons Ltd

1

virulence, and offer promising new targets for columnaris prevention and treatment. Keywords: columnaris disease, Flavobacterium columnare, iron uptake, virulence.

Introduction

While a myriad of pathogens can affect both wild and cultured fish, one of the most well-known and lethal diseases of freshwater fish is columnaris disease, caused by the ubiquitous Gram-negative bacterium Flavobacterium columnare. Although columnaris has been studied for nearly a century (Davis 1922), knowledge of the actors mediating virulence in F. columnare remains limited. A growing area of study in this regard is seeking to better understand the extent to which pathogenic Flavobacterium species acquire iron. Competition for iron between a vertebrate host and pathogenic bacterium is one of the central themes by which the outcome of an infection is determined (Massad et al. 1991). While iron is an absolute requirement by infectious microbes for growth, it is not freely available in vivo, but is commonly sequestered intracellularly or by carrier molecules such as lactoferrin and transferrin. Not surprisingly, infectious microbes have evolved a variety of systems to outcompete the iron-sequestering mechanisms employed by the host (Braun et al. 2001; Møller et al. 2005). Mediators of iron uptake have been linked to virulence in the aquaculture pathogen Flavobacterium psychrophilum, the causative agent of coldwater disease (Beddek

B H Beck et al. A comparison of virulence


et al. 2004; Møller et al. 2005; Wyckoff et al. 2006; Dumetz et al. 2008). Mutants defective in iron uptake components exhibited attenuated virulence and showed promise as vaccine candidates (Alvarez et al. 2008). Far less is known about the importance of iron acquisition in F. columnare and its role in virulence. Earlier studies using subtractive hybridization documented variation in transcripts related to iron transport between two F. columnare strains with different virulence levels in grass carp (Li et al. 2010). More recently, one study identified the presence of iron uptake machinery, determined that iron levels in media were found to be crucial for growth in vitro, and found that F. columnare can synthesize siderophores which chelate and facilitate iron uptake (Guan et al. 2013). In this study, we sought to gain further insight into iron acquisition and the influence of this process on virulence in F. columnare. Towards that end, we examined two isolates with greatly disparate levels of virulence in channel catfish fingerlings and found key functional and basal transcriptional differences related to iron uptake.

Materials and methods

Fish and experimental conditions Fingerling channel catfish were reared at the Harry K. Dupree Stuttgart National Aquaculture Research Center, in Stuttgart, Arkansas, USA. For the initial virulence assessment between isolates, 50 fish (weighing 5.24 0.48 g; to yield approximately 250 grams of biomass/tank) were stocked per 18-L tank containing 10 L of filtered well water. Water was provided through the ultra-lowflow water delivery system (Mitchell & Farmer 2010) at a rate of 29.6 0.14 mL min1. This disease challenge system has been demonstrated to allow for the natural progression of columnaris disease in a flow-through environment (Mitchell & Farmer 2010; Beck et al. 2012, 2014; Farmer, Beck & Straus 2012; Farmer et al. 2013). Temperature and dissolved oxygen were measured daily using an YSI Pro20 dissolved oxygen meter (Yellow Springs, Ohio). Each tank received aeration from submerged air stones. Water temperature averaged 26.0 0.07 °C and dissolved oxygen averaged 8.05 0.19 mg L1. Standard titration methods (Eaton et al. 2005) were used to measure total alkalinity (214 mg L1) and total Ó 2015 John Wiley & Sons Ltd

2

hardness (119 mg L1) of the well water. Total ammonia nitrogen (TAN) concentrations were determined in each tank with a Hach DR/4000V spectrophotometer using the Nessler Method 8038 (Hach Company). Ammonia was measured throughout the study and averaged 1.95 0.27 mg L1. Fish were not fed the first day after challenge, but offered pelleted catfish feed (35% protein, 2.5% fat; Delta Western, Indianola, Mississippi) on day 2 and throughout the rest of the study. Bacteriology Fish were experimentally challenged with two F. columnare isolates: LSU-066-04 (hereafter referred to as LSU) obtained from Dr. John Hawke (Louisiana State University School of Veterinary Medicine, Department of Pathobiological Sciences) and LV-359-01 (hereafter referred to as LV); both of which are assigned to genomovar II following the methods of Arias et al. 2004;. Isolates were retrieved from frozen glycerol stocks that were stored at 80 °C and streaked on Ordals’ medium (Anacker & Ordal 1959). After 48 h, isolates were dislodged from the agar using sterile cotton swabs and inoculated into 5 mL of F. columnare Growth Medium (FCGM; Farmer 2004). Suspensions were incubated at 28 °C for 24 h and then used to inoculate 1 L of FCGM for each isolate. The inoculated broth was incubated for 24 h at 28 °C in an orbital shaker incubator set at 200 rpm; when the bacterial growth reached an absorbance of 0.75 at 550 nm, the flasks were removed and placed on a stir plate at room temperature until the challenge. Challenge experiment to assess virulence To compare virulence between the two bacterial isolates, a total of eight tanks received a challenge dose of bacteria; four tanks (n = 200 fish) per isolate, comprised of 100 mL of each bacterial stock. The exposed dose of bacteria was calculated to be 3.4 9 108 CFU mL1 for the LSU isolate and 5.7 9 108 CFU mL1 for the LV isolate, which were not significantly different (P > 0.05). Three replicate tanks per challenge isolate (containing 50 fish each) were used to calculate survival (from a total of 150 fish per isolate), while the additional tank challenged with each isolate was used exclusively for time-course sampling to examine


bacterial attachment (i.e. fish in these tanks were not included in survival analyses). An additional tank containing 50 fish was not challenged and was used as a negative control. Fish were observed twice daily at which any dead fish were promptly removed. Quantitative PCR for Flavobacterium columnare quantification At 1, 2 and 4 h post-challenge, a section of the left second gill arch was collected (approximately 50 mg) from each fish (n = 3 fish per isolate group at each timepoint) for qPCR analysis to quantify F. columnare burden on the gill as previously described (Farmer, Mitchell & Straus 2011; Beck et al. 2012, 2014; Farmer et al. 2012). DNA extractions were performed according to the manufacturer’s instructions using a DNeasy Blood and Tissue Kit (Qiagen). The extracted template DNA was used for pathogen detection, identity confirmation and quantification utilizing the primers of Panangala, Shoemaker & Klesius (2007) which were FcFp[5-CCTGTACCTAATTGGGGAAAAGAG G-30 ], FcRp [5-CGGTTATGGCCTTGTTTATCATAGA-30 ] and FAM-labelled probe [50 -ACAACAATGATTTTGCAGGAGGAGTATCTGAT GGG-30 ]. This primer and fluorescent probe set targets a region of the chondroitin AC lyase gene of F. columnare. Primers and FAM-labelled probe were obtained from Applied Biosystems Incorporated. Quantitative polymerase chain reaction (qPCR) assays were performed on a Lightcycler 480 Real-Time PCR system (Roche Applied Science, Indianapolis, Indiana). All samples were run in duplicate. A standard (1.0 9 104 CFU mL1) and a control without extracted template (no-template control) were included on each plate; the standard was used as a positive control and to validate the internal standard curve within each run. Reactions included 500 nM of forward (FcFp) and reverse (FcRp) primers, a 250-nM labelled probe, 1 lL of template DNA, Bio-Rad 29 master mix (Bio-Rad Laboratories), and molecular grade water to give 20 lL total reaction volumes. The initial DNA denaturation step was 95 °C for 10 min, followed by 45 cycles of 95 °C for 10 s and then 60 °C for 30 s. These data were calculated using a Roche Lightcycler 480 software macro for absolute quantification. A standard curve was applied which had been previously generated and validated from bacterial samples grown Ó 2015 John Wiley & Sons Ltd

3


in broth then serially diluted and counted from 108–102. For normalization, the qPCR data were divided by the amount of template DNA put into each reaction, and results are reported as CFU ng1 of template DNA. In vitro growth under iron-limited conditions The growth of F. columnare was measured as previously described (Guan et al. 2013). Briefly, cultures were grown at 28 °C for 48 h with shaking at 200 rpm in standard FCGM or under ironrestricted conditions using FCGM containing 100 lM of the high-affinity iron chelator 2,2’-bipyridyl (Sigma-Aldrich). This concentration was previously determined to be the minimum inhibitory concentration for F. columnare (Guan et al. 2013). Growth was measured every 2 h by quantifying the absorbance at a wavelength of 600 nm with a BioTek Synergy H1 plate reader and Gen5 software. Measurements were obtained from ten replicate wells per treatment at each timepoint, and all experiments were repeated twice. The results reported are from one representative experiment. Virulence after growth in iron-limited conditions After characterizing the effects of iron restriction on in vitro growth kinetics, we examined the impact of iron limitation on the virulence of each isolate. Both LV and LSU were cultured in basal FCGM and in iron-limited conditions as described above. After the culture period, the isolates grown in basal FCGM required a dilution with sterile FCGM to equal the absorbance of the iron-depleted isolates because the growth of both LSU and LV was found to be slowed by iron restriction. Immediately following, channel catfish fingerlings were challenged as described above (in section entitled: Challenge experiment to assess virulence) with each bacterial stock (LV basal, LV iron restricted, LSU basal, LSU iron restricted) with the following modifications. Because LSU resulted in 100% mortality within 24 h in the initial virulence comparison, the challenge dose was reduced to assess whether iron restriction could alter the virulence of the LSU isolate. Immediately after challenge, an aliquot of each bacterial treatment was used for colony counts. Challenge doses were calculated to be 1.9 9 107 CFU mL1 for the



LSU basal iron level and 3.2 9 107 CFU mL1 for the LSU iron limited. Accordingly, as the LV isolate only produced 26.7% mortality in the initial virulence comparison, two parameters were altered in an effort to produce higher mortality rates to better reveal whether iron deprivation influences virulence of the LV isolate. The number of individual fish was increased to 60 per replicate tank, and the temperature was increased to 27.5 0.22 °C. The bacterial challenge dose of LV was determined to be 6.2 9 108 CFU mL1 for the iron-replete culture and 3.1 9 108 CFU mL1 for the iron-limited culture.

cycling profile consisted of an initial denaturation at 95 °C (for 30 s), followed by 40 cycles of denaturation at 94 °C (5 s), an appropriate annealing/extension temperature (58 °C, 5 s). An additional temperature ramping step was utilized to produce melting curves of the reaction from 65 °C to 95 °C. The housekeeping gene 16S was set as the reference gene; relative fold changes were calculated in the Relative Expression Software Tool version 2009 based on the cycle threshold (Ct) values generated by qRT-PCR. Statistics

Gene expression To examine the expression of select genes related to iron uptake at the time of a columnaris disease challenge, samples of each isolate (1 mL, in triplicate) were collected after being cultured identically as the challenge inocula as described above under the Bacteriology section. Using gene specific primers designed using Primer3 software (Table 1), QPCR was performed. Genes were selected based on previous reports that identified these genes/proteins as potentially important in iron acquisition by F. columnare (Guan et al. 2013; Dumpala et al. 2010). Total RNA was extracted using the RNeasy Plus Universal Mini Kit (Qiagen) following manufacturer’s instructions. First-strand cDNA was synthesized by iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories) according to manufacturer’s protocol. All the cDNA products were diluted to 250 ng lL1 and utilized for the quantitative real-time PCR using the SsoFastTM EvaGreenâ Supermix on a CFX96 real-time PCR Detection System (Bio-Rad). The thermal

All statistical tests were performed using SigmaPlot 11. Survival data were analysed using Kaplan–Meier Log Rank Survival Analysis and all pairwise multiple comparisons used the Holm–Sidak method with adjusted P values. Quantitative PCR data were log-transformed and resulted in normally distributed data with equal variances. An analysis of variance (ANOVA) was performed on the transformed qPCR data. Statistical differences between in vitro growth curves were determined using a one-way repeated measures ANOVA. Treatment effects were considered significant at P ≤ 0.05.

Results

Columnaris disease mortality and adhesion kinetics The experimental laboratory infection revealed that significantly greater mortality (P < 0.001) was observed in fingerling channel catfish challenged with the LSU isolate than fish challenged

Table 1 Primers used for quantitative polymerase chain reaction-based gene expression (50 to 30 ) and fold change of select genes Full name

Fold change

P-value

Primer(F)

Primer(R)

16s TonB-dependent outer membrane receptor TonB-dependent receptor precursor TonB-dependent receptor plug Ferroxidase

N/A 110.9 22.2

N/A 0.030*

GGCTTAAATGGGAAACGAC GCAACAGGTTACGGAGACAATA

ACTTCAGGTACCCCCAGC GGTTATTCCAGAAGTTCGCTCT

3.1 1.5

0.160

CAGTAGTGAAGGAACTGTAGCC

GCATCATAACGAGCAGAAGGT

140.3 20.8

0.040*

GCGGCTAATGCGTAATCT

GGCTACAGTTTCAGAGGTT

0.001*

CCCTCCTCGTTCGTTTACATAT

ATGGCTTGTTGGGCAGAAAT

11.9 3.5

Positive values indicate higher expression in the highly virulent LSU-066-04 isolate, while negative values indicate higher expression in the modestly virulent LV-359-01 isolate. An asterisk denotes statistical significance between the two isolates (P < 0.05). Ó 2015 John Wiley & Sons Ltd

4


Figure 1 Kaplan–Meier survival analysis of channel catfish challenged with Flavobacterium columnare isolate LSU-066-04 (LSU) or LV-359-01 (LV). Data represent accumulative mortality of challenged fish across three replicate tanks per isolate containing 150 fish total (50 per tank). The asterisk denotes a statistically significant difference in survival between the LSU and LV isolates (P < 0.001).

with LV (Fig. 1). Mortality was 100% in LSUchallenged fish with all fish dying by 24 h. In the LV-challenged group, mortality across all treatment tanks was substantially lower with only 26.7% of fish dying by 4 days post-challenge. There were no mortalities in the unchallenged control tank. There were no differences in initial adhesion to the gills between isolates at 1 h and 2 h post-challenge (Fig. 2). However, by 4 h post-challenge, fish exposed to the LSU isolate had a significantly greater bacterial load colonizing the gill (4.9 0.17 vs. 4.3 0.26 log10 CFU ng1; mean SEM). Growth comparison between isolates Growth curves were determined by culturing test isolates in either FCGM or under iron-restricted conditions in FCGM containing 2,2’-bipyridyl. In basal FCGM, generation time for LV was significantly shorter in comparison with the more virulent LSU isolate (P < 0.001). However, when cultured under iron-restricted conditions, the LV isolate was more severely impacted by diminished iron levels and growth was perturbed significantly as compared to the LSU isolate (Fig. 3; P < 0.001). When compared to growth in FCGM Ó 2015 John Wiley & Sons Ltd

5


Figure 2 Comparison of Flavobacterium columnare attachment to gill at 1, 2 and 4 h post-challenge. Quantitative PCR (specific for the chondroitin AC lyase gene) results showing mean ( SD) bacterial load (colony-forming units/nanogram of tissue; CFU ng1) on gill tissue after challenge with LSU-066-04 (LSU) or LV-359-01 (LV). These data were derived from the gill tissue obtained from three fish per isolate per timepoint. Asterisk denotes a significant difference at the 4-h sampling timepoint (P < 0.05).

alone, iron restriction reduced the final optical density achieved by 41.5% in LV vs. a reduction of 22.6% in the LSU isolate. Iron limitation alters virulence Iron limitation differentially altered virulence patterns for both isolates. The LV isolate was severely impacted by iron deprivation as mortality was 74.4% when fish were challenged with LV grown in basal FCGM, while LV cultured in ironrestricted media showed only 2.2% mortality over the course of the study (P < 0.001; Fig. 4a). Conversely, LSU was not affected by iron limitation as the iron-replete treatment produced 23.9% mortality, while LSU cultured in iron-restricted media resulted in 26.7% mortality (P > 0.05; Fig. 4b). No unchallenged control fish died. Gene expression differences Genes related to iron acquisition were selected because they represented two predominant mechanisms for iron transport which are siderophore-based (TonB family members) and siderophore-independent (ferroxidase) iron uptake pathways. In addition, the TonB system was recently identified in F. columnare (Guan et al. 2013). Differences between LSU and LV in the expression of the TonB outer membrane receptor,



genetic groupings/genomovars of F. columnare isolates (Arias et al. 2004; Olivares-Fuster et al. 2007; Shoemaker et al. 2008; LaFrentz et al. 2014; Shoemaker & LaFrentz 2014) and new insights into environmental and host-derived factors that mediate susceptibility (Beck et al. 2012; Peatman et al. 2013; Liu et al. 2013; Sun et al. 2012). Many questions remain as to how this pathogenic microbe elicits disease, particularly the bacteriological events preceding disease and death (recently reviewed by Declercq et al. 2013). The LV isolate used in this study has proven valuable in recent years as a model to gain insight into F. columnare pathogenesis and to explore new therapies for columnaris disease (Farmer 2004; Thomas-Jinu & Goodwin 2004; Farmer et al. 2011, 2013; Beck et al. 2012; Peatman et al. 2013). Recent studies found that the LSU isolate was highly virulent in white bass Morone chrysops, hybrid striped bass Morone chrysops x Morone saxatilis and channel catfish (Beck et al. 2014; Fuller, Farmer & Beck 2014). Building upon these previous reports, the present study is the first head-to-head comparison of these two isolates in a single host species. Our findings suggest that the obvious differences in overall mortality and rate of mortality caused by the two test strains cannot be explained by differences in initial adherence or in vitro growth rates. Several previous studies have examined adhesion of high- and low-virulence strains of F. columnare to the host (Decostere et al. 1999a; Shoemaker et al. 2008; Olivares-Fuster

Figure 3 Growth of Flavobacterium columnare isolates. LV and LSU isolates were cultured in F. columnare growth medium (FCGM), or FCGM supplemented with the high-affinity iron chelator 2’-2 dipyridyl (DP, 100 lM) at 28 °C with shaking. Measurements (optical density at a wavelength of 600 nm) were collected every two hours from 10 replicates per treatment.

TonB outer membrane receptor precursor, TonB outer membrane receptor plug domain and ferroxidase are reported (Table 1). Discussion

The limited knowledge of the suite of genes involved in F. columnare infection and colonization has hindered the development of efficacious vaccines and the identification of compounds to treat columnaris. Significant progress in this area has been made due to improved understanding of

(a)

(b)

Figure 4 The impact of iron deprivation on the virulence of Flavobacterium columnare isolates. LV and LSU isolates were cultured in F. columnare growth medium (FCGM; labelled as basal), or FCGM supplemented with the high-affinity iron chelator 2’-2 dipyridyl (labelled as iron limited) and used to challenge fingerling channel catfish. Data represent accumulative mortality across three replicate tanks per isolate containing 180 fish total (60 per tank). The asterisk denotes a statistically significant difference in survival between the basal iron and iron-limited culture stocks (P < 0.001). Ó 2015 John Wiley & Sons Ltd

6


et al. 2011). Adhesion is widely accepted as an essential prerequisite to infection; however, adhesion may not necessarily lead to successful colonization of the host. Firm bacterial adhesion is thought to allow F. columnare to withstand cleansing mechanisms operating on the surfaces of the gill, such as water flow, mucus secretion and the frequent cellular turnover of the respiratory epithelium (Decostere et al. 1999a,b). Additionally, in comparison with the aquatic environment, the gills may serve as a source of nutrients, offering growth advantages to the pathogen (Decostere et al. 1999a,b). More recently, Olivares-Fuster et al. (2011) found that two isolates of F. columnare adhered similarly at early timepoints, but the less-virulent isolate failed to persist on the gill at later timepoints (Olivares-Fuster et al. 2011). Likewise, in the present study, within the first 2 h, the two isolates did not differ in adhesion; however, the more virulent LSU isolate showed over a half log greater number of bacteria colonizing the gill by 4 h. Thus, in agreement with the findings of Olivares-Fuster et al. (2011), the early adherence of F. columnare is an essential first step for infection, but may not be a reliable correlate of virulence. Following initial adherence, persistence on the host requires successful invasion of host tissues, acquisition of key components for growth and circumvention of host immunity. Accordingly, virtually all forms of life require iron to carry out numerous cellular processes ranging from energy generation and DNA replication to transport of oxygen and protection against oxidative stress (Skaar 2010). Bacterial pathogens are not exempt from this iron requirement, as they must acquire iron within their vertebrate hosts to replicate and cause disease (Skaar 2010). Bacteria have evolved a number of means by which to maintain iron homoeostasis through mechanisms that scavenge iron from the host, store iron, control iron consumption, sense iron levels and to protect against iron-induced reactive species (Andrews, Robinson & Rodriguez-Qui~ nones 2003). The importance of iron metabolism is becoming increasingly recognized in the fish health community, particularly in the context of Flavobacterium psychrophilum pathogenesis. Culture of an attenuated strain of F. psychrophilum in iron-limited conditions has been shown to upregulate various outer membrane associated proteins and boost vaccine efficacy as compared Ó 2015 John Wiley & Sons Ltd

7


to culture in iron-replete conditions (Long et al. 2013; LaFrentz et al. 2009). In eels (Anguilla japonica), the injection of exogenous iron was shown to increase mortality after a columnaris challenge, while the injection of human transferrin improved survival time of challenged animals (Kuo, Chung & Kou 1981). A siderophore-independent system that has emerged as an important area of bacterial iron acquisition is mediated by enzymes termed ferroxidases (Møller et al. 2005). This group of enzymes is associated with various iron storage proteins, where they catalyse the oxidation of reduced iron Fe2+ (ferric form) to oxidized iron Fe3+ (ferrous form), an essential first step in the iron uptake process. We found that basal expression of a ferroxidase was nearly 12-fold higher in the hypervirulent LSU isolate. Ferroxidases play a significant role in iron acquisition in the human pathogen Pseudomonas aeruginosa, and its expression was detected in all virulent clinical respiratory isolates of Pseudomonas aeruginosa examined in a group of patients (Huston, Jennings & McEwan 2002; Huston et al. 2004). Likewise, Salmonella enterica serovar Typhimurium possesses a multi-copperion oxidase protein termed CueO, which has a high copper oxidase and ferroxidase activity and has been linked to systemic virulence in murine models (Achard et al. 2010). The higher basal expression of ferroxidase by LSU at the time of initial infection could yield a significant advantage in terms of a ‘head start’ to disease initiation over LV. Gram-negative bacteria have evolved another means to overcome the low bioavailability of Fe3+ through the use of a high-affinity transport system that involves the transduction of energy from the cytoplasmic membrane, resulting in the active transport of Fe3+ that is chelated to siderophores (Pawelek et al. 2006). This energy transduction process is mediated in part by TonBdependent outer membrane receptors which span the periplasm and contact outer membrane receptors that bind the iron-chelated siderophores (Pawelek et al. 2006). Acting together with the proton motive force of the cytoplasmic membrane, TonB transduces energy to enable siderophore transport (Pawelek et al. 2006). As compared to LSU, the seemingly low expression of the TonB outer membrane receptor by LV (~110-fold lower expression) could be associated with the markedly reduced virulence. The TonB



system has been shown to be essential for virulence in a diverse group of bacterial pathogens and was found to be expressed by a closely related aquaculture pathogen Flavobacterium psychrophilum, the causative agent of coldwater disease (Beddek et al. 2004; Wyckoff et al. 2006; Dumetz et al. 2008). Inhibition of TonB-dependent processes in E. coli with a targeted pentapeptide resulted in slower growth rates in iron-limited media (Tuckman and Osburne 1992). In Salmonella typhimurium, mutations in TonB also resulted in slower growth in iron-limited conditions and attenuated virulence in mouse models (Tsolis et al. 1996). Perhaps most relevant to the present study was the finding that, in comparison with its parental strain of F. psychrophilum, a mutant designated FP1033 was shown to be mutated in one of two exbD loci of the TonB complex, grew poorly in the presence of 2,2’-dipyridyl and showed attenuated virulence compared to the parental strain when cultured in conditions with adequate iron (Alvarez et al. 2006, 2008). Similarly, in the present study, the LV isolate showed a greater level of growth impairment and virulence when iron was restricted while the LSU isolate was less affected. Future studies should examine whether the LV isolate, after growth in iron-restricted conditions, could offer protection to channel catfish against subsequent challenges with columnaris, similar to that described previ ously in the context of cold water disease (Alvarez et al. 2008; Long et al. 2013). Perhaps of equal significance, was the stark difference in expression of the TonB plug between the two strains. The TonB receptor is tightly regulated by a plug (or referred to as a cork) domain, which occludes the lumen of the b-barrel, and prevents the passive diffusion of ferrichromes. In the LSU isolate, while we observed a higher expression of a TonB outer membrane receptor, the regulatory TonB receptor plug was strongly downregulated in the LSU isolate. While the consequences of the presumptive loss of the plug domain are not precisely known, the absence of a plug may afford the LSU isolate the ability to constitutively and passively acquire iron ad libitum, a characteristic that may enhance iron acquisition and hasten disease initiation. This notion is supported by studies showing that the targeted unfolding of the TonB plug with a high concentration of urea, induced channel opening and consequently resulted in a large ion-conducting Ó 2015 John Wiley & Sons Ltd

8

pathway in the bacterial outer membrane (Udho et al. 2009). The present study was not an exhaustive categorization of all possible iron uptake genes/pathways but instead focuses on, the expression of select candidate genes that were recently identified in F. columnare and relatively unexplored in terms of their roles in virulence. Future studies are needed to validate these differentially expressed genes at the level of protein. Proteomic approaches or various in vitro assays could be utilized to examine the activity of the various enzymes and receptors involved in iron uptake. Further, and perhaps most important, the ability to constitutively modulate gene expression, such as the silencing or overexpression of these factors will be crucial in the confirmation and extension of the current findings. More refinement in this area is desperately needed to fully establish the roles of these and other putative virulence genes in F. columnare. The recent sequencing of the F. columnare genome and advent of genetic manipulation systems for F. columnare will enhance such efforts (Staroscik et al. 2008; Li et al. 2012; Tekedar et al. 2012). Acknowledgements The USDA is an equal opportunity provider and employer. The authors thank Allison Sites for technical assistance and reviewing the manuscript. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the United States Department of Agriculture. References Achard M.E.S., Tree J.J., Holden J.A., Simpfendorfer K.R., Wijburg O.L.C., Strugnell R.A., Schembri M.A., Sweet M.J., Jennings M.P. & McEwan A.G. (2010) The multicopper-ion oxidase CueO of Salmonella enterica serovar Typhimurium is required for systemic virulence. Infection and Immunity 78, 2319. Alvarez B., Secades P., Prieto M., McBride M.J. & Guijarro J.A. (2006) A mutation in Flavobacterium psychrophilum tlpB inhibits gliding motility and induces biofilm formation. Applied and Environmental Microbiology 72, 4053. Alvarez B., Alvarez J., Menendez A. & Guijarro J.A. (2008) A mutant in one of two exbD loci of a TonB system in Flavobacterium psychrophilum shows attenuated virulence and


confers protection against cold water disease. Microbiology 154, 1151. Anacker R.L. & Ordal E.J. (1959) Studies on the myxobacterium Chondrococcus columnaris. Serological typing. Journal of Bacteriology 78, 32. Andrews S.C., Robinson A.K. & Rodriguez-Qui~ nones F. (2003) Bacterial iron homeostasis. FEMS Microbiology Reviews 27, 237. Arias C.R., Welker T.L., Shoemaker C.A., Abernathy J.W. & Klesius P.H. (2004) Genetic fingerprinting of Flavobacterium columnare isolates from cultured fish. Journal of Applied Microbiology 97, 428. Beck B.H., Farmer B.D., Straus D.L., Li C. & Peatman E. (2012) Putative roles for a rhamnose binding lectin in Flavobacterium columnare pathogenesis in channel catfish Ictalurus punctatus. Fish and Shellfish Immunology 33, 1008– 1015. Beck B.H., Barnett L.M., Farmer B.D., Peatman E. & Carter D. (2014) Kaolinitic clay protects against Flavobacterium columnare infection in channel catfish Ictalurus punctatus. Journal of Fish Diseases. doi: 10.1111/ jfd.12229, in press Beddek A.J., Sheehan B.J., Bosse J.T., Rycroft A.N., Kroll J.S. & Langford P.R. (2004) Two TonB systems in Actinobacillus pleuropneumoniae: their roles in iron acquisition and virulence. Infection and Immunity 72, 708. Braun V. (2001) Iron uptake mechanisms and their regulation in pathogenic bacteria. International Journal of Medical Microbiology 291, 79. Davis H.S. (1922) A new bacterial disease in freshwater fishes. U.S. Bureau of Fisheries Bulletin 38, 67.

Farmer B.D. (2004) Improved Methods for the Isolation and Characterization of Flavobacterium columnare. Master’s thesis. Louisiana State University, Baton Rouge, Louisiana. Farmer B.D., Mitchell A.J. & Straus D.L. (2011) The effect of high total ammonia concentration on the survival of channel catfish experimentally infected with Flavobacterium columnare. Journal of Aquatic Animal Health 23, 168. Farmer B.D., Beck B.H. & Straus D.L. (2012) Effectiveness of copper sulfate and potassium permanganate on channel catfish infected with Flavobacterium columnare. North American Journal of Aquaculture 74, 329. Farmer B.D., Beck B.H., Mitchell A.J. & Straus D.L. (2013) Pre-treating channel catfish with copper sulfate affects susceptibility to columnaris. North American Journal of Aquaculture 75, 211. Fuller S.A., Farmer B.D. & Beck B.H. (2014) White bass Morone chrysops is less susceptible than its hybrid to experimental infection with Flavobacterium columnare. Diseases of Aquatic Organisms 109, 22. Guan L., Santander J., Mellata M., Zhang Y. & Curtiss R. III (2013) Identification of an iron acquisition machinery in Flavobacterium columnare. Diseases of Aquatic Organisms 106, 138. Huston W.M., Jennings M.P. & McEwan A.G. (2002) The multicopper oxidase of Pseudomonas aeruginosa is a ferroxidase with a central role in iron acquisition. Molecular Microbiology 45, 1750. Huston W.M., Potter A.J., Jennings M.P., Rello J., Hauser A.R. & McEwan A.G. (2004) Survey of ferroxidase expression and siderophore production in clinical isolates of Pseudomonas aeruginosa. Journal of Clinical Microbiology 42, 2809.

Declercq A.M., Haesebrouck F., Van den Broeck W., Bossier P. & Decostere A. (2013) Columnaris disease in fish: a review with emphasis on bacterium-host interactions. Veterinary Research 44, 27.

Kuo S.C., Chung H.Y. & Kou G.H. (1981) Studies on artificial infection of the gliding bacteria in cultured fishes. Fish Pathology 15, 314.

Decostere A., Haesebrouck F., Van Driessche E., Charlier G. & Ducatelle R. (1999a) Characterization of the adhesion of Flavobacterium columnare (Flexibacter columnaris) to gill tissue. Journal of Fish Diseases 22, 474.

LaFrentz B.R., Waldbieser G.C., Welch T.J. & Shoemaker C.A. (2014) Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment. Journal of Fish Diseases 37, 669.

Decostere A., Haesebrouck F., Charlier G. & Ducatelle R. (1999b) The association of Flavobacterium columnare strains of high and low virulence with gill tissue of black mollies Poecilia sphenops. Veterinary Microbiology 67, 298.

LaFrentz B.R., LaPatra S.E., Call D.R., Wiens G.D. & Cain K.D. (2009) Proteomic analysis of Flavobacterium psychrophilum cultured in vivo and in iron-limited media. Diseases of Aquatic Organisms 87, 171.

Dumetz F., Duchaud E., Claverol S., Orieux N., Papillon S., Lapaillerie D. & Le Henaff M. (2008) Analysis of the Flavobacterium psychrophilum outer-membrane subproteome and identification of new antigenic targets for vaccine by immunomics. Microbiology 154, 1793–1801. Dumpala P.R., Gu¨lsoy N., Lawrence M.L. & Karsi A. (2010) Proteomic analysis of the fish pathogen Flavobacterium columnare. Proteome Science 26, 2–11. Eaton A.D., Clesceri L.S., Rice E.W., Greenberg A.E. & Franson M.A.H., Editors (2005) Standard Methods for the Examination of Water and Wastewater, 21st edn. APHA (American Public Health Association), AWWA (American Water Works Association), and WEF (Water Environment Federation),Washington, D.C. Ó 2015 John Wiley & Sons Ltd


9

Li N., Zhang L.Q., Zhang J., Liu Z.X., Huang B., Zhang S.H. & Nie P. (2012) Type I restriction-modification system and its resistance in electroporation efficiency in Flavobacterium columnare. Veterinary Microbiology 160, 68. Li N., Zhang J., Zhang L.Q. & Nie P. (2010) Difference in genes between a high virulence strain G4 and a low virulence strain G18 of Flavobacterium columnare by using suppression subtractive hybridization. Journal of Fish Diseases 33, 403. Liu L., Li C., Su B., Beck B.H. & Peatman E. (2013) Shortterm feed deprivation alters immune status of surface mucosa in channel catfish (Ictalurus punctatus). PloS one 8, e74581. Long A., Fehringer T.R., Swain M.A., LaFrentz B.R., Call D.R. & Cain K.D. (2013) Enhanced efficacy of an


attenuated Flavobacterium psychrophilum strain cultured under iron-limited conditions. Fish and Shellfish Immunology 35, 1482. Massad G., Arceneaux J.E. & Byers B.R. (1991) Acquisition of iron from host sources by mesophilic Aeromonas species. Journal of General Microbiology 137, 237. Mitchell A.J. & Farmer B.D. (2010) Evaluation of an ultra low-flow water delivery system for small experimental tanks. North American Journal of Aquaculture 72, 200. Møller J.D., Ellis A.E., Barnes A.C. & Dalsgaard I. (2005) Iron acquisition mechanisms of Flavobacterium psychrophilum. Journal of Fish Diseases 28, 398. Olivares-Fuster O., Baker J.L., Terhune J.S., Shoemaker C.A., Klesius P.H. & Arias C.R. (2007) Host-specific association between Flavobacterium columnare genomovars and fish species. Systematic and Applied Microbiology 30, 633. Olivares-Fuster O., Bullard S.A., McElwain A., Llosa M.J. & Arias C.R. (2011) Adhesion dynamics of Flavobacterium columnare to channel catfish Ictalurus punctatus and zebrafish Danio rerio after immersion challenge. Diseases of Aquatic Organisms 96, 227.

Ó 2015 John Wiley & Sons Ltd


Skaar E.P. (2010) The battle for iron between bacterial pathogens and their vertebrate hosts. PLoS Pathogens 6, e1000949. Staroscik A.M., Hunnicutt D.W., Archibald K.E. & Nelson D.R. (2008) Development of methods for the genetic manipulation of Flavobacterium columnare. BMC Microbiology 8, 115. Sun F., Peatman E., Li C., Liu S., Jiang Y., Zhou Z. & Liu Z. (2012) Transcriptomic signatures of attachment, NF-kappaB suppression and IFN stimulation in the catfish gill following columnaris bacterial infection. Developmental and Comparative Immunology 38, 180. Tekedar H.C., Karsi A., Gillaspy A.F., Dyer D.W., Benton N.R., Zaitshik J., Vamenta S., Banes M.M., G€ ulsoy N., Aboko-Cole M., Waldbieser G.C. & Lawrence M.L. (2012) Genome sequence of the fish pathogen Flavobacterium columnare ATCC 49512. Journal of Bacteriology 194, 2764. Thomas-Jinu S. & Goodwin A.E. (2004) Morphological and genetic characteristics of Flavobacterium columnare isolates: correlations with virulence in fish. Journal of Fish Diseases 27, 35.

Panangala V.S., Shoemaker C.A. & Klesius P.H. (2007) TaqMan real-time polymerase chain reaction assay for rapid detection of Flavobacterium columnare. Aquaculture Research 38, 517.

Tuckman M. & Osburne M.S. (1992) In vivo inhibition of TonB-dependent processes by a TonB box consensus pentapeptide. Journal of Bacteriology 174, 320.

Pawelek P.D., Croteau N., Ng-Thow-Hing C., Khursigara C.M., Moiseeva N., Allaire M. & Coulton J.W. (2006) Structure of TonB in complex with FhuA, E. coli outer membrane receptor. Science 312, 1402.

Tsolis R.M., Ba¨umler A.J., Heffron F. & Stojiljkovic I. (1996) Contribution of TonB-and Feo-mediated iron uptake to growth of Salmonella typhimurium in the mouse. Infection and Immunity 64, 4549.

Peatman E., Li C., Peterson B., Straus D., Farmer B. & Beck B. (2013) Basal polarization of the mucosal compartment in Flavobacterium columnare susceptible and resistant channel catfish Ictalurus punctatus. Molecular Immunology 56, 327.

Wyckoff E.E., Mey A.R., Leimbach A., Fisher C.F. & Payne S.M. (2006) Characterization of ferric and ferrous iron transport systems in Vibrio cholerae. Journal of Bacteriology 188, 6523.

Shoemaker C.A. & LaFrentz B.R. (2014) Lack of association between Flavobacterium columnare genomovar and virulence in hybrid tilapia Oreochromis niloticus (L.)9Oreochromis aureus (Steindachner). Journal of Fish Diseases, doi: 10.1111/ jfd.12262

Udho E., Jakes K.S., Buchanan S.K., James K.J., Jiang X., Klebba P.E. & Finkelstein A. (2009) Reconstitution of bacterial outer membrane TonB-dependent transporters in planar lipid bilayer membranes. Proceedings of the National Academy of Sciences 106, 21990.

Shoemaker C.A., Olivares-Fuster O., Arias C.R. & Klesius P.H. (2008) Flavobacterium columnare genomovar influences mortality in channel catfish (Ictalurus punctatus). Veterinary Microbiology 127, 359.

Received: 15 July 2014 Revision received: 23 November 2014 Accepted: 24 November 2014

10

Mycobacterial Esx-3 requires multiple components for iron acquisition.

Iron acquisition strategies in mycobacteria.

Acquisition of iron by Legionella pneumophila: role of iron reductase.

Activities of wogonin analogs and other flavones against Flavobacterium columnare.

Shigella Iron Acquisition Systems and their Regulation.

Analysis of high iron rice lines reveals new miRNAs that target iron transporters in roots.

Iron acquisition in Bacillus cereus: the roles of IlsA and bacillibactin in exogenous ferritin iron mobilization.

Iron deficiency and immune responses.

Cortisol directly impacts Flavobacterium columnare in vitro growth characteristics.

Complete Genome Sequence of the Fish Pathogen Flavobacterium columnare Pf1.

Iron acquisition systems of Listeria monocytogenes.

Iron Acquisition Strategies of Vibrio anguillarum.

Iron acquisition and regulation systems in Streptococcus species.

Iron acquisition and oxidative stress response in aspergillus fumigatus.

Sex differences in iron absorption.

Synthetic Lethality of the bfr and mbfA Genes Reveals a Functional Relationship between Iron Storage and Iron Export in Managing Stress Responses in Bradyrhizobium japonicum.

Hydroxamate production as a high affinity iron acquisition mechanism in Paracoccidioides spp.

Within-host evolution of Pseudomonas aeruginosa reveals adaptation toward iron acquisition from hemoglobin.

Comparative Genomics and Transcriptional Analysis of Flavobacterium columnare Strain ATCC 49512.

A comparison of performance of Deca Iron and Triple Deca Iron ultra-triathletes.

Iron-fortified parboiled rice - A novel solution to high iron density in rice-based diets.

Flavobacterium columnare: an important contributing factor to fish die-offs in southern lakes of Saskatchewan, Canada.

Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

Enrichment and isolation of Flavobacterium strains with tolerance to high concentrations of cesium ion.