brain research 1595 (2015) 120–126
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Review
A case of familial paroxysmal nonkinesigenic dyskinesia due to mutation of the PNKD gene in Chinese Mainland Shuli Liangn, Xiaoman Yu, Shaohui Zhang, Junli Tai Department of Neurosurgery, Capital Epilepsy Therapy Center, First Affiliated Hospital of Chinese People’s Liberation Army (PLA) General Hospital, Beijing, China
ar t ic l e in f o
abs tra ct
Article history:
Background: Paroxysmal dyskinesia is a rare neurological disorder characterized by parox-
Accepted 29 July 2014
ysmal movement disorders. Paroxysmal movement disorders include kinesigenic chor-
Available online 5 August 2014
eoathetosis, nonkinesigenic choreoathetosis or dyskinesia (PNKD), exercise-induced
Keywords:
choreoathetosis, and hypnogenic paroxysmal dystonia. There have been some sporadic
Paroxysmal non-kinesigenic
reports of PNKD occurrences in Chinese Mainland, but none has been reported on familial
dyskinesia
PNKD. Proband and methods A 32 years old male admitted to the First Affiliated Hospital of
PNKD
Chinese PLA General Hospital, Beijing, China in 2009 with recurrent limb involuntary
MR-1
movements spanning over 30 years was diagnosed with PNKD. Family history was
PNKD mutation
collected to identify if it was a case of familial or sporadic PNKD. Mutation and linkage analysis were performed to identify the pathogenic gene and the localization of the same. Results: There were five generations of 26 patients, out of which 3 of these patients died. Follow-up was conducted on 17 out of the 23 patients alive and 9 normal family members. The pedigree showed autosomal dominant inheritance, whom could be divided into light, moderate, and severe group according to clinical signs, spontaneous attack and response to drugs. All patients harbored c.20C4T (p.A7V) mutation in exon 1 of the PNKD/MR-1 gene. Preliminary linkage analyses using phenocopy rates of 0.0001 and 0.1 suggested that linkage signal localizes between D2S126 and D2S377. The functional consequence of the mutation in the disease pathogenesis is pending investigation. Conclusions We report the first case of familial paroxysmal non-kinesigenic dyskinesia (PNKD) in Chinese Mainland, which coincidentally is also the largest case of familial PNKD ever reported. This article is part of a Special Issue entitled Brain and Memory. & 2014 Elsevier B.V. All rights reserved.
n Correspondence to: Department of Neurosurgery, First Affiliated Hospital of PLA General Hospital. No. 51, Fucheng Road, Beijing 100048, China. E-mail address: [email protected] (S. Liang).
http://dx.doi.org/10.1016/j.brainres.2014.07.047 0006-8993/& 2014 Elsevier B.V. All rights reserved.
brain research 1595 (2015) 120–126
121
Contents 1. 2.
Introduction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 2.1. Pedigree and family history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 2.2. Mutation analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 2.3. Localization of pathogenesis gene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 3. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 4. Experimental procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124 4.1. Proband, history, and PNKD diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124 4.2. Mutation analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 4.3. Linkage analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 Conflicts of interest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125
1.
Introduction
Paroxysmal dyskinesia is a rare neurological disorder characterized by interictal abnormality. Clinically it includes paroxysmal movement disorders, episodic ataxia and tremor. Paroxysmal movement disorders could be paroxysmal kinesigenic choreoathetosis, paroxysmal non-kinesigenic choreoathetosis or dyskinesia (PNKD), paroxysmal exerciseinduced choreoathetosis, and hypnogenic paroxysmal dystonia (Mehta et al., 2009). Among these four types, paroxysmal kinesigenic choreoathetosis is more prevalent, whereas the other three are relatively rare (Lotze and Jankovic, 2003). PNKD, which was first reported by Mount and Reback in 1940, exhibits complete dominance and is inherited in an autosomal dominant fashion. Early research had located the pathogenic gene as a 2.7 cM fragment on chromosome 2q33– 2q35 between D2S295 and D2S163 (Fink et al., 1996; Jarman et al., 1997; Raskind et al., 1998), which predominantly encodes for ion channels; inclusive of AE3 (Hofele et al., 1997; Einum et al., 1998; Matsuo et al., 1999). However, in some pedigrees, pathogenic gene had been found to be PNKD gene on chromosome 2q35 (Ghezzi et al., 2009; Stefanova et al., 2006; Friedman et al., 2009; Bruno et al., 2007; Rainier et al., 2004; Lee et al., 2004), which was originally discovered in a cDNA library of human skeletal muscle. PKND is mostly expressed in skeletal muscle and heart, with some scarce expression reported in brain also (Lee et al., 2004; Li et al., 2004). PNKD gene has three confirmed spliced forms PNKD L includes exon 1–10 (385 amino acids), PNKD M includes exon 3–10 of PNKD L and one exon before exon 3
(361 amino acids), and PNKD S includes exon 1-2 of PNKD L and one special exon before its stop codon (142 amino acids) (Lee et al., 2004; Li et al., 2007; Ren et al., 2008). PNKD L is exclusively expressed in the brain (Ghezzi et al., 2009). However, a retrospective analysis on 14 pedigrees in Europe found no PNKD gene mutation among 6 pedigrees (Bruno et al., 2007), suggestive of the fact that other related genes could still be involved. Shimojima et al. (2012) reported that PNKD gene mutation only associates with 60% PNKD. In 2006, Spacey et al. (2006) reported a Canadian family who were European descendants with PNKD gene mutation; however, the descendants did not exhibit any PNKD gene mutations. Even though most PNKD are instances of familial disease, some sporadic occurrences have also been reported. Sporadic occurrences are mainly secondary diseases associated with multiple sclerosis, perinatal hypoxia, and apoplexy (Bhatia, 2011). There have been some sporadic reports of PNKD occurrences in Chinese Mainland, but none has been reported on familial PNKD. The current study reports on the first case of diagnosed familial PKND in Chinese Mainland and also summarizes the initial results of localizing the responsible genes.
2.
Results
2.1.
Pedigree and family history
There were five generations of 26 patients (13 of them were male) (Fig. 1), out of which 3 of these patients died and
Fig. 1 – The pedigree of all of 26 patients and their normal family members. The pedigree showed autosomal dominant inheritance.
122
brain research 1595 (2015) 120–126
Fig. 2 – This figure shows the pedigree of 3 died patients and 26 subjects who finished gene sequence, including 17 patients and 9 normal family members. The pedigree showed autosomal dominant inheritance.
follow-up was done with 17 out of the 23 patients and 9 normal family members. The pedigree, including 3 died patients and 26 follow-up subjects, showed autosomal dominant inheritance (Fig. 2). The youngest out of the 17 patients was 1.5 years old, and the oldest was 63 years old. The disease started in all before age 3 years and could be triggered by drinking alcohol or Chinese tea, fatigue, cold or sexual activities and all showed no movements induction. Eleven of 17 patients presented with moderate clinical signs; this cohort had multiple attacks each year which were less severe when there was no obvious trigger factors and lasted for a minimum of 10 min. If the stated trigger factors existed, the attack frequencies increased. All of them had medical treatments history: 8 patients were clonazepam sensitive. 3 patients suffered severe clinical signs, and their attacks could last for several hours and occurred multiple times each week. These attacks largely impacted normal life activity and work, and could be spontaneous. These patients were not clonazepam sensitive. The remaining 3 patients presented with mild clinical signs. Spontaneous attack was lacking in this later group; however, triggered attacks presented multiple times each year and lasted from several minutes to 2 h. Their normal life activities and works were less impacted by these attacks.
2.2.
Mutation analysis
Mutation analysis was performed in 26 family members, including 17 patients. All patients had c.20C4T (p.A7V) missense mutation in exon 1 of PNKD/MR-1 (Fig. 3). We did not detect either the p.A9V or p.A33P mutations in these patients.
2.3.
Localization of pathogenesis gene
The LOD value of gene linkage analysis for phenocopy rates 0.0001 and 0.1 are summarized in Tables 2 and 3, respectively. A LOD less than 2 showed lack of linkage, whereas a LOD 42 and 43 showed standardized and significant linkage, respectively. At a phenocopy rate of 0.0001, we observed a maximum LOD score of 1.75 on D2S126 and a maximum LOD score of 1.74 on D2S377. With a phenocopy rate of 0.1, we also observed a maximum LOD score of 1.58 on D2S126 and a maximum LOD score of 1.59 on D2S377. Therefore, the two results together suggested linkage signal possibly near these two markers, which would merit further investigation and confirmation.
3.
Discussion
This pedigree is the first PNKD family from Chinese Mainland, which is also the largest PNKD family among those reported across the globe. It included 5 generations and 26 patients (3 patients died, and follow-up for 17 patients), and this pedigree had the characteristics of autosomal dominant inheritance, as has been previously indicated in other studies (Shen et al., 2011). PNKD is usually triggered by alcohol, coffee, and tea; it can also be associated with fatigue, stress and excitements (Matsuo et al., 1999; Stefanova et al., 2006). Some patients in the present case did not show obvious trigger factors. The attack lasted from several minutes to several hours and some exceeded 1 day, which is slightly variant to the reported 5 min to 4 h (Bhatia, 2011). The attack symptoms were dystonia, athetosis, and multiple forms of chorea. It was a mix of unilateral or bilateral, local or systematic, in sync with
brain research 1595 (2015) 120–126
123
Fig. 3 – This figure show the outcome of mutation analysis, where c.20C4T mutation in PNKD/MR-1 gene exon 1. Table 1 – Oligonucleotide sequences used to amplify the 10 exons. Exons
Primer
Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon
CAACTGGAGGGAAACAAGCG TCCTGCTATCGTCGGGCTG TCCTCCCAAGCCCTTACTGC CCCTCCCCTACAAGCCACG CAGGCATCACGAAGGAGTCTA CTCTCTAGCAAGGCGAAACTG ACACTCCTGGCTCTTGCTGCT GTGTCCAGGTGACTTCACGAGG CCTGGAGATGCTGTGGTAAAGA ACCTGCTGATACCCCTGAAACA CTTTTGTATGGAAGCCCACTCTC TTCGGGGAAACTCACCACAG ATTGTGTTATCCTGGCACCTTG GAGCCAGCACTCCAGGAAGAA ACCACCAATCTCTCTCTGCTCT TCACTTGCTCTTGTGCATATCC GGGTCCAAAGGAGAGGTCAAT GTGGCTTCTCCAGTCCGTCT GGAGTTACGGGGTTTTAAGCAG TCAGGTCTGCACCCCAGAC
1-F 1-R 2-F -2-R 3-F 3-R 4-F 4-R 5-F 5-R 6-F 6-R 7-F 7-R 8-F 8-R 9-F -9-R 10-F 10-R
what has been reported previously (Mehta et al., 2009). Language function was always impacted, but consciousness was not affected in most of the times (Spacey et al., 2006). The age of disease had a median of 12 years old (3–30 years old), and the symptoms improved partially or completely with age (Bhatia, 2011). Sleeping could terminate the attack break-out (Mehta et al., 2009). Primary PNKD patients had normal EEG and CT/MRI (Mehta et al., 2009; Bhatia, 2011). Lance and colleagues reported 1 sample of brain biopsy in an accidental death patient, and they did not find any pathological changes (Lance, 1977). PNKD patients were not sensitive to traditional anti-epileptic drugs such as carbamazepine, and clonazepam was the most sensitive drug (Bruno et al., 2007). Some reported acetazolamide, haloperidol, gabapentin, valproic acid and levetiracetam and levodopa were possibly more efficacious (Mehta et al., 2009; Friedman et al., 2009; Hempelmann et al., 2006; Yeh et al., 2012; Pons et al., 2012). The differences between this pedigree and past pedigrees reported are (a) early onset (usually before 3 years old), (b) disease condition did not improve with age, and (c) over 20% of patients (6 out of 17) were not sensitive to clonazepam and
other anti-epileptic drugs. We failed to find the hereditary characters of this family pedigree by gene analyses, and low dosage in our patients may affect the judgment of sensitivity to clonazepam, because most of patients worried about side affect of clonazepam. This pedigree harbored the p.A7V mutation in PNKD gene exon 1, which is same as the mutation of the family from Chinese Taiwan region (Yeh et al., 2012). Many European descendants with PNKD pedigrees were proved to be caused by PNKD/MR-1 mutation at p.A7V and p.A9V (Ghezzi et al., 2009; Yeh et al., 2012). Ghezzi et al. (2009) reported an Italian pedigree in 2009, which had PNKD gene mutation at p.A33P. All three types of mutation reported localize to the N-terminal exons 1 and 2 found in PNKD L and PNKD S isoforms and are absent from PNKD M isoform (Ghezzi et al., 2009; Friedman et al., 2009; Hempelmann et al., 2006). This N-terminal portion codes for a 39 amino acid mitochondrial targeting sequence (MTS) that normally localizes the PNKD L and S into the mitochondria, but not the PNKD M, which is localized to the Golgi body, endoplasmic reticulum and plasma membrane (Ghezzi et al., 2009). There were 2 other Asian pedigrees reported: pathogenic gene of Japanese PNKD pedigree located at chromosome 2q33–2q35 (Matsuo et al., 1999), and the Oman family study (Hempelmann et al., 2006) also concluded that PNKD gene was the pathological gene. Shen et al. (2011) investigated the stability, cellular localization, and enzymatic activity of PNKD protein in cultured cells and transgenic animals . The wild-type long PNKD isoform (PNKD L) undergoes an amino terminal cleavage event, resistance to which is conferred by disease-associated mutations (Shen et al., 2011). Inhibition of this cleavage event also resulted in rapid degradation of the PNKD L protein, a result corroborated by their observation of decreased cortical PNKD L levels in mutant transgenic mice (Shen et al., 2011). Their results further suggested that PNKD is the homeostatic regulator of neuronal cell redox status. However, Ghezzi et al. (2009) reported no difference in protein maturation and mitochondrial localization between wild type and mutant PNKD variants, perhaps suggestive of a dominant negative effect of the mutated MTS in the pathogenesis of PNKD. Hence, it is imperative to investigate the effect of PNKD p.A7V, p.A9V, and pA33P mutations on PNKD L and S proteins and how PNKD M isoform fits into this whole puzzle. The biological characteristics of PNKD p.A7V mutation and distribution in nerve cells in PNKD pedigree in the current
124
brain research 1595 (2015) 120–126
Table 2 – LOD value of gene linkage analysis (phenocopy rate ¼0.0001). Marker
Theta
D2S126 D2S130 D2S143 D2S159 D2S339 D2S371 D2S434 D2S1242 D2S2359 D2S2310 D2S2250 D2S2148 D2S377 D2S295 D2S324 D2S364 D2S173 D2S164 D2S163
0
0.01
0.05
0.1
0.15
0.2
0.3
1.75 0.81 1.09 2.17 0.74 4.05 4.05 1.65 0.15 0.41 1.85 0.38 1.74 1.71 3.79 2.8 0.76 2.92 1.24
1.72 0.79 0.16 1.18 0.73 2.91 3.02 0.72 0.15 0.41 1.18 0.38 1.71 0.75 2.64 1.83 0.16 2.46 1.03
1.6 0.73 0.36 0.54 0.65 1.35 1.64 0.16 0.13 0.38 0.04 0.35 1.54 0.11 1.58 1.11 0.68 1.31 0.14
1.43 0.65 0.46 0.3 0.55 0.63 0.9 0.04 0.1 0.33 0.35 0.31 1.33 0.1 1.04 0.77 0.76 0.81 0.25
1.24 0.57 0.45 0.18 0.45 0.27 0.49 0.03 0.08 0.26 0.49 0.26 1.12 0.17 0.73 0.56 0.72 0.55 0.39
1.05 0.49 0.39 0.11 0.36 0.07 0.25 0.07 0.06 0.2 0.52 0.21 0.91 0.18 0.51 0.39 0.63 0.39 0.43
0.64 0.32 0.25 0.03 0.19 0.1 0.01 0.14 0.03 0.09 0.43 0.11 0.5 0.13 0.23 0.17 0.4 0.2 0.34
Table 3 – LOD value of gene linkage analysis (phenocopy rate ¼0.1). Marker
Theta
D2S126 D2S130 D2S143 D2S159 D2S339 D2S371 D2S434 D2S1242 D2S2359 D2S2310 D2S2250 D2S2148 D2S377 D2S295 D2S324 D2S364 D2S173 D2S164 D2S163
0
0.01
0.05
0.1
0.15
0.2
0.3
0.4
1.58 0.75 0.85 1.63 0.76 0.55 0.55 0.83 0.14 0.29 0.78 0.2 1.59 0.07 1.67 0.64 1.07 0.15 1.4
1.55 0.74 0.84 1.16 0.74 0.56 0.56 0.59 0.13 0.28 0.77 0.2 1.56 0.09 1.55 0.61 1.06 0.16 1.37
1.43 0.68 0.81 0.6 0.66 0.55 0.54 0.24 0.11 0.25 0.74 0.18 1.4 0.16 1.15 0.5 1.02 0.18 1.22
1.27 0.6 0.73 0.36 0.56 0.5 0.49 0.13 0.09 0.21 0.71 0.15 1.21 0.19 0.81 0.39 0.93 0.19 1.04
1.09 0.53 0.63 0.23 0.45 0.44 0.42 0.12 0.07 0.16 0.66 0.12 1.01 0.19 0.58 0.3 0.82 0.18 0.87
0.91 0.45 0.52 0.15 0.36 0.38 0.34 0.14 0.05 0.12 0.6 0.1 0.81 0.16 0.41 0.23 0.69 0.17 0.7
0.54 0.29 0.29 0.05 0.19 0.24 0.21 0.17 0.02 0.06 0.44 0.04 0.43 0.1 0.19 0.1 0.41 0.12 0.4
0.21 0.13 0.11 0.01 0.07 0.12 0.11 0.11 0 0.01 0.23 0.01 0.13 0.05 0.06 0.03 0.17 0.06 0.15
reported case are being currently pursued which will depict the functional relevance of the detected mutation and the role of the same in the pathogenesis of PNKD.
4.
Experimental procedures
4.1.
Proband, history, and PNKD diagnosis
The study was approved by the Ethics Committee of the First Affiliated Hospital of PLA General Hospital, Beijing, China and
signed informed consent was obtained for all living enrolled patients, including the Proband. A 32 years old male was admitted for recurrent limb involuntary movements lasting for more than 30 years. The patient showed limb involuntary movements without obvious intriguing factors recurrently since birth. When the attack started, the patient was conscious and the involuntary limb movements lasted from 2 min to 2 h. The attacks broke out multiple times every day. Sometimes the involuntary movements were unilateral (right or left), or bilateral with facial twitches. The patient was initially treated with carbamazepine and sodium phenytoin,
brain research 1595 (2015) 120–126
however neither drug provided satisfactory outcome. The patient was then prescribed sodium valproate but did now show satisfactory outcome. The patient did not receive any medication for three months prior to admission at our facility. No pre-attack aura was reported. These attacks broke out spontaneously, but become serious after drinking alcohol or Chinese tea. All of the attacks were during awake state. The patient's neurological physical examination at admission had shown normal consciousness, cranial nerve check returned normal, limb muscle force and muscle tension had been normal, physiological reflexes returned positive and pathological reflexes returned negative. Wechsler Adult Intelligence Scale full scale IQ scored 98, and detected no abnormality in psychological tests. Blood glucose, trace elements, and screening of urine staining were normal. Magnetic resonance imaging (MRI) showed no abnormality. Electroencephalogram (EEG) showed no abnormality both in interictal and ictal period. The family history was positive and based on the aforementioned the patient was diagnosed as PNKD. The patient was administered clonazepam 1 mg each time for 2 times per day. However, recurrence was still detected. The patient did not agree to a further increase in the dosage of clonazepam.
4.2.
Mutation analysis
Primers of ten exons and intron borders of PNKD/MR-1 gene sequence were designed with Primer Premier 5.0 and synthesized by Shanghai Biotechnological Company, Shanghai, China (Table 1). Two hundred ml peripheral venous bloods were drawn for DNA extraction. The bloods were split with SDS and digested with protease K. QIA amp Blood Kit DNA extraction kit (Qiagen, Beijing, China) was used to extract DNA according the operating instruction, and then, UV–vis spectrophotometer was used to test content of DNA. PCR reaction conditions were prepared according to ABI Company's standard protocols.
4.3.
Linkage analysis
Nineteen microsatellite loci between 2q31–2q35 were chosen according to past literatures. Primers were designed according to STR loci sequence information using Primer 5 software (primer sequences are available upon request). Post PCR amplification, 1 ml of PCR product was mixed with molecular marker/formamide (0.5:8.5) and denatured at 95 1C for 3 min prior to sequencing using the 3730 XL sequencer. Mendelian inconsistencies of the genotype data were investigated with Pedcheck and improper genotypes were set to missing before the linkage analysis. Two-point parametric linkage analyses were performed via the program Mendel version 11.01. We assumed an autosomal-dominant inheritance with complete penetrance and a phenocopy rate of 0.0001 for the parametric analysis and an affected allele frequency of 0.0001. At the same time, we also analyzed the gene linkage analysis with a phenocopy rate of 0.1, because we diagnosed the family depend on interview information rather than examination of objective signs. Every STR position was tested for different theta associated limit of detection (LOD) value.
125
Conflicts of interest None.
Acknowledgments The authors would like to show gratitude to the Proband and members of his family for their long-term cooperation. We also appreciate the contribution provided by Prof. X.H. Liu from Department of Pathophysiology, PLA Medical College. This research was funded by Chinese National Nature & Science Foundation (81271437), and Beijing Technology & Science New-star Training Project (2010B084).
r e f e r e nc e s
Bhatia, K.P., 2011. Paroxysmal dyskinesias. Mov. Disord. 26, 1157–1165. Bruno, M.K., Lee, H.Y., Auburger, G.W., Friedman, A., Nielsen, J.E., Lang, A.E., et al., 2007. Genotype-phenotype correlation of paroxysmal nonkinesigenic dyskinesia. Neurology 68, 1782–1789. Einum, D.D., Zhang, J, Arneson, P.J., Menon, A.G., Ptacek, L.J., 1998. Genomic structure of human anion exchanger 3 and its potential role in hereditary neurological disease. Neurogenetics 1, 289–292. Fink, J.K., Rainer, S., Wilkowski, J., Jones, S.M., Kume, A., Hedera, P., et al., 1996. Paroxysmal dystonic choreoathetosis:tight linkage to chromosome 2q. Am. J. Hum. Genet. 59, 140–145. Friedman, A., Zakrzewska-Pniewska, B., Domitrz, I., Lee, H.Y., Ptacek, L., Kwiecinski, H., 2009. Paroxysmal non-kinesigenic dyskinesia caused by the mutation of MR-1 in a large Polish kindred. Eur. Neuro l61, 39–41. Ghezzi, D., Viscomi, C., Ferlini, A., Gualandi, F., Mereghetti, P., DeGrandis, D., Zeviani, M., 2009. Paroxysmal non-kinesigenic dyskinesia is caused by mutations of the MR-1 mitochondrial targeting sequence. Hum. Mol. Genet. 18, 1058–1064. Hempelmann, A., Kumar, S., Muralitharan, S., Sander, T., 2006. Myofibrillogenesis regulator 1 gene (MR-1) mutation in an Omani family with paroxysmal nonkinesigenic dyskinesia. Neurosci. Lett. 402, 118–120. Hofele, K., Benecke, R., Auburger, G., 1997. Gene locus FPD1 of the dystonic Mount-Reback type of autosomal-dominant paroxysmal choreoathetosis. Neurology 49, 1252–1257. Jarman, P.R., Davis, M.B., Hodgson, S.V., Marsden, C.D., Wood, N. W., 1997. Paroxysmal dystonic choreoathetosis. Genetic linkage studies in a British family. Brain 120, 2125–2130. Lance, J.W., 1977. Familial paroxysmal dystonic choreoathetosis and its differentiation from related syndromes. Ann. Neurol. 2, 285–293. Lee, H.Y., Xu, Y., Huang, Y., Ahn, A.H., Auburger, G.W., Pandolfo, M., et al., 2004. The gene for paroxysmal non-kinesigenic dyskinesia encodes an enzyme in a stress response pathway. Hum. Mol. Genet. 13, 3161–3170. Li, H.L., She, Z.G., Li, T.B., Wang, A.B., Yang, Q., Wei, Y.S., et al., 2007. Overexpression of myofibrillogenesis regulator-1 aggravates cardiac hypertrophy induced by angiotensin II in mice. Hypertension 49, 1399–1408. Li, T.B., Liu, X.H., Feng, S., Hu, Y., Yang, W.X., Han, Y., et al., 2004. Characterization of MR-1, a novel myofibrillogenesis regulator
126
brain research 1595 (2015) 120–126
in human muscle. Acta Biochim. Biophys. Sin 36, 412–418. Lotze, T., Jankovic, J., 2003. Paroxysmal kinesigenic dyskinesia. Semin. Pediatr. Neurol. 10, 68–79. Matsuo, H., Kamakura, K., Satio, M., Yuzuriha, T., Urakami, K., Masaki, T., Higuchi, S., 1999. Familial paroxysmal dystonic choreoathetosis: Clinical findings in a larger Japanese family and genetic linkage to 2q. Arch. Neurol. 56, 721–726. Mehta, S.H., Morgan, J.C., Sethi, K.D., 2009. Paroxysmal dyskinesias. Curr. Treat. Options Neurol. 11, 170–178. Pons, R, Cuenca-Leo´n, E, Miravet, E, Pons, M, Xaidara, A, Youroukos, S, Macaya, A., 2012. Paroxysmal non-kinesigenic dyskinesia due to a PNKD recurrent mutation: report of two Southern European families. Eur. J. Paediatr. Neurol. 16, 86–89. Rainier, S., Thomas, D., Tokarz, D., Ming, L., Bui, M., Plein, E., et al., 2004. Myofibrillogenesis regulator 1 gene mutations cause paroxysmal dystonic choreoathetosis. Arch. Neurol. 61, 1025–1029. Raskind, W.H., Bolin, T., Wolff, J., Fink, J., Matsushita, M., Litt, M., et al., 1998. Further localization of a gene for paroxysmal dystonic choreoathetosis to a 5 cM region on chromosome 2q34. Hum. Genet. 102, 93–97. Ren, K., Jin, H., Bian, C., He, H., Liu, X., Zhang, S., et al., 2008. MR-1 modulates proliferation and migration of human hepatoma
HepG2 cells through myosin light chains-2 (MLC2)/focal adhesion kinase (FAK)/Akt signaling pathway. J. Biol. Chem. 283, 35598–35605. Shen, Y., Lee, H.Y., Rawson, J., Ojha, S., Babbitt, P., Fu, Y.H., Pta´cek, L.J., 2011. Mutations in PNKD causing paroxysmal dyskinesia alters protein cleavage and stability. Hum. Mol. Genet. 20, 2322–2332. Shimojima, K., Okumura, A., Natsume, J., Aiba, K., Kurahashi, H., Kubota, T., et al., 2012. Spinocerebellar ataxias type 27 derived from a disruption of the fibroblast growth factor 14 gene with mimicking phenotype of paroxysmal non-kinesigenic dyskinesia. Brain Dev. 34, 230–233. Spacey, S.D., Adams, P.J., Lam, P.C., Materek, L.A., Stoessl, A.J., Snutch, T.P., Hsiung, G.Y., 2006. Genetic heterogeneity in paroxysmal nonkinesigenic dyskinesia. Neurology 66, 1588–1590. Stefanova, E., Djarmati, A., Momcilovic´, D., Dragasevic´, N., Svetel, M., Klein, C., Kostic´, V.S., 2006. Clinical characteristics of paroxysmal nonkinesigenic dyskinesia in Serbian family with myofibrillogenesis regulator 1 gene mutation. Mov. Disord. 21, 2010–2015. Yeh, T.H., Lin, J.J., Lai, S.C., Wu-Chou, Y.H., Chen, A.C., Yueh, K.C., et al., 2012. Familial paroxysmal nonkinesigenic dyskinesia: clinical and genetic analysis of a Taiwanese family. J. Neurol. Sci. 323, 80–84.
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Review
A case of familial paroxysmal nonkinesigenic dyskinesia due to mutation of the PNKD gene in Chinese Mainland Shuli Liangn, Xiaoman Yu, Shaohui Zhang, Junli Tai Department of Neurosurgery, Capital Epilepsy Therapy Center, First Affiliated Hospital of Chinese People’s Liberation Army (PLA) General Hospital, Beijing, China
ar t ic l e in f o
abs tra ct
Article history:
Background: Paroxysmal dyskinesia is a rare neurological disorder characterized by parox-
Accepted 29 July 2014
ysmal movement disorders. Paroxysmal movement disorders include kinesigenic chor-
Available online 5 August 2014
eoathetosis, nonkinesigenic choreoathetosis or dyskinesia (PNKD), exercise-induced
Keywords:
choreoathetosis, and hypnogenic paroxysmal dystonia. There have been some sporadic
Paroxysmal non-kinesigenic
reports of PNKD occurrences in Chinese Mainland, but none has been reported on familial
dyskinesia
PNKD. Proband and methods A 32 years old male admitted to the First Affiliated Hospital of
PNKD
Chinese PLA General Hospital, Beijing, China in 2009 with recurrent limb involuntary
MR-1
movements spanning over 30 years was diagnosed with PNKD. Family history was
PNKD mutation
collected to identify if it was a case of familial or sporadic PNKD. Mutation and linkage analysis were performed to identify the pathogenic gene and the localization of the same. Results: There were five generations of 26 patients, out of which 3 of these patients died. Follow-up was conducted on 17 out of the 23 patients alive and 9 normal family members. The pedigree showed autosomal dominant inheritance, whom could be divided into light, moderate, and severe group according to clinical signs, spontaneous attack and response to drugs. All patients harbored c.20C4T (p.A7V) mutation in exon 1 of the PNKD/MR-1 gene. Preliminary linkage analyses using phenocopy rates of 0.0001 and 0.1 suggested that linkage signal localizes between D2S126 and D2S377. The functional consequence of the mutation in the disease pathogenesis is pending investigation. Conclusions We report the first case of familial paroxysmal non-kinesigenic dyskinesia (PNKD) in Chinese Mainland, which coincidentally is also the largest case of familial PNKD ever reported. This article is part of a Special Issue entitled Brain and Memory. & 2014 Elsevier B.V. All rights reserved.
n Correspondence to: Department of Neurosurgery, First Affiliated Hospital of PLA General Hospital. No. 51, Fucheng Road, Beijing 100048, China. E-mail address: [email protected] (S. Liang).
http://dx.doi.org/10.1016/j.brainres.2014.07.047 0006-8993/& 2014 Elsevier B.V. All rights reserved.
brain research 1595 (2015) 120–126
121
Contents 1. 2.
Introduction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 2.1. Pedigree and family history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 2.2. Mutation analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 2.3. Localization of pathogenesis gene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 3. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122 4. Experimental procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124 4.1. Proband, history, and PNKD diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124 4.2. Mutation analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 4.3. Linkage analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 Conflicts of interest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125
1.
Introduction
Paroxysmal dyskinesia is a rare neurological disorder characterized by interictal abnormality. Clinically it includes paroxysmal movement disorders, episodic ataxia and tremor. Paroxysmal movement disorders could be paroxysmal kinesigenic choreoathetosis, paroxysmal non-kinesigenic choreoathetosis or dyskinesia (PNKD), paroxysmal exerciseinduced choreoathetosis, and hypnogenic paroxysmal dystonia (Mehta et al., 2009). Among these four types, paroxysmal kinesigenic choreoathetosis is more prevalent, whereas the other three are relatively rare (Lotze and Jankovic, 2003). PNKD, which was first reported by Mount and Reback in 1940, exhibits complete dominance and is inherited in an autosomal dominant fashion. Early research had located the pathogenic gene as a 2.7 cM fragment on chromosome 2q33– 2q35 between D2S295 and D2S163 (Fink et al., 1996; Jarman et al., 1997; Raskind et al., 1998), which predominantly encodes for ion channels; inclusive of AE3 (Hofele et al., 1997; Einum et al., 1998; Matsuo et al., 1999). However, in some pedigrees, pathogenic gene had been found to be PNKD gene on chromosome 2q35 (Ghezzi et al., 2009; Stefanova et al., 2006; Friedman et al., 2009; Bruno et al., 2007; Rainier et al., 2004; Lee et al., 2004), which was originally discovered in a cDNA library of human skeletal muscle. PKND is mostly expressed in skeletal muscle and heart, with some scarce expression reported in brain also (Lee et al., 2004; Li et al., 2004). PNKD gene has three confirmed spliced forms PNKD L includes exon 1–10 (385 amino acids), PNKD M includes exon 3–10 of PNKD L and one exon before exon 3
(361 amino acids), and PNKD S includes exon 1-2 of PNKD L and one special exon before its stop codon (142 amino acids) (Lee et al., 2004; Li et al., 2007; Ren et al., 2008). PNKD L is exclusively expressed in the brain (Ghezzi et al., 2009). However, a retrospective analysis on 14 pedigrees in Europe found no PNKD gene mutation among 6 pedigrees (Bruno et al., 2007), suggestive of the fact that other related genes could still be involved. Shimojima et al. (2012) reported that PNKD gene mutation only associates with 60% PNKD. In 2006, Spacey et al. (2006) reported a Canadian family who were European descendants with PNKD gene mutation; however, the descendants did not exhibit any PNKD gene mutations. Even though most PNKD are instances of familial disease, some sporadic occurrences have also been reported. Sporadic occurrences are mainly secondary diseases associated with multiple sclerosis, perinatal hypoxia, and apoplexy (Bhatia, 2011). There have been some sporadic reports of PNKD occurrences in Chinese Mainland, but none has been reported on familial PNKD. The current study reports on the first case of diagnosed familial PKND in Chinese Mainland and also summarizes the initial results of localizing the responsible genes.
2.
Results
2.1.
Pedigree and family history
There were five generations of 26 patients (13 of them were male) (Fig. 1), out of which 3 of these patients died and
Fig. 1 – The pedigree of all of 26 patients and their normal family members. The pedigree showed autosomal dominant inheritance.
122
brain research 1595 (2015) 120–126
Fig. 2 – This figure shows the pedigree of 3 died patients and 26 subjects who finished gene sequence, including 17 patients and 9 normal family members. The pedigree showed autosomal dominant inheritance.
follow-up was done with 17 out of the 23 patients and 9 normal family members. The pedigree, including 3 died patients and 26 follow-up subjects, showed autosomal dominant inheritance (Fig. 2). The youngest out of the 17 patients was 1.5 years old, and the oldest was 63 years old. The disease started in all before age 3 years and could be triggered by drinking alcohol or Chinese tea, fatigue, cold or sexual activities and all showed no movements induction. Eleven of 17 patients presented with moderate clinical signs; this cohort had multiple attacks each year which were less severe when there was no obvious trigger factors and lasted for a minimum of 10 min. If the stated trigger factors existed, the attack frequencies increased. All of them had medical treatments history: 8 patients were clonazepam sensitive. 3 patients suffered severe clinical signs, and their attacks could last for several hours and occurred multiple times each week. These attacks largely impacted normal life activity and work, and could be spontaneous. These patients were not clonazepam sensitive. The remaining 3 patients presented with mild clinical signs. Spontaneous attack was lacking in this later group; however, triggered attacks presented multiple times each year and lasted from several minutes to 2 h. Their normal life activities and works were less impacted by these attacks.
2.2.
Mutation analysis
Mutation analysis was performed in 26 family members, including 17 patients. All patients had c.20C4T (p.A7V) missense mutation in exon 1 of PNKD/MR-1 (Fig. 3). We did not detect either the p.A9V or p.A33P mutations in these patients.
2.3.
Localization of pathogenesis gene
The LOD value of gene linkage analysis for phenocopy rates 0.0001 and 0.1 are summarized in Tables 2 and 3, respectively. A LOD less than 2 showed lack of linkage, whereas a LOD 42 and 43 showed standardized and significant linkage, respectively. At a phenocopy rate of 0.0001, we observed a maximum LOD score of 1.75 on D2S126 and a maximum LOD score of 1.74 on D2S377. With a phenocopy rate of 0.1, we also observed a maximum LOD score of 1.58 on D2S126 and a maximum LOD score of 1.59 on D2S377. Therefore, the two results together suggested linkage signal possibly near these two markers, which would merit further investigation and confirmation.
3.
Discussion
This pedigree is the first PNKD family from Chinese Mainland, which is also the largest PNKD family among those reported across the globe. It included 5 generations and 26 patients (3 patients died, and follow-up for 17 patients), and this pedigree had the characteristics of autosomal dominant inheritance, as has been previously indicated in other studies (Shen et al., 2011). PNKD is usually triggered by alcohol, coffee, and tea; it can also be associated with fatigue, stress and excitements (Matsuo et al., 1999; Stefanova et al., 2006). Some patients in the present case did not show obvious trigger factors. The attack lasted from several minutes to several hours and some exceeded 1 day, which is slightly variant to the reported 5 min to 4 h (Bhatia, 2011). The attack symptoms were dystonia, athetosis, and multiple forms of chorea. It was a mix of unilateral or bilateral, local or systematic, in sync with
brain research 1595 (2015) 120–126
123
Fig. 3 – This figure show the outcome of mutation analysis, where c.20C4T mutation in PNKD/MR-1 gene exon 1. Table 1 – Oligonucleotide sequences used to amplify the 10 exons. Exons
Primer
Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon
CAACTGGAGGGAAACAAGCG TCCTGCTATCGTCGGGCTG TCCTCCCAAGCCCTTACTGC CCCTCCCCTACAAGCCACG CAGGCATCACGAAGGAGTCTA CTCTCTAGCAAGGCGAAACTG ACACTCCTGGCTCTTGCTGCT GTGTCCAGGTGACTTCACGAGG CCTGGAGATGCTGTGGTAAAGA ACCTGCTGATACCCCTGAAACA CTTTTGTATGGAAGCCCACTCTC TTCGGGGAAACTCACCACAG ATTGTGTTATCCTGGCACCTTG GAGCCAGCACTCCAGGAAGAA ACCACCAATCTCTCTCTGCTCT TCACTTGCTCTTGTGCATATCC GGGTCCAAAGGAGAGGTCAAT GTGGCTTCTCCAGTCCGTCT GGAGTTACGGGGTTTTAAGCAG TCAGGTCTGCACCCCAGAC
1-F 1-R 2-F -2-R 3-F 3-R 4-F 4-R 5-F 5-R 6-F 6-R 7-F 7-R 8-F 8-R 9-F -9-R 10-F 10-R
what has been reported previously (Mehta et al., 2009). Language function was always impacted, but consciousness was not affected in most of the times (Spacey et al., 2006). The age of disease had a median of 12 years old (3–30 years old), and the symptoms improved partially or completely with age (Bhatia, 2011). Sleeping could terminate the attack break-out (Mehta et al., 2009). Primary PNKD patients had normal EEG and CT/MRI (Mehta et al., 2009; Bhatia, 2011). Lance and colleagues reported 1 sample of brain biopsy in an accidental death patient, and they did not find any pathological changes (Lance, 1977). PNKD patients were not sensitive to traditional anti-epileptic drugs such as carbamazepine, and clonazepam was the most sensitive drug (Bruno et al., 2007). Some reported acetazolamide, haloperidol, gabapentin, valproic acid and levetiracetam and levodopa were possibly more efficacious (Mehta et al., 2009; Friedman et al., 2009; Hempelmann et al., 2006; Yeh et al., 2012; Pons et al., 2012). The differences between this pedigree and past pedigrees reported are (a) early onset (usually before 3 years old), (b) disease condition did not improve with age, and (c) over 20% of patients (6 out of 17) were not sensitive to clonazepam and
other anti-epileptic drugs. We failed to find the hereditary characters of this family pedigree by gene analyses, and low dosage in our patients may affect the judgment of sensitivity to clonazepam, because most of patients worried about side affect of clonazepam. This pedigree harbored the p.A7V mutation in PNKD gene exon 1, which is same as the mutation of the family from Chinese Taiwan region (Yeh et al., 2012). Many European descendants with PNKD pedigrees were proved to be caused by PNKD/MR-1 mutation at p.A7V and p.A9V (Ghezzi et al., 2009; Yeh et al., 2012). Ghezzi et al. (2009) reported an Italian pedigree in 2009, which had PNKD gene mutation at p.A33P. All three types of mutation reported localize to the N-terminal exons 1 and 2 found in PNKD L and PNKD S isoforms and are absent from PNKD M isoform (Ghezzi et al., 2009; Friedman et al., 2009; Hempelmann et al., 2006). This N-terminal portion codes for a 39 amino acid mitochondrial targeting sequence (MTS) that normally localizes the PNKD L and S into the mitochondria, but not the PNKD M, which is localized to the Golgi body, endoplasmic reticulum and plasma membrane (Ghezzi et al., 2009). There were 2 other Asian pedigrees reported: pathogenic gene of Japanese PNKD pedigree located at chromosome 2q33–2q35 (Matsuo et al., 1999), and the Oman family study (Hempelmann et al., 2006) also concluded that PNKD gene was the pathological gene. Shen et al. (2011) investigated the stability, cellular localization, and enzymatic activity of PNKD protein in cultured cells and transgenic animals . The wild-type long PNKD isoform (PNKD L) undergoes an amino terminal cleavage event, resistance to which is conferred by disease-associated mutations (Shen et al., 2011). Inhibition of this cleavage event also resulted in rapid degradation of the PNKD L protein, a result corroborated by their observation of decreased cortical PNKD L levels in mutant transgenic mice (Shen et al., 2011). Their results further suggested that PNKD is the homeostatic regulator of neuronal cell redox status. However, Ghezzi et al. (2009) reported no difference in protein maturation and mitochondrial localization between wild type and mutant PNKD variants, perhaps suggestive of a dominant negative effect of the mutated MTS in the pathogenesis of PNKD. Hence, it is imperative to investigate the effect of PNKD p.A7V, p.A9V, and pA33P mutations on PNKD L and S proteins and how PNKD M isoform fits into this whole puzzle. The biological characteristics of PNKD p.A7V mutation and distribution in nerve cells in PNKD pedigree in the current
124
brain research 1595 (2015) 120–126
Table 2 – LOD value of gene linkage analysis (phenocopy rate ¼0.0001). Marker
Theta
D2S126 D2S130 D2S143 D2S159 D2S339 D2S371 D2S434 D2S1242 D2S2359 D2S2310 D2S2250 D2S2148 D2S377 D2S295 D2S324 D2S364 D2S173 D2S164 D2S163
0
0.01
0.05
0.1
0.15
0.2
0.3
1.75 0.81 1.09 2.17 0.74 4.05 4.05 1.65 0.15 0.41 1.85 0.38 1.74 1.71 3.79 2.8 0.76 2.92 1.24
1.72 0.79 0.16 1.18 0.73 2.91 3.02 0.72 0.15 0.41 1.18 0.38 1.71 0.75 2.64 1.83 0.16 2.46 1.03
1.6 0.73 0.36 0.54 0.65 1.35 1.64 0.16 0.13 0.38 0.04 0.35 1.54 0.11 1.58 1.11 0.68 1.31 0.14
1.43 0.65 0.46 0.3 0.55 0.63 0.9 0.04 0.1 0.33 0.35 0.31 1.33 0.1 1.04 0.77 0.76 0.81 0.25
1.24 0.57 0.45 0.18 0.45 0.27 0.49 0.03 0.08 0.26 0.49 0.26 1.12 0.17 0.73 0.56 0.72 0.55 0.39
1.05 0.49 0.39 0.11 0.36 0.07 0.25 0.07 0.06 0.2 0.52 0.21 0.91 0.18 0.51 0.39 0.63 0.39 0.43
0.64 0.32 0.25 0.03 0.19 0.1 0.01 0.14 0.03 0.09 0.43 0.11 0.5 0.13 0.23 0.17 0.4 0.2 0.34
Table 3 – LOD value of gene linkage analysis (phenocopy rate ¼0.1). Marker
Theta
D2S126 D2S130 D2S143 D2S159 D2S339 D2S371 D2S434 D2S1242 D2S2359 D2S2310 D2S2250 D2S2148 D2S377 D2S295 D2S324 D2S364 D2S173 D2S164 D2S163
0
0.01
0.05
0.1
0.15
0.2
0.3
0.4
1.58 0.75 0.85 1.63 0.76 0.55 0.55 0.83 0.14 0.29 0.78 0.2 1.59 0.07 1.67 0.64 1.07 0.15 1.4
1.55 0.74 0.84 1.16 0.74 0.56 0.56 0.59 0.13 0.28 0.77 0.2 1.56 0.09 1.55 0.61 1.06 0.16 1.37
1.43 0.68 0.81 0.6 0.66 0.55 0.54 0.24 0.11 0.25 0.74 0.18 1.4 0.16 1.15 0.5 1.02 0.18 1.22
1.27 0.6 0.73 0.36 0.56 0.5 0.49 0.13 0.09 0.21 0.71 0.15 1.21 0.19 0.81 0.39 0.93 0.19 1.04
1.09 0.53 0.63 0.23 0.45 0.44 0.42 0.12 0.07 0.16 0.66 0.12 1.01 0.19 0.58 0.3 0.82 0.18 0.87
0.91 0.45 0.52 0.15 0.36 0.38 0.34 0.14 0.05 0.12 0.6 0.1 0.81 0.16 0.41 0.23 0.69 0.17 0.7
0.54 0.29 0.29 0.05 0.19 0.24 0.21 0.17 0.02 0.06 0.44 0.04 0.43 0.1 0.19 0.1 0.41 0.12 0.4
0.21 0.13 0.11 0.01 0.07 0.12 0.11 0.11 0 0.01 0.23 0.01 0.13 0.05 0.06 0.03 0.17 0.06 0.15
reported case are being currently pursued which will depict the functional relevance of the detected mutation and the role of the same in the pathogenesis of PNKD.
4.
Experimental procedures
4.1.
Proband, history, and PNKD diagnosis
The study was approved by the Ethics Committee of the First Affiliated Hospital of PLA General Hospital, Beijing, China and
signed informed consent was obtained for all living enrolled patients, including the Proband. A 32 years old male was admitted for recurrent limb involuntary movements lasting for more than 30 years. The patient showed limb involuntary movements without obvious intriguing factors recurrently since birth. When the attack started, the patient was conscious and the involuntary limb movements lasted from 2 min to 2 h. The attacks broke out multiple times every day. Sometimes the involuntary movements were unilateral (right or left), or bilateral with facial twitches. The patient was initially treated with carbamazepine and sodium phenytoin,
brain research 1595 (2015) 120–126
however neither drug provided satisfactory outcome. The patient was then prescribed sodium valproate but did now show satisfactory outcome. The patient did not receive any medication for three months prior to admission at our facility. No pre-attack aura was reported. These attacks broke out spontaneously, but become serious after drinking alcohol or Chinese tea. All of the attacks were during awake state. The patient's neurological physical examination at admission had shown normal consciousness, cranial nerve check returned normal, limb muscle force and muscle tension had been normal, physiological reflexes returned positive and pathological reflexes returned negative. Wechsler Adult Intelligence Scale full scale IQ scored 98, and detected no abnormality in psychological tests. Blood glucose, trace elements, and screening of urine staining were normal. Magnetic resonance imaging (MRI) showed no abnormality. Electroencephalogram (EEG) showed no abnormality both in interictal and ictal period. The family history was positive and based on the aforementioned the patient was diagnosed as PNKD. The patient was administered clonazepam 1 mg each time for 2 times per day. However, recurrence was still detected. The patient did not agree to a further increase in the dosage of clonazepam.
4.2.
Mutation analysis
Primers of ten exons and intron borders of PNKD/MR-1 gene sequence were designed with Primer Premier 5.0 and synthesized by Shanghai Biotechnological Company, Shanghai, China (Table 1). Two hundred ml peripheral venous bloods were drawn for DNA extraction. The bloods were split with SDS and digested with protease K. QIA amp Blood Kit DNA extraction kit (Qiagen, Beijing, China) was used to extract DNA according the operating instruction, and then, UV–vis spectrophotometer was used to test content of DNA. PCR reaction conditions were prepared according to ABI Company's standard protocols.
4.3.
Linkage analysis
Nineteen microsatellite loci between 2q31–2q35 were chosen according to past literatures. Primers were designed according to STR loci sequence information using Primer 5 software (primer sequences are available upon request). Post PCR amplification, 1 ml of PCR product was mixed with molecular marker/formamide (0.5:8.5) and denatured at 95 1C for 3 min prior to sequencing using the 3730 XL sequencer. Mendelian inconsistencies of the genotype data were investigated with Pedcheck and improper genotypes were set to missing before the linkage analysis. Two-point parametric linkage analyses were performed via the program Mendel version 11.01. We assumed an autosomal-dominant inheritance with complete penetrance and a phenocopy rate of 0.0001 for the parametric analysis and an affected allele frequency of 0.0001. At the same time, we also analyzed the gene linkage analysis with a phenocopy rate of 0.1, because we diagnosed the family depend on interview information rather than examination of objective signs. Every STR position was tested for different theta associated limit of detection (LOD) value.
125
Conflicts of interest None.
Acknowledgments The authors would like to show gratitude to the Proband and members of his family for their long-term cooperation. We also appreciate the contribution provided by Prof. X.H. Liu from Department of Pathophysiology, PLA Medical College. This research was funded by Chinese National Nature & Science Foundation (81271437), and Beijing Technology & Science New-star Training Project (2010B084).
r e f e r e nc e s
Bhatia, K.P., 2011. Paroxysmal dyskinesias. Mov. Disord. 26, 1157–1165. Bruno, M.K., Lee, H.Y., Auburger, G.W., Friedman, A., Nielsen, J.E., Lang, A.E., et al., 2007. Genotype-phenotype correlation of paroxysmal nonkinesigenic dyskinesia. Neurology 68, 1782–1789. Einum, D.D., Zhang, J, Arneson, P.J., Menon, A.G., Ptacek, L.J., 1998. Genomic structure of human anion exchanger 3 and its potential role in hereditary neurological disease. Neurogenetics 1, 289–292. Fink, J.K., Rainer, S., Wilkowski, J., Jones, S.M., Kume, A., Hedera, P., et al., 1996. Paroxysmal dystonic choreoathetosis:tight linkage to chromosome 2q. Am. J. Hum. Genet. 59, 140–145. Friedman, A., Zakrzewska-Pniewska, B., Domitrz, I., Lee, H.Y., Ptacek, L., Kwiecinski, H., 2009. Paroxysmal non-kinesigenic dyskinesia caused by the mutation of MR-1 in a large Polish kindred. Eur. Neuro l61, 39–41. Ghezzi, D., Viscomi, C., Ferlini, A., Gualandi, F., Mereghetti, P., DeGrandis, D., Zeviani, M., 2009. Paroxysmal non-kinesigenic dyskinesia is caused by mutations of the MR-1 mitochondrial targeting sequence. Hum. Mol. Genet. 18, 1058–1064. Hempelmann, A., Kumar, S., Muralitharan, S., Sander, T., 2006. Myofibrillogenesis regulator 1 gene (MR-1) mutation in an Omani family with paroxysmal nonkinesigenic dyskinesia. Neurosci. Lett. 402, 118–120. Hofele, K., Benecke, R., Auburger, G., 1997. Gene locus FPD1 of the dystonic Mount-Reback type of autosomal-dominant paroxysmal choreoathetosis. Neurology 49, 1252–1257. Jarman, P.R., Davis, M.B., Hodgson, S.V., Marsden, C.D., Wood, N. W., 1997. Paroxysmal dystonic choreoathetosis. Genetic linkage studies in a British family. Brain 120, 2125–2130. Lance, J.W., 1977. Familial paroxysmal dystonic choreoathetosis and its differentiation from related syndromes. Ann. Neurol. 2, 285–293. Lee, H.Y., Xu, Y., Huang, Y., Ahn, A.H., Auburger, G.W., Pandolfo, M., et al., 2004. The gene for paroxysmal non-kinesigenic dyskinesia encodes an enzyme in a stress response pathway. Hum. Mol. Genet. 13, 3161–3170. Li, H.L., She, Z.G., Li, T.B., Wang, A.B., Yang, Q., Wei, Y.S., et al., 2007. Overexpression of myofibrillogenesis regulator-1 aggravates cardiac hypertrophy induced by angiotensin II in mice. Hypertension 49, 1399–1408. Li, T.B., Liu, X.H., Feng, S., Hu, Y., Yang, W.X., Han, Y., et al., 2004. Characterization of MR-1, a novel myofibrillogenesis regulator
126
brain research 1595 (2015) 120–126
in human muscle. Acta Biochim. Biophys. Sin 36, 412–418. Lotze, T., Jankovic, J., 2003. Paroxysmal kinesigenic dyskinesia. Semin. Pediatr. Neurol. 10, 68–79. Matsuo, H., Kamakura, K., Satio, M., Yuzuriha, T., Urakami, K., Masaki, T., Higuchi, S., 1999. Familial paroxysmal dystonic choreoathetosis: Clinical findings in a larger Japanese family and genetic linkage to 2q. Arch. Neurol. 56, 721–726. Mehta, S.H., Morgan, J.C., Sethi, K.D., 2009. Paroxysmal dyskinesias. Curr. Treat. Options Neurol. 11, 170–178. Pons, R, Cuenca-Leo´n, E, Miravet, E, Pons, M, Xaidara, A, Youroukos, S, Macaya, A., 2012. Paroxysmal non-kinesigenic dyskinesia due to a PNKD recurrent mutation: report of two Southern European families. Eur. J. Paediatr. Neurol. 16, 86–89. Rainier, S., Thomas, D., Tokarz, D., Ming, L., Bui, M., Plein, E., et al., 2004. Myofibrillogenesis regulator 1 gene mutations cause paroxysmal dystonic choreoathetosis. Arch. Neurol. 61, 1025–1029. Raskind, W.H., Bolin, T., Wolff, J., Fink, J., Matsushita, M., Litt, M., et al., 1998. Further localization of a gene for paroxysmal dystonic choreoathetosis to a 5 cM region on chromosome 2q34. Hum. Genet. 102, 93–97. Ren, K., Jin, H., Bian, C., He, H., Liu, X., Zhang, S., et al., 2008. MR-1 modulates proliferation and migration of human hepatoma
HepG2 cells through myosin light chains-2 (MLC2)/focal adhesion kinase (FAK)/Akt signaling pathway. J. Biol. Chem. 283, 35598–35605. Shen, Y., Lee, H.Y., Rawson, J., Ojha, S., Babbitt, P., Fu, Y.H., Pta´cek, L.J., 2011. Mutations in PNKD causing paroxysmal dyskinesia alters protein cleavage and stability. Hum. Mol. Genet. 20, 2322–2332. Shimojima, K., Okumura, A., Natsume, J., Aiba, K., Kurahashi, H., Kubota, T., et al., 2012. Spinocerebellar ataxias type 27 derived from a disruption of the fibroblast growth factor 14 gene with mimicking phenotype of paroxysmal non-kinesigenic dyskinesia. Brain Dev. 34, 230–233. Spacey, S.D., Adams, P.J., Lam, P.C., Materek, L.A., Stoessl, A.J., Snutch, T.P., Hsiung, G.Y., 2006. Genetic heterogeneity in paroxysmal nonkinesigenic dyskinesia. Neurology 66, 1588–1590. Stefanova, E., Djarmati, A., Momcilovic´, D., Dragasevic´, N., Svetel, M., Klein, C., Kostic´, V.S., 2006. Clinical characteristics of paroxysmal nonkinesigenic dyskinesia in Serbian family with myofibrillogenesis regulator 1 gene mutation. Mov. Disord. 21, 2010–2015. Yeh, T.H., Lin, J.J., Lai, S.C., Wu-Chou, Y.H., Chen, A.C., Yueh, K.C., et al., 2012. Familial paroxysmal nonkinesigenic dyskinesia: clinical and genetic analysis of a Taiwanese family. J. Neurol. Sci. 323, 80–84.
