CED
Clinical dermatology • Concise report
Clinical and Experimental Dermatology
A Chinese pedigree of lymphoedema–distichiasis syndrome with a novel mutation in the FOXC2 gene L.-l. Zhu,1,2 Y.-N. Lv,1 H.-D. Chen1 and X.-H. Gao1 1 Department of Dermatology, No.1 Hospital of China Medical University, China; and 2Department of Dermatology, The People’s Hospital of Liaoning Province, China
doi:10.1111/ced.12389
Summary
Lymphoedema–distichiasis syndrome (LDS) is a syndromic form of primary lymphoedema associated with double rows of eyelashes (distichiasis). Mutations in the FOXC2 gene were reported to be associated with this syndrome. In this study, we identified in a Chinese LDS pedigree a novel FOXC2 gene mutation, C.370C>T, leading to p.Leu124Phe. The novel mutation is not a common polymorphism, but is co-inherited with the disease.
Lymphoedema–distichiasis syndrome (LDS, MIM 153400), a syndromic form of primary lymphoedema, is inherited as an autosomal dominant disease, with variability in expression of several complications including lymphoedema, distichiasis, early varicose veins, ptosis, cleft palate and cardiac abnormalities.1,2 Primary lymphoedema is rare, affecting approximately 1.15 in 100 000 of the population younger than 20 years of age,3 irrespective of race or geographic area, and the female:male ratio is 3.5:1,4 LDS appears to account for about 16% of familial lymphoedema.5 LDS is associated with mutations in the highly conserved transcription factor gene FOXC2 (also known as MFH-1) on chromosome 16.1 We report a Chinese LDS pedigree (Fig. 1) with a novel mutation in the FOXC2 gene, confirming that alterations in this gene are involved in the pathogeneis of LDS, and we discuss the clinical relevance of FOXC2 mutations.
Correspondence: Dr Xing-Hua Gao, Department of Dermatology, No.1 Hospital of China Medical University, Shenyang, 110001, China E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. The first two authors contributed equally to this work, and should be considered joint first authors. Accepted for publication 16 February 2014
ª 2014 British Association of Dermatologists
Report The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki, and informed consent was obtained from all participants. The family was of Han ethnicity, from Liaoning province, in northeast China. The proband (II:5, male, 18 years old) reported progressive swelling of his legs, especially the right leg, for about 5 years. His mother (I:1, 53 years old) and a sister (II:2, 23 years old) had similar symptoms, which had at the age of 17 and 12 years, respectively. The proband’s mother had borne five children; the first child (II:1, male) died of congenital heart disease when 2 months old. The third and the fifth children (II:4, female, 21 years old; and II: 6, female, 17 years old) had no sign of lymphoedema. The family reported that they had not resided in filarial-endemic regions such as southern China. Physical examination of I:1, II:2 and II:5 revealed significant oedema of both lower legs and multiple layers of eyelashes in the meibomian glands (distichiasis). II:4 and III:1 had distichiasis but not lymphoedema, while II:6 showed neither lymphoedema nor distichiasis (Figs 1–3). Filaria examination from peripheral blood was negative. Histopathological findings from the proband were nonspecific but consistent with lymphoedema. Peripheral blood was obtained from I:1, II:2, II:4, II:5, II:6 and III:1 for mutation analysis. Blood specimens
Clinical and Experimental Dermatology (2014) 39, pp731–733
731
A lymphoedema–distichiasis pedigree L.-l Zhu et al.
from 100 unrelated healthy Chinese subjects were used as control samples. Genomic DNA was extracted from peripheral venous blood. Because the FOXC2 gene has > 60% GC content, all PCR assays were performed using the GC-rich PCR MasterMix kit (KT206; Tiangen, Beijing, China) following the manufacturer’s protocol, and using primers located in the 50 and 30 untranslated region of the gene (Table 1). Results were verified by sequencing both the sense and antisense strands.
Analysis was conducted using the Chromas Sequence Analysis software package. Sequencing of FOXC2 identified a missense mutation, C.370C>T, in five members of the family: I: 1, II: 2, II: 4, II: 5 and III: 1. This mutation causes an amino acid change, from leucine to phenylalanine (Fig. 3). Mutationtaster (http://www.mutationtaster. org/) predicted that the mutation is disease-causing, in that a change from leucine to phenylalanine might
Figure 1 Pedigree of our family with lymphoedema-distichiasis
syndrome (LDS). Closed symbols represent subjects with both lymphoedema and distichiasis; shadowed symbols represent subjects with dischiasis; and open symbols represent healthy subjects.
(a)
(b)
Figure 3 DNA sequencing analysis: proband is arrowed. The top
panel shows a representative missense mutation of C.370C>T in one allele, and the bottom panel shows the control sequence.
(c)
Figure 2 Lymphoedema of the legs in
(d)
732
(e)
Clinical and Experimental Dermatology (2014) 39, pp731–733
several family members: (a) I: 1, (b) II: 2 and (c) II: 5. This was especially marked in I: 1; the skin of her left lower leg had a thick and pitted appearance resembling the skin of an orange (peau d’orange), and there were ginger root-like confluent masses on her left lower leg. (d,e) Aberrant eyelashes arising from the meibomian glands (distichiasis, arrowhead) in II: 4.
ª 2014 British Association of Dermatologists
A lymphoedema–distichiasis pedigree L.-l Zhu et al.
Table 1 Primer sequences.6 Primer
Sequence (50 ?30 )
FOXC2F FOXC2R
TGGCTCTCTCGCGCTCTCTC CGTCTCTGCAGCCCCTTAATTG
(p.Leu124Phe). This novel gene mutation has not been documented in the National Center for Biotechnology Information single nucleotide polymorphism database, and was found in multiple family members.
Acknowledgement affect protein features and cause splice site changes. This gene mutation was not found in any of the 100 unrelated Chinese controls or in the unaffected member of the family, II:6. FOXC2, a gene located on chromosome 16q24.3, is the only gene known to be involved in LDS.1 In this family, II:1 died of congenital heart disease 2 months after birth, and there was no clinical record to document whether he had LDS or not. However, there is a possibility that the cardiac abnormality of which he died was a rare symptom of LDS. In the case of II:4, who carries the mutation, the only prominent feature was dischiasis. However, she did recall occasional slight pitting oedema on her legs, which usually disappeared in in 1 or 2 days. Her brother, III:1, a 5-yearold boy who showed apparent distichiasis without visible lymphoedema, was also found to carry this mutation. Lymphoedema is though to occur around the time of puberty in LDS, thus there is a possibility that this child will develop lymphoedema later in life.1 Consequently, detecting FOXC2 mutations in younger members of an LDS pedigree may lead to early disease recognition and initiate prompt treatment to prevent severe problems, such as irreversible fibrosclerotic tissue and impaired lymphatic drainage. Therapeutic options for the management of lymphoedema are limited to symptomatic control. We recommended elastic stockings to relieve swelling of the legs. The specific mutation in FOXC2 differs between families. The mutations are frequently small insertions or deletions that cause a frame shift in the gene, and missense mutations are rare.1,7–9 A search of the literature did not find any reports of similar pathogenic mutations in the paralogous FOX gene, but FOX mutations are known to cause some other heritable disorders including dominantly inherited glaucomas, as discussed by Fang et al.7 In conclusion, we found a novel missense mutation of C.370C>T in a family with LDS, which caused an amino acid change from leucine to phenylalanine
ª 2014 British Association of Dermatologists
This work was supported by the Programme for Changjiang Scholars and Innovative Teams in Universities, Ministry of Education, China (IRT0760). The sponsors had no role in the design and conduct of the study; in the collection, analysis or interpretation of data; or in the preparation, revision, or approval of the manuscript.
References 1 Brice G, Mansour S, Bell R et al. Analysis of the phenotypic abnormalities in lymphoedema-distichiasis syndrome in 74 patients with FOXC2 mutations or linkage to 16q24. J Med Genet 2002; 39: 478–83. 2 Connell F, Brice G, Jeffery S et al. A new classification system for primary lymphatic dysplasias based on phenotype. Clin Genet 2010; 77: 438–52. 3 Smeltzer DM, Stickler GB, Schirger A. Primary lymphedema in children and adolescents: a follow-up study and review. Pediatrics 1985; 76: 206–18. 4 Saito Y, Nakagami H, Kaneda Y, Morishita R. Lymphedema and therapeutic lymphangiogenesis. Biomed Res Int 2013; 2013: 804675. 5 Traboulsi EI, Al-Khayer K, Matsumoto M et al. Lymphedema-distichiasis syndrome and FOXC2 gene mutation. Am J Ophthalmol 2002; 134: 592–6. 6 van Steensel MA, Damstra RJ, Heitink MV et al. Novel missense mutations in the FOXC2 gene alter transcriptional activity. Hum Mutat 2009; 30: E1002–9. 7 Fang J, Dagenais SL, Erickson RP et al. Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome. Am J Hum Genet 2000; 67: 1382–8. 8 Berry FB, Tamimi Y, Carle M et al. The establishment of a predictive mutational model of the forkhead domain through the analyses of FOXC2 missense mutations identified in patients with hereditary lymphedema with distichiasis. Hum Mol Genet 2005; 14: 2619–27. 9 Sholto-Douglas-Vernon C, Bell R, Brice G et al. Lymphoedema-distichiasis and FOXC2: unreported mutations, de novo mutation estimate, families without coding mutations. Hum Genet 2005; 117: 238–42.
Clinical and Experimental Dermatology (2014) 39, pp731–733
733
Clinical dermatology • Concise report
Clinical and Experimental Dermatology
A Chinese pedigree of lymphoedema–distichiasis syndrome with a novel mutation in the FOXC2 gene L.-l. Zhu,1,2 Y.-N. Lv,1 H.-D. Chen1 and X.-H. Gao1 1 Department of Dermatology, No.1 Hospital of China Medical University, China; and 2Department of Dermatology, The People’s Hospital of Liaoning Province, China
doi:10.1111/ced.12389
Summary
Lymphoedema–distichiasis syndrome (LDS) is a syndromic form of primary lymphoedema associated with double rows of eyelashes (distichiasis). Mutations in the FOXC2 gene were reported to be associated with this syndrome. In this study, we identified in a Chinese LDS pedigree a novel FOXC2 gene mutation, C.370C>T, leading to p.Leu124Phe. The novel mutation is not a common polymorphism, but is co-inherited with the disease.
Lymphoedema–distichiasis syndrome (LDS, MIM 153400), a syndromic form of primary lymphoedema, is inherited as an autosomal dominant disease, with variability in expression of several complications including lymphoedema, distichiasis, early varicose veins, ptosis, cleft palate and cardiac abnormalities.1,2 Primary lymphoedema is rare, affecting approximately 1.15 in 100 000 of the population younger than 20 years of age,3 irrespective of race or geographic area, and the female:male ratio is 3.5:1,4 LDS appears to account for about 16% of familial lymphoedema.5 LDS is associated with mutations in the highly conserved transcription factor gene FOXC2 (also known as MFH-1) on chromosome 16.1 We report a Chinese LDS pedigree (Fig. 1) with a novel mutation in the FOXC2 gene, confirming that alterations in this gene are involved in the pathogeneis of LDS, and we discuss the clinical relevance of FOXC2 mutations.
Correspondence: Dr Xing-Hua Gao, Department of Dermatology, No.1 Hospital of China Medical University, Shenyang, 110001, China E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. The first two authors contributed equally to this work, and should be considered joint first authors. Accepted for publication 16 February 2014
ª 2014 British Association of Dermatologists
Report The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki, and informed consent was obtained from all participants. The family was of Han ethnicity, from Liaoning province, in northeast China. The proband (II:5, male, 18 years old) reported progressive swelling of his legs, especially the right leg, for about 5 years. His mother (I:1, 53 years old) and a sister (II:2, 23 years old) had similar symptoms, which had at the age of 17 and 12 years, respectively. The proband’s mother had borne five children; the first child (II:1, male) died of congenital heart disease when 2 months old. The third and the fifth children (II:4, female, 21 years old; and II: 6, female, 17 years old) had no sign of lymphoedema. The family reported that they had not resided in filarial-endemic regions such as southern China. Physical examination of I:1, II:2 and II:5 revealed significant oedema of both lower legs and multiple layers of eyelashes in the meibomian glands (distichiasis). II:4 and III:1 had distichiasis but not lymphoedema, while II:6 showed neither lymphoedema nor distichiasis (Figs 1–3). Filaria examination from peripheral blood was negative. Histopathological findings from the proband were nonspecific but consistent with lymphoedema. Peripheral blood was obtained from I:1, II:2, II:4, II:5, II:6 and III:1 for mutation analysis. Blood specimens
Clinical and Experimental Dermatology (2014) 39, pp731–733
731
A lymphoedema–distichiasis pedigree L.-l Zhu et al.
from 100 unrelated healthy Chinese subjects were used as control samples. Genomic DNA was extracted from peripheral venous blood. Because the FOXC2 gene has > 60% GC content, all PCR assays were performed using the GC-rich PCR MasterMix kit (KT206; Tiangen, Beijing, China) following the manufacturer’s protocol, and using primers located in the 50 and 30 untranslated region of the gene (Table 1). Results were verified by sequencing both the sense and antisense strands.
Analysis was conducted using the Chromas Sequence Analysis software package. Sequencing of FOXC2 identified a missense mutation, C.370C>T, in five members of the family: I: 1, II: 2, II: 4, II: 5 and III: 1. This mutation causes an amino acid change, from leucine to phenylalanine (Fig. 3). Mutationtaster (http://www.mutationtaster. org/) predicted that the mutation is disease-causing, in that a change from leucine to phenylalanine might
Figure 1 Pedigree of our family with lymphoedema-distichiasis
syndrome (LDS). Closed symbols represent subjects with both lymphoedema and distichiasis; shadowed symbols represent subjects with dischiasis; and open symbols represent healthy subjects.
(a)
(b)
Figure 3 DNA sequencing analysis: proband is arrowed. The top
panel shows a representative missense mutation of C.370C>T in one allele, and the bottom panel shows the control sequence.
(c)
Figure 2 Lymphoedema of the legs in
(d)
732
(e)
Clinical and Experimental Dermatology (2014) 39, pp731–733
several family members: (a) I: 1, (b) II: 2 and (c) II: 5. This was especially marked in I: 1; the skin of her left lower leg had a thick and pitted appearance resembling the skin of an orange (peau d’orange), and there were ginger root-like confluent masses on her left lower leg. (d,e) Aberrant eyelashes arising from the meibomian glands (distichiasis, arrowhead) in II: 4.
ª 2014 British Association of Dermatologists
A lymphoedema–distichiasis pedigree L.-l Zhu et al.
Table 1 Primer sequences.6 Primer
Sequence (50 ?30 )
FOXC2F FOXC2R
TGGCTCTCTCGCGCTCTCTC CGTCTCTGCAGCCCCTTAATTG
(p.Leu124Phe). This novel gene mutation has not been documented in the National Center for Biotechnology Information single nucleotide polymorphism database, and was found in multiple family members.
Acknowledgement affect protein features and cause splice site changes. This gene mutation was not found in any of the 100 unrelated Chinese controls or in the unaffected member of the family, II:6. FOXC2, a gene located on chromosome 16q24.3, is the only gene known to be involved in LDS.1 In this family, II:1 died of congenital heart disease 2 months after birth, and there was no clinical record to document whether he had LDS or not. However, there is a possibility that the cardiac abnormality of which he died was a rare symptom of LDS. In the case of II:4, who carries the mutation, the only prominent feature was dischiasis. However, she did recall occasional slight pitting oedema on her legs, which usually disappeared in in 1 or 2 days. Her brother, III:1, a 5-yearold boy who showed apparent distichiasis without visible lymphoedema, was also found to carry this mutation. Lymphoedema is though to occur around the time of puberty in LDS, thus there is a possibility that this child will develop lymphoedema later in life.1 Consequently, detecting FOXC2 mutations in younger members of an LDS pedigree may lead to early disease recognition and initiate prompt treatment to prevent severe problems, such as irreversible fibrosclerotic tissue and impaired lymphatic drainage. Therapeutic options for the management of lymphoedema are limited to symptomatic control. We recommended elastic stockings to relieve swelling of the legs. The specific mutation in FOXC2 differs between families. The mutations are frequently small insertions or deletions that cause a frame shift in the gene, and missense mutations are rare.1,7–9 A search of the literature did not find any reports of similar pathogenic mutations in the paralogous FOX gene, but FOX mutations are known to cause some other heritable disorders including dominantly inherited glaucomas, as discussed by Fang et al.7 In conclusion, we found a novel missense mutation of C.370C>T in a family with LDS, which caused an amino acid change from leucine to phenylalanine
ª 2014 British Association of Dermatologists
This work was supported by the Programme for Changjiang Scholars and Innovative Teams in Universities, Ministry of Education, China (IRT0760). The sponsors had no role in the design and conduct of the study; in the collection, analysis or interpretation of data; or in the preparation, revision, or approval of the manuscript.
References 1 Brice G, Mansour S, Bell R et al. Analysis of the phenotypic abnormalities in lymphoedema-distichiasis syndrome in 74 patients with FOXC2 mutations or linkage to 16q24. J Med Genet 2002; 39: 478–83. 2 Connell F, Brice G, Jeffery S et al. A new classification system for primary lymphatic dysplasias based on phenotype. Clin Genet 2010; 77: 438–52. 3 Smeltzer DM, Stickler GB, Schirger A. Primary lymphedema in children and adolescents: a follow-up study and review. Pediatrics 1985; 76: 206–18. 4 Saito Y, Nakagami H, Kaneda Y, Morishita R. Lymphedema and therapeutic lymphangiogenesis. Biomed Res Int 2013; 2013: 804675. 5 Traboulsi EI, Al-Khayer K, Matsumoto M et al. Lymphedema-distichiasis syndrome and FOXC2 gene mutation. Am J Ophthalmol 2002; 134: 592–6. 6 van Steensel MA, Damstra RJ, Heitink MV et al. Novel missense mutations in the FOXC2 gene alter transcriptional activity. Hum Mutat 2009; 30: E1002–9. 7 Fang J, Dagenais SL, Erickson RP et al. Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome. Am J Hum Genet 2000; 67: 1382–8. 8 Berry FB, Tamimi Y, Carle M et al. The establishment of a predictive mutational model of the forkhead domain through the analyses of FOXC2 missense mutations identified in patients with hereditary lymphedema with distichiasis. Hum Mol Genet 2005; 14: 2619–27. 9 Sholto-Douglas-Vernon C, Bell R, Brice G et al. Lymphoedema-distichiasis and FOXC2: unreported mutations, de novo mutation estimate, families without coding mutations. Hum Genet 2005; 117: 238–42.
Clinical and Experimental Dermatology (2014) 39, pp731–733
733
