Biosensors and Bioelectronics 66 (2015) 423–430
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A cascade signal amplification strategy for surface enhanced Raman spectroscopy detection of thrombin based on DNAzyme assistant DNA recycling and rolling circle amplification Fenglei Gao n, Lili Du, Daoquan Tang, Yao Lu, Yanzhuo Zhang, Lixian Zhang Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Xuzhou Medical College, 221004 Xuzhou, China
art ic l e i nf o
a b s t r a c t
Article history: Received 1 September 2014 Received in revised form 11 November 2014 Accepted 1 December 2014 Available online 3 December 2014
A sensitive protocol for surface enhanced Raman spectroscopy (SERS) detection of thrombin is designed with R6G-Ag NPs as a signal tag by combining DNAzyme assistant DNA recycling and rolling circle amplification (RCA). Molecular beacon (MB) as recognition probe immobilizes on the glass slides and performs the amplification procedure. After thrombin-induced structure-switching DNA hairpins of probe 1, the DNAzyme is liberated from the caged structure, which hybridizes with the MB for cleavage of the MB in the presence of cofactor Zn2 þ and initiates the DNA recycling process, leading to the cleavage of a large number of MB and the generation of numerous primers for triggering RCA reaction. The long amplified RCA product which contained hundreds of tandem-repeat sequences, which can bind with oligonucleotide functionalized Ag NPs reporters. The attached signal tags can be easily read out by SERS. Because of the cascade signal amplification, these newly designed protocols provides a sensitive SERS detection of thrombin down to the femolar level (2.3 fM) with a linear range of 5 orders of magnitude (from 10 14 to 10 9 M) and have high selectivity toward its target protein. The proposed method is expected to be a good clinical tool for the diagnosis of a thrombotic disease. & 2014 Elsevier B.V. All rights reserved.
Keywords: Surface enhanced Raman spectroscopy Signal amplification DNAzyme Rolling circle amplification
1. Introduction Thrombin is a coagulation protein in the blood stream that has played significant roles in many life processes and relates to a multitude of diseases (Bichler et al., 1996; Holland et al., 2000). It is usually regarded as a tumor marker in the diagnosis of pulmonary metastasis and the high or low concentration of thrombin in blood is associated with coagulation abnormalities (Wang et al., 2009; Zhang et al., 2009a, 2009b). Therefore, the quantitative detection of thrombin is extremely important in both clinical practice and diagnostic (Liu et al., 2009). The current clinical methods for protein detection rely heavily on antibodies. Although these conventional strategies provide accurate and sensitive detection of proteins, there are still some inconveniences that exist, such as the utilization of radioactive substances, enzyme labeling, time-consuming processes, and technical expertise as well as sophisticated equipment (Shuman and Majerus, 1976; Bichler et al., 1991; Zhu et al., 2000). Thus, development of protein sensing methods that are rapid, simple, n
Corresponding author. Fax: þ 86 516 83262138. E-mail address: jsxzgfl@sina.com (F. Gao).
http://dx.doi.org/10.1016/j.bios.2014.12.006 0956-5663/& 2014 Elsevier B.V. All rights reserved.
sensitive, selective, on-site and cost-effective is still highly desirable. To overcome these problem, the strategies based on aptamers as recognition element to construct thrombin biosensor have been developed, which owing to lots of advantages, such as the ease of labeling, excellent stability and high affinity and selectivity towards thrombin compared to traditional molecular recognition system (Xiao et al., 2005; He et al., 2007; Li et al., 2008). Recently, various sensitive detection modes based on aptamers including electrochemical (Baker et al., 2006; Zhao et al., 2011; Peng et al., 2014; Sun et al., 2014), fluorescence (Wang et al., 2004; Lin et al., 2006; Huang et al., 2010; Chi et al., 2011), colorimetry (Huang et al., 2005; Li et al., 2012a, 2012b, 2012c, 2012d; Li et al., 2014), surface plasmon resonance (Wang et al., 2008, 2010), electrochemiluminescence (Huang and Zhu, 2009; Wang et al., 2011a, 2011b; Li et al., 2012a, 2012b, 2012c, 2012d) and surface enhanced Raman spectroscopy (Hu et al., 2008; Li et al., 2012a, 2012b, 2012c, 2012d; He et al., 2013) techniques have been used for detecting thrombin. Among these aptasensors, Raman spectra aptasensors are the most attractive due to their advantages of being excited at any wavelength, alleviated photobleaching, and showing narrow peak widths and fast response over the fluorescent counterparts (Cho et al., 2008; Ye et al., 2013; Zheng et al., 2014). Despite its
424
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
significant advantages, the traditional Raman aptasensor is not sensitive enough because of that traditionary 1:1 binding ratio of aptamer and analyte, limiting the total signal gain and corresponding sensitivity (Kim et al., 2010; Li et al., 2012a, 2012b, 2012c, 2012d). In order to improve the sensitivity of these aptasensors, DNA recycling amplification methods via nuclease, such as polymerasemediated strand displacement amplification (Qiu et al., 2011), exonuclease III (Gao et al., 2013; Liu et al., 2014a, 2014b) and nicking endonuclease (Xue et al., 2010, 2012; Zheng et al., 2012) aided signal amplification, wherein a single target can be amplified to cyclically produce multiple hybridization events, have increasingly become attractive alternatives for the detection of trace levels of protein. Recently, DNA recycling was also achieved by DNAzyme to promote signal amplification, which can realize simple detection, high sensitivity and low detection limit (Wang et al., 2011a, 2011b). DNAzymes are catalytic DNA sequences isolated via in vitro selection (Breaker, 2000). Cofactor-dependent DNAzymes can often be generated by varying cofactors and cofactor concentrations during the selection process. DNAzymes show high catalytic hydrolytic cleavage activities toward specific substrates, and can be denatured and renatured many times without losing their catalytic activities toward substrates (Lu et al., 2012). This unique advantage makes DNAzymes ideal biocatalysts for amplified sensing applications (Liu et al., 2014a, 2014b). This work further combined the DNAzymes assisted DNA recycling with rolling circle amplification (RCA) for SERS detection of thrombin. RCA, as an advanced DNA amplification technique alternative to polymerase chain reaction, can achieve significant signal amplification via the production of thousands of repeated sequences under mild reaction conditions and with speediness, high efficiency, and specificity. Thus, it has widely been employed for the analysis of proteins and nucleic acids by coupling with electrochemistry (Zhang et al., 2009a, 2009b), SERS (Hu and Zhang, 2010), and colorimetry (Li et al., 2010). In this paper, molecular beacon (MB) immobilized on a substrate by a highly amino–epoxy interaction to recognize the DNAzymes by thrombininduced structure-switching DNA hairpins, and then produce MB fragment structure with Zn2 þ (Brown et al., 2003) for triggering the RCA reaction (Scheme 1). Subsequently, oligonucleotide functionalized Ag NPs reporters bind with long repeated DNA sequences of RCA products, which were used for SERS analysis. The combination of dual signal amplification ways led to the attachment of a mass of Ag NPs reporters on the prolonged MB fragments, leading to an extremely sensitive strategy for detection of thrombin.
2. Experimental 2.1. Materials and reagents Zinc chloride, rhodamine 6G (R6G), glycidoxypropyltrimethoxysilane (GPTMS) (98%), thrombin, bovine serum albumin (BSA), mouse IgG, and fibrinogen were purchased from SigmaAldrich Inc. T4 ligase, phi29 DNA polymerase and the mixtures of deoxyribonucleotides (dNTPs) were obtained from Fermentas Biotechnology Co. Ltd. (Canada). Silver nitrate (AgNO3) and trisodium citrate were obtained from Shang-hai Reagent Co. (Shanghai, China) and other chemicals were of analytical grade and purchased from Beijing Chemical Reagent Co. (Beijing, China). Milli-Q water (resistance 4 18 MΩ cm) was used in all experiments. Phosphate-buffered saline (PBS, 0.1 M) of various pHs were prepared by mixing the stock solutions of NaH2PO4 and Na2HPO4. The washing buffer was PBS (0.1 M, pH 7.4) containing 0.05% (w/v) Tween-20. Thrombin aptamer and DNA were obtained from Takara (Dalian, China). The detail base sequences is shown in Table 1. 2.2. Preparation and modification of Ag NPs To provide a suitable metal surface for enhancing the SERS signal, a suspension of citrate-reduced Ag NPs was produced using a modified procedure with the conditions specified by Lee et al. (Lee and Meisel, 1982). Briefly, 200 mL aqueous solution of 10 3 M AgNO3 was boiled under vigorous stirring, then 5 mL of 35 mM sodium citrate solution was added, and the resulting mixture was kept boiling for 1 h. The colloidal solution was stored at 4 °C and protected from room light. Before DNA loading, the thiol functionality on the oligonucleotide probes was deprotected by treatment with 1.7 equivalents of TCEP for 1 h by using acetate buffer (0.05 mM, pH 5.2) at room temperature. The Ag NPs (3 mL, 2.5 nM) were functionalized with the deprotected thiol oligonucleotides (30 μL, 12 μM) by incubation at room temperature for at least 16 h with gently stirring and an additional 24 h after the concentration of NaCl had been increased to 100 mM. In order to obtain the DNA-conjugated Ag NPs, dependence of SERS intensity for 1.0 pM target thrombin on the concentration of DNA have been investigated in Supporting information. The resulting detection probe attached Ag NPs were purified three times by centrifugation at 8000 rpm for 15 min, redispersed in 10 mM PBS and stored at 4 °C. 10 μL of R6G solution (1 mM) was added to 1.0 mL of probe attached Ag NPs (25 nM) for reaction under stirring for 12 h. The R6G co-assembled with the probe on Ag NPs surface by thiol group. The obtained reporter Ag NPs were rinsed by centrifugation and redispersed in 1 mL PBS (0.01 M, pH 7.4).
Scheme 1. Schematic illustration of SERS assay for thrombin detection based on DNAzyme assistant DNA recycling and rolling circle amplification.
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
425
Table 1 Oligonucleotides used in the present work. Oligonucleotide
Sequence (5′-3′)
Probe 1 MB Padlock probe Detection probe
ACCACGGACTCATCTCTTCTCCGAGCCGGTCGAAATAGTGATGAGTCCGTGGTAGGGCAGGTTGGGGTGACT NH2-CCACCACATTGAAATTGACCCACTATrAGGAAGAGATGTTACGAGGCGGTGGTGG p-GGTCAAACTAACGGTGGCCGGTTGAAATTCAGTCGGCTTCGAATGATAGTG SH-CGGTTGAAATTCAGT
2.3. Immobilization of MB on the glass slide surface A glass substrate was first immersed in piranha solution (30% hydrogen peroxide and 70% sulfuric acid) for 12 h, washed thoroughly with water, and then dried under a stream of nitrogen. The obtained substrate was silylanized by dipping it in a toluene solution of 1% GPTMS overnight at room temperature. Afterward, the substrate was washed thoroughly with toluene and ethanol to remove the physically absorbed GPTMS and dried under a stream of nitrogen. The immobilization of MB on the silylanized substrate was performed by dropping 10 μL of MB solution (1 μM) on the substrate and reacting at room temperature for 2 h. 2.4. Dual amplification detection of thrombin To detect target thrombin, the hybridization between probe 1 (5 μL, 0.1 μM) and different concentrations of target thrombin (5 μL) was performed for 30 min. Then, 10 μL hybridization solutions and 2 μL of 0.8 mM Zn2 þ were dropped on the glass slides surface for 80 min. The glass slide was then washed three times with buffer subsequently. Afterward, a volume of 50 μL of solution containing 1 ligase buffer, 1 μM padlock probe, 10 U T4 ligase was hybridized with the MB fragments on the substrate at 37 °C for 1 h. The introduction of the T4 ligase made the 5′ and 3′ termini of the padlock probe link together to form a circular template. After ligation, T4 DNA ligase was inactivated by heating. The excess circular template was removed by washing three times with 100 μL of rinsing buffer and twice with 100 μL of ultrapure water. The RCA reaction was initiated by addition of 10 U of phi29 DNA polymerase and 10 mM dNTP in 50 μL of RCA buffer and incubated for 2 h at 37 °C. After RCA reaction, the solution was removed from the surface of the electrode. The above glass slide was immerged in 100 μL of detection probe-modified Ag NPs for 1 h at 37 °C. The glass slide was then washed three times with buffer subsequently. 2.5. Apparatus SERS measurements were performed using a Renishaw inViaReflex Raman microscope system (Renishaw, U.K.). A He–Ne laser at 514 nm and at laser powers of 10 mW was used for excitation, and spectra were acquired using a 10 working objective lens on a sample. The stable testing result of Raman microscope system is in Supporting information. Tapping mode atomic force microscopic (AFM) image was acquired under ambient conditions using an Agilent 5500 AFM/SPM system. X-ray photoelectron spectroscopic (XPS) measurements were performed using an ESCALAB 250 spectrometer (Thermo-VG Scientific) with an ultrahigh vacuum generator. The UV–vis absorption spectrum was observed with a UV-3600 UV–vis spectrophotometer (Shimadzu). X-ray photoelectron spectroscopic (XPS) measurements were performed using an ESCALAB 250 spectrometer (Thermo-VG Scientific) with an ultrahigh vacuum generator. The transmission electron microscopic (TEM) image was observed on a JEM-2100 transmission electron microscope (JEOL Ltd., Japan). X-ray diffraction (XRD) patterns were obtained using a Bruker D8 Discover X-ray
diffractometer (German).
3. Results and discussion 3.1. The principle of SERS sensor for amplification detection of thrombin In order to realize the sensitive detection of target thrombin, the cascade signal amplification was performed with DNAzyme assistant DNA recycling, RCA, Ag NPs tagging, and SERS analysis. As shown in Scheme 1, the amino groups functionalized MB is immobilized on to the glass slide surface by amino–epoxy interaction, which perform the amplification procedure as recognition probe. In the presence of thrombin, which facilitates the opening of the hairpin structure of probe 1, the DNAzyme is liberated from the caged structure. The activated DNAzyme hybridizes with the MB substrate and catalyze the cleavage of the MB substrate with cofactor Zn2 þ . After cleavage, the MB is cleaved into two pieces, resulting in DNAzyme strand spontaneously dissociated from the MB structure at the surface of the substrate. Eventually, each target-induced activated DNAzyme recycles many times to trigger the cleavage of MB substrates for formation of numerous MB fragments. After the circular template was formed by incubating the padlock probe and T4 ligase on the MB fragment captured substrate, the RCA reaction was initiated by adding Phi29 DNA polymerase and dNTPs. Subsequently, the detection probe modified Ag NPs hybridize with the long amplified RCA product which contained hundreds of tandem-repeat sequences, resulting in the multiplication of Ag NPs reporters on the glass slide surface, thus carried more Raman dye (R6G) molecules to the substrate. Consequently, the SERS signal increased due to the binding of the amplified RCA products with the detection probe modified Ag NPs–R6G, resulting in improved sensitivity for low-abundance thrombin detection. On the contrary, in the absence of target thrombin, although probe 1 has some matched bases with the MB, they could not form a double-stranded structure due to the hairpin structure of probes 1 and could not form MB fragments for initiation the RCA, which provides low background for the sensing system. 3.2. Characterization of Ag NPs-DNA probe XPS measurements were performed to obtain the elemental composition of the films in order to confirm the immobilization of MB. Fig. 1 showed the N 1s region of the high-resolution XPS spectra obtained for the glass slide substrate. The N (1s) at 399 eV (Fig. 1A, curve a) did not show any peak indicating the non-existence of nitrogen on the glass slide surface. After MB was covalently linked to the glass slide, the intensity of the N (1s) peak at 399 eV increased sharply (Fig. 1A, curve b), which was obviously due to the covalent binding of MB on the surfaces of glass slides. The binding of the SH-modified probes to Ag NPs were demonstrated by UV–vis spectra (Fig. 1B). The size of the Ag NPs could be estimated to be 25 nm from the absorption peak at 428 nm (curve a). The UV–vis spectrum of probes attached Ag NPs
426
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
Fig. 1. (A) XPS analysis of (a) glass slides and (b) MB immobilized glass slides; (B) UV–vis absorption spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; (C) TEM image of DNA functionalized Ag NPs; (D) XRD spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; (E) XPS spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; and (F) SERS spectra of (a) blank, (b) no target and (c) 1.0 pM target thrombin followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles.
showed a slight redshift of the absorption peak to 433 nm compared with Ag NPs (curve b), indicating that the latter possessed better dispersion due to the presence of negatively charged oligonucleotides (Qian et al., 2014; Zong et al., 2013). Meanwhile, the probes attached Ag NPs showed a strong absorption peak at about
260 nm (curve b), which could be attributed to the adsorption of the DNA strand (Su et al., 2014; Zhang et al., 2014), indicating the successful binding of probes to the surfaces of Ag NPs. The transmission electron microscopy (TEM) image reveals that DNA-Ag NPs are spherical particles with good monodispersibility
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
427
(Fig. 1C) and an average size of 26 72 nm (Fig. 1C), which was slightly greater than the size of unfunctionalized Ag NPs and consistent with the result obtained from the UV–vis absorption. The inset is a TEM imager of Ag NPs-DNA conjugates, from which the DNA can be seen loading on Ag NPs clearly, as indicated by the light gray cloud surrounding the particles. The size is advantageous for their use in SERS. The deprotected thiol oligonucleotides do not lead to aggregate formation. The X-ray diffraction (XRD) spectra of DNA-Ag NPs is displayed in Fig. 1D. The scanning range (2θ) was selected between 20° and 90°. Diffraction peaks were observed at 2θ values of 38.17°, 44.37°, 64.56°, and 77.54°, which corresponded to the (111), (200), (220), and (311) reflections of face-centered Ag NPs, respectively (Prasad et al., 2005). However, a much more significant reduction in intensity is seen after modifying of DNA on the Ag NPs (curve d), which confirming the assembly of DNA on the Ag NPs surface. X-ray photoelectron spectroscopy (XPS), which is a typical surface analytical tool, was also used to analyze the surface chemical compositions of the Ag NPs, and DNA-Ag NPs. The characteristic Ag (3d) peaks at 374 and 368 eV are in the Fig. 1E. This is direct evidence that Ag exists in DNA-Ag NPs. P (2p) peak occurred at 133.1 eV, which corresponded to the phosphate group, confirming the assembly of DNA on the Ag NPs surface.
in Fig. 2A, the Ag NPs were either well-separated within the entangled and coalesced parts of the DNA, because the fluidic flow created during removal of the solution droplet cause the long assemblies to be entangled. And Ag NPs were observed only along the DNA skeletons indicating that the probes on the Ag NPs only hybridize with RCA product, and no specific adsorption on the glass slide. The associated height profile showed that the size of Ag NPs was about 25 nm. The tagging of Ag NPs on RCA product could be confirmed by TEM. It could be seen from Fig. 2B, that a large number of Ag NPs regularly aligned on the stretched RCA products. Thus, the RCA procedure produced the tandem-repeat oligonucleotide sequences complementary with the Ag NPs-DNA probe, leading to the tagging of Ag NPs on RCA product. Thus, the SERS signal might be significantly amplified as a result of the increase of Ag NPs reporters’ number. In addition, the XPS spectrum of nanoassembled superstructures on the glass slide showed an Ag (3d) peak at 367.8 and 373.8 eV (Fig. 2C, curve a) compared with blank (Fig. 2C, curve b), which confirming the assembly of Ag NPs on the glass slide surface.
3.3. The viability of the design
Several factors, including the reaction time of DNAzyme and RCA, the concentration of Zn2 þ , Raman dye, Ag NPs, and polymerase, could affect the assay performance of the proposed method. To achieve optimal analytical performance, these experimental parameters were optimized. As we all know, the SERS intensity was dependent on the amount of the Ag NPs reporters bound to the RCA product. The greater the number of MB fragment produced by DNAzyme reaction, the greater the number of long RCA products DNA. The greater the number of repeated sequences produced by RCA reaction, the greater the amount of Ag NPs reporters bound on the substrate. In theory, a long RCA reaction time was expected to generate more repeated sequences. As shown in Fig. 3A and B, the Raman intensity increased rapidly with the time of the reaction duration trended to a constant value. Thus the optimal reaction time of DNAzyme and RCA were chosen as 80 min and 2 h, respectively. As shown in Fig. 3C, D, E, and F, the Raman intensity responses increased with the increasing amount and then levelled off, which corresponded to the saturated state. Consequently, the optimal amount of Raman dyes, Zn2 þ , polymerase, and Ag NPs, were selected at 10 μL, 0.8 mM, 10 U and 100 μL for the test, respectively.
In order to verify the amplification ability of the proposed assay strategy, the SERS intensity of the system was tested. In the absence of thrombin before (Fig. 1F, curve a) and after (Fig. 1F, curve b) RCA, and the followed Ag NPs adsorption on the MB modified substrate did not show any detectable Raman signal, indicating no Ag NPs was assembled or R6G was absorbed on the glass slide surface. Because probe 1 could not hybridize with the loop of the MB to produce the MB fragment as prime for initiating RCA reaction, due to the DNAzyme caged by hairpin structure of probe 1. When the thrombin molecules were added into the SERS assay, a typical Raman vibration band of R6G appeared at 772, 1130, 1184, 1312, 1363, 1508, and 1651 cm 1(Fig. 1F, curve c), which were attributed to the carbon–hydrogen bend mode, ethylamine group wag modes, and xanthenes ring stretch mode, respectively. The RCA amplified the attachment of Ag NPs reporters on the glass slide surface and greatly improved the sensitivity of detection. The experimental results confirmed that DNAzyme assistant DNA recycling and RCA did occur as expected for signal amplification. The formation of Ag-nanoassembled superstructures along the long RCA products were further characterized by AFM. As shown
3.4. Optimization of the reaction conditions
Fig. 2. (A) AFM height image of MB modified glass slides followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles; (B) TEM image of RCA and Ag NPs assembles; (C) XPS spectra of (a) blank and (b) glass slides followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles.
428
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
Fig. 3. Dependence of SERS intensity for 1.0 pM target thrombin on (A) the reaction time of RCA; (B) the reaction time of DNAzyme assistant DNA recycling; (C) the amount of Raman dye; (D) the amount of Zn2 þ ; (E) the amount of polymerase, and (F) the volume of Ag NPs. When one parameter changes the others are under their optimal conditions.
3.5. Analytical performance of the aptasensor Under the optimized experiment conditions, the proposed aptasensor was incubated with a series of thrombin solution with various concentrations and the corresponding Raman spectra were recorded. The relative Raman intensity of R6G at 1508 cm 1 was monitored and used as a quantitative evaluation of the thrombin levels. As shown in Fig. 4, the SERS signal increased linearly with the logarithm of thrombin concentration with a linear range from 10 fM to 1 nM. The linear equation was I ¼674.7 log cþ 9721.3, and the detection limit were 2.3 fM (3s). The detection limit of the proposed thrombin aptasensor was comparable or even lower
than that obtained from previous electrochemical (0.15 pM) (Sun et al., 2014), fluorescent (1 nM) (Chi et al., 2011), and colorimetric (0.6 nM) (Li et al., 2014) methods with aptamers as the molecular recognition elements. The concentration of thrombin in healthy people blood can change considerably nM levels; thrombin only reaches pM levels even in the blood of patients suffering from diseases related to coagulation abnormalities (Bichler et al., 1996; Yoon et al., 2013). The limit of detection achieved relates to physiological thrombin concentrations and the enhanced sensitivity could use in monitoring thrombin levels in patients. The SERS biosensor developed in this work exhibits a very low Limit of detection, which due to the following reason: the amplification of
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
429
Fig. 4. SERS spectra for 10 15, 10 14, 10 13, 10 12, 10 11, 10 10, and 10 9 M target thrombin (from a to g) with dual signal amplification and (B) linear calibration of SERS intensity vs logarithm of thrombin concentration.
DNAzyme and the RCA process, which increased the number of Raman dyes on the surface of MB modified glass slide. To check the selectivity of our SERS-based assay platform, we also tested the response of negative control samples with aptamer-conjugated nanoprobes. Three proteins (BSA, IgG and fibrinogen) were selected as negative control targets on the basis of previous reports for the aptamer-based thrombin assay ( Fig. 5). It was found that the presence of the interferences did not show any significant responses compared with the blank. Moreover, the presence of high concentration of interfering components (0.1 μM BSA and 0.1 μM IgG) also did not interfere with the assay for thrombin (1.0 pM). These results clearly demonstrated the high specificity of the proposed assay for thrombin detection. To examine the reproducibility, ten equally proposed aptasensors incubated with the same concentration thrombin (10 pM) were used. All the glass slides displayed the similar SERS responses. Also, a relative standard deviation (RSD) of 5.1% was obtained, indicating acceptable reproducibility of the aptasensor. Additionally, the stability of the proposed aptasensor was evaluated long-term storage assay. After 10 days storage at 4 °C, the aptasensor retained 93.8% of initial signal. And, over 86.8% of initial response remained after storage of 30 days. The results suggested the apatasensor could be used for protein analysis with acceptable stability.
Fig. 5. The selectivity of the aptasensor examined by being incubated in the following samples under the same experimental conditions: (a) blank; (b) 1.0 pM BSA; (c) 1.0 pM IgG; (d) 1.0 pM fibrinogen; (e) 1.0 pM thrombinþ0.1 μM BSA; (f) 1.0 pM thrombinþ0.1 μM IgG; and (g) 1.0 pM thrombin.
Table 2 Determination of thrombin added in human blood serum (n¼5) with the proposed aptasensor. Serum samples
Concentration of thrombin added
Concentration obtained with aptasensor
RSD (%) Recovery (%)
1 2
1 nM 10 pM
0.98 nM 10.53 pM
4.7 6.6
98.1 105.3
3.6. Analysis of thrombin in human serum To further assess its biomedical and diagnostic applications, our SERS detector was investigated for detecting thrombin in human serum samples. According to the standard addition method, a series of different concentration of thrombin were added into human serum samples obtained from the affiliated hospital of Xuzhou medical college. The data are given in Table 2. At the concentration of 10 11 and 10 9 M, the recovery was 98.1% and 105.3% and the RSD was ranging from 4.7% to 6.6%. Our method demonstrated the potential of the method for application in complex matrix and future biomarker development.
4. Conclusions In summary, we have demonstrated the construction of a universal and sensitive SERS aptasensor for detection of thrombin based on DNAzyme assistant DNA recycling and rolling circle amplification. On the basis of dual signal amplification strategy, the prepared aptasensors exhibited high response sensitivity, a low detection limit, and a wide linear range to thrombin. Firstly, a large quantity of single strand capture probes could be obtained via DNAzyme-catalyzed DNA recycling, which provides sufficient primers for the following RCA. Secondly, plenty of Ag NPs reporters would be immobilized onto the electrode surface via the interaction between of Ag NPs reporters and the long amplified RCA product which contained hundreds of tandem-repeat sequences, resulting in amplified SERS response of Raman dyes. Besides the high reproducibility and stability of sensing platform, the special selectivity and simple regeneration of the sensing system were illustrated. Compared to standard laboratory analysis techniques (conventional microplate-based enzyme-linked immunosorbent assay) (Funano et al., 2013), this method do not need such long incubation time of 180 min for enzyme-linked reaction.
430
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
In addition, it is indeed not a quick enough time to result to deploy in the field, and efforts are currently being made to shorten the time in our lab. In view of these advantages, the proposed aptasensor showed a promising way in clinic application and other protein monitoring.
Acknowledgment The authors gratefully acknowledge the financial support of the National Natural Science Foundation of China (21405130) and Excellent Talents of Xuzhou Medical College (D2014007).
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.12.006.
References Baker, B.R., Lai, R.Y., Wood, M.S., Doctor, E.H., Heeger, A.J., Plaxco, K.W., 2006. J. Am. Chem. Soc. 128, 3138–3139. Bichler, J., Heit, J.A., Owen, W.G., 1996. Thromb. Res. 84, 289–294. Bichler, J., Siebeck, M., Maschler, R., Pelzer, H., Fritz, H., 1991. Blood Coagul. Fibrinolysis 2, 129–133. Breaker, R.R., 2000. Science 290, 2095–2096. Brown, A.K., Li, J., Pavot, C.M.B., Lu, Y., 2003. Biochemistry 42, 7152–7161. Chi, C.W., Lao, Y.H., Li, Y.S., Chen, L.C., 2011. Biosens. Bioelectron. 26, 3346–3352. Cho, H., Baker, B.R., Wachsmann-Hogiu, S., Pagba, C.V., Laurence, T.A., Lane, S.M., Lee, L.P., Tok, J.B.H., 2008. Nano Lett. 8, 4386–4390. Funano, S., Henares, T.G., Kurata, M., Sueyoshi, K., Endo, T., Hisamoto, H., 2013. Anal. Biochem. 440, 137–141. Gao, T., Ning, L.M., Li, C., Wang, H.Y., Li, G.X., 2013. Anal. Chim. Acta 788, 171–176. He, P., Shen, L., Cao, Y., Li, D., 2007. Anal. Chem. 79, 8024–8029. He, P., Zhang, Y., Liu, L.J., Qiao, W.P., Zhang, S.S., 2013. Chem. Eur. J. 19, 7452–7460. Holland, C.A., Henry, A.T., Whinna, H.C., Church, F.C., 2000. FEBS Lett. 484, 87–91. Huang, D.W., Niu, C.G., Qin, P.Z., Ruan, M., Zeng, G.M., 2010. Talanta 83, 185–189. Huang, C.C., Huang, Y.F., Cao, Z., Tan, W., Chang, H.T., 2005. Anal. Chem. 77, 5735–5741. Huang, H.P., Zhu, J.J., 2009. Biosens. Bioelectron. 25, 927–930. Hu, J., Zheng, P.C., Jiang, J.H., Shen, G.L., Yu, R.Q., Liu, G.K., 2008. Anal. Chem. 81, 87–93. Hu, J., Zhang, C.Y., 2010. Anal. Chem. 82, 8991–8997. Kim, N.H., Lee, S.J., Moskovits, M., 2010. Nano Lett. 10, 4181–4185. Lee, P.C., Meisel, D., 1982. J. Phys. Chem. 86, 3391–3395. Li, B.L., Wang, Y.L., Wei, H., Dong, S.J., 2008. Biosens. Bioelectron. 23, 965–970. Li, J.S., Deng, T., Chu, X., Yang, R.H., Jiang, J.H., Shen, G.L., Yu, R.Q., 2010. Anal. Chem. 82, 2811–2816. Li, J., Fu, H.E., Wu, L.J., Zheng, A.X., Chen, G.N., Yang, H.H., 2012a. Anal. Chem. 84,
5309–5315. Li, Y.F., Liu, L.L., Fang, X.L., Bao, J.C., Han, M., Dai, Z.H., 2012b. Electrochim. Acta 65, 1–6. Li, Y., Lei, C.C., Zeng, Y., Ji, X.T., Zhang, S.S., 2012c. Chem. Commun. 48, 10892–10894. Li, M., Zhang, J.M., Suri, S., Sooter, L.J., Ma, D.L., Wu, N.Q., 2012d. Anal. Chem. 84, 2837–2842. Li, J., Li, W., Qiang, W.B., Wang, X., Li, H., Xu, D.K., 2014. Anal. Chim. Acta 807, 120–125. Lin, C., Katilius, E., Liu, Y., Zhang, J., Yan, H., 2006. Angew. Chem. Int. Ed. 45, 5296–5301. Liu, J.W., Cao, Z.H., Lu, Y., 2009. Chem. Rev. 109, 1948–1998. Liu, S.F., Ming, J.J., Lin, Y., Wang, C.F., Cheng, C.B., Liu, T., Wang, L., 2014a. Biosens. Bioelectron. 55, 225–230. Liu, X.T., Xue, Q.W., Ding, Y.S., Zhu, J., Wang, L., Jiang, W., 2014b. Analyst 139, 2884–2889. Lu, C.H., Wang, F., Willner, I., 2012. J. Am. Chem. Soc. 134, 10651–10658. Peng, K.F., Zhao, H.W., Yuan, Y.L., Yuan, R., Wu, X.F., 2014. Biosens. Bioelectron. 55, 366–371. Prasad, B.L.V., Arumugam, S.K., Bala, T., Sastry, M., 2005. Langmuir 21, 822–826. Qian, R.C., Ding, L., Yan, L.W., Lin, M.F., Ju, H.X., 2014. J. Am. Chem. Soc. 136, 8205–8208. Qiu, L.P., Wu, Z.S., Shen, G.L., Yu, R.Q., 2011. Anal. Chem. 83, 3050–3057. Su, S., Fan, J.W., Xue, B., Yuwen, L.H., Liu, X.F., Pan, D., Fan, C.H., Wang, L.H., 2014. ACS Appl. Mater. Interfaces 6, 1152–1157. Sun, A.L., Qi, Q.G., Wang, X.N., Bie, P., 2014. Biosens. Bioelectron. 57, 16–21. Shuman, M.A., Majerus, P.W., 1976. J. Clin. Investig. 58, 1249–1258. Wang, Y.L., Li, D., Ren, W., Liu, Z.J., Dong, S.J., Wang, E.K., 2008. Chem. Commun. 22, 2520–2522. Wang, X.L., Li, F., Su, Y.H., Sun, X., Li, X.B., Schluesener, H.J., Tang, F., Xu, S.Q., 2004. Anal. Chem. 76, 5605–5610. Wang, J.L., Munir, A., Zhu, Z.Z., Zhou, H.S., 2010. Anal. Chem. 82, 6782–6789. Wang, J., Meng, W.Y., Zhou, X.F., Liu, S.L., Li, G.X., 2009. Biosens. Bioelectron. 24, 1598–1602. Wang, J., Shan, Y., Zhao, W.W., Xu, J.J., Chen, H.Y., 2011a. Anal. Chem. 83, 4004–4011. Wang, F., Elbaz, J., Orbach, R., Magen, N., Willner, I., 2011b. J. Am. Chem. Soc. 133, 17149–17151. Xue, L.Y., Zhou, X.M., Xing, D., 2010. Chem. Commun. 46, 7373–7375. Xue, L.Y., Zhou, X.M., Xing, D., 2012. Anal. Chem. 84, 3507–3513. Xiao, Y., Arica, A.L., Alan, J.H., Kevin, W.P., 2005. Angew. Chem. Int. Ed. 44, 5456–5459. Ye, S.J., Guo, Y.Y., Xiao, J., Zhang, S.S., 2013. Chem. Commun. 49, 3643–3645. Yoon, J., Choi, N., Ko, J., Kim, K., Lee, S., Choo, J., 2013. Biosens. Bioelectron. 47, 62–67. Zhang, S.B., Wu, Z.S., Shen, G.L., Yu, R.Q., 2009a. Biosens. Bioelectron. 24, 3201–3207. Zhang, X.R., Qi, B.P., Li, Y., Zhang, S.S., 2009b. Biosens. Bioelectron. 25, 259–262. Zhang, C.L., Yan, J., Liu, C., Ji, X.H., He, Z.K., 2014. ACS Appl. Mater. Interfaces 6, 3189–3194. Zhao, J., Chen, G.F., Zhu, L., Li, G.X., 2011. Electrochem. Commun. 13, 31–33. Zheng, A.X., Wang, J.R., Li, J., Song, X.R., Chen, G.N., Yang, H.H., 2012. Chem. Commun. 48, 374–376. Zheng, J., Hu, Y.P., Bai, J.H., Ma, C., Li, J.S., Li, Y.H., Shi, M.L., Tan, W.H., Yang, R.H., 2014. Anal. Chem. 86, 2205–2212. Zong, C., Wu, J., Xu, J., Ju, H.X., Yan, F., 2013. Biosens. Bioelectron. 43, 372–378. Zhu, H., Klemic, J.F., Chang, S., Bertone, P., Casamayor, A., Klemic, K.G., Smith, D., Gerstein, M., Reed, M.A., Snyder, M., 2000. Nat. Genet. 26, 283–289.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A cascade signal amplification strategy for surface enhanced Raman spectroscopy detection of thrombin based on DNAzyme assistant DNA recycling and rolling circle amplification Fenglei Gao n, Lili Du, Daoquan Tang, Yao Lu, Yanzhuo Zhang, Lixian Zhang Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Xuzhou Medical College, 221004 Xuzhou, China
art ic l e i nf o
a b s t r a c t
Article history: Received 1 September 2014 Received in revised form 11 November 2014 Accepted 1 December 2014 Available online 3 December 2014
A sensitive protocol for surface enhanced Raman spectroscopy (SERS) detection of thrombin is designed with R6G-Ag NPs as a signal tag by combining DNAzyme assistant DNA recycling and rolling circle amplification (RCA). Molecular beacon (MB) as recognition probe immobilizes on the glass slides and performs the amplification procedure. After thrombin-induced structure-switching DNA hairpins of probe 1, the DNAzyme is liberated from the caged structure, which hybridizes with the MB for cleavage of the MB in the presence of cofactor Zn2 þ and initiates the DNA recycling process, leading to the cleavage of a large number of MB and the generation of numerous primers for triggering RCA reaction. The long amplified RCA product which contained hundreds of tandem-repeat sequences, which can bind with oligonucleotide functionalized Ag NPs reporters. The attached signal tags can be easily read out by SERS. Because of the cascade signal amplification, these newly designed protocols provides a sensitive SERS detection of thrombin down to the femolar level (2.3 fM) with a linear range of 5 orders of magnitude (from 10 14 to 10 9 M) and have high selectivity toward its target protein. The proposed method is expected to be a good clinical tool for the diagnosis of a thrombotic disease. & 2014 Elsevier B.V. All rights reserved.
Keywords: Surface enhanced Raman spectroscopy Signal amplification DNAzyme Rolling circle amplification
1. Introduction Thrombin is a coagulation protein in the blood stream that has played significant roles in many life processes and relates to a multitude of diseases (Bichler et al., 1996; Holland et al., 2000). It is usually regarded as a tumor marker in the diagnosis of pulmonary metastasis and the high or low concentration of thrombin in blood is associated with coagulation abnormalities (Wang et al., 2009; Zhang et al., 2009a, 2009b). Therefore, the quantitative detection of thrombin is extremely important in both clinical practice and diagnostic (Liu et al., 2009). The current clinical methods for protein detection rely heavily on antibodies. Although these conventional strategies provide accurate and sensitive detection of proteins, there are still some inconveniences that exist, such as the utilization of radioactive substances, enzyme labeling, time-consuming processes, and technical expertise as well as sophisticated equipment (Shuman and Majerus, 1976; Bichler et al., 1991; Zhu et al., 2000). Thus, development of protein sensing methods that are rapid, simple, n
Corresponding author. Fax: þ 86 516 83262138. E-mail address: jsxzgfl@sina.com (F. Gao).
http://dx.doi.org/10.1016/j.bios.2014.12.006 0956-5663/& 2014 Elsevier B.V. All rights reserved.
sensitive, selective, on-site and cost-effective is still highly desirable. To overcome these problem, the strategies based on aptamers as recognition element to construct thrombin biosensor have been developed, which owing to lots of advantages, such as the ease of labeling, excellent stability and high affinity and selectivity towards thrombin compared to traditional molecular recognition system (Xiao et al., 2005; He et al., 2007; Li et al., 2008). Recently, various sensitive detection modes based on aptamers including electrochemical (Baker et al., 2006; Zhao et al., 2011; Peng et al., 2014; Sun et al., 2014), fluorescence (Wang et al., 2004; Lin et al., 2006; Huang et al., 2010; Chi et al., 2011), colorimetry (Huang et al., 2005; Li et al., 2012a, 2012b, 2012c, 2012d; Li et al., 2014), surface plasmon resonance (Wang et al., 2008, 2010), electrochemiluminescence (Huang and Zhu, 2009; Wang et al., 2011a, 2011b; Li et al., 2012a, 2012b, 2012c, 2012d) and surface enhanced Raman spectroscopy (Hu et al., 2008; Li et al., 2012a, 2012b, 2012c, 2012d; He et al., 2013) techniques have been used for detecting thrombin. Among these aptasensors, Raman spectra aptasensors are the most attractive due to their advantages of being excited at any wavelength, alleviated photobleaching, and showing narrow peak widths and fast response over the fluorescent counterparts (Cho et al., 2008; Ye et al., 2013; Zheng et al., 2014). Despite its
424
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
significant advantages, the traditional Raman aptasensor is not sensitive enough because of that traditionary 1:1 binding ratio of aptamer and analyte, limiting the total signal gain and corresponding sensitivity (Kim et al., 2010; Li et al., 2012a, 2012b, 2012c, 2012d). In order to improve the sensitivity of these aptasensors, DNA recycling amplification methods via nuclease, such as polymerasemediated strand displacement amplification (Qiu et al., 2011), exonuclease III (Gao et al., 2013; Liu et al., 2014a, 2014b) and nicking endonuclease (Xue et al., 2010, 2012; Zheng et al., 2012) aided signal amplification, wherein a single target can be amplified to cyclically produce multiple hybridization events, have increasingly become attractive alternatives for the detection of trace levels of protein. Recently, DNA recycling was also achieved by DNAzyme to promote signal amplification, which can realize simple detection, high sensitivity and low detection limit (Wang et al., 2011a, 2011b). DNAzymes are catalytic DNA sequences isolated via in vitro selection (Breaker, 2000). Cofactor-dependent DNAzymes can often be generated by varying cofactors and cofactor concentrations during the selection process. DNAzymes show high catalytic hydrolytic cleavage activities toward specific substrates, and can be denatured and renatured many times without losing their catalytic activities toward substrates (Lu et al., 2012). This unique advantage makes DNAzymes ideal biocatalysts for amplified sensing applications (Liu et al., 2014a, 2014b). This work further combined the DNAzymes assisted DNA recycling with rolling circle amplification (RCA) for SERS detection of thrombin. RCA, as an advanced DNA amplification technique alternative to polymerase chain reaction, can achieve significant signal amplification via the production of thousands of repeated sequences under mild reaction conditions and with speediness, high efficiency, and specificity. Thus, it has widely been employed for the analysis of proteins and nucleic acids by coupling with electrochemistry (Zhang et al., 2009a, 2009b), SERS (Hu and Zhang, 2010), and colorimetry (Li et al., 2010). In this paper, molecular beacon (MB) immobilized on a substrate by a highly amino–epoxy interaction to recognize the DNAzymes by thrombininduced structure-switching DNA hairpins, and then produce MB fragment structure with Zn2 þ (Brown et al., 2003) for triggering the RCA reaction (Scheme 1). Subsequently, oligonucleotide functionalized Ag NPs reporters bind with long repeated DNA sequences of RCA products, which were used for SERS analysis. The combination of dual signal amplification ways led to the attachment of a mass of Ag NPs reporters on the prolonged MB fragments, leading to an extremely sensitive strategy for detection of thrombin.
2. Experimental 2.1. Materials and reagents Zinc chloride, rhodamine 6G (R6G), glycidoxypropyltrimethoxysilane (GPTMS) (98%), thrombin, bovine serum albumin (BSA), mouse IgG, and fibrinogen were purchased from SigmaAldrich Inc. T4 ligase, phi29 DNA polymerase and the mixtures of deoxyribonucleotides (dNTPs) were obtained from Fermentas Biotechnology Co. Ltd. (Canada). Silver nitrate (AgNO3) and trisodium citrate were obtained from Shang-hai Reagent Co. (Shanghai, China) and other chemicals were of analytical grade and purchased from Beijing Chemical Reagent Co. (Beijing, China). Milli-Q water (resistance 4 18 MΩ cm) was used in all experiments. Phosphate-buffered saline (PBS, 0.1 M) of various pHs were prepared by mixing the stock solutions of NaH2PO4 and Na2HPO4. The washing buffer was PBS (0.1 M, pH 7.4) containing 0.05% (w/v) Tween-20. Thrombin aptamer and DNA were obtained from Takara (Dalian, China). The detail base sequences is shown in Table 1. 2.2. Preparation and modification of Ag NPs To provide a suitable metal surface for enhancing the SERS signal, a suspension of citrate-reduced Ag NPs was produced using a modified procedure with the conditions specified by Lee et al. (Lee and Meisel, 1982). Briefly, 200 mL aqueous solution of 10 3 M AgNO3 was boiled under vigorous stirring, then 5 mL of 35 mM sodium citrate solution was added, and the resulting mixture was kept boiling for 1 h. The colloidal solution was stored at 4 °C and protected from room light. Before DNA loading, the thiol functionality on the oligonucleotide probes was deprotected by treatment with 1.7 equivalents of TCEP for 1 h by using acetate buffer (0.05 mM, pH 5.2) at room temperature. The Ag NPs (3 mL, 2.5 nM) were functionalized with the deprotected thiol oligonucleotides (30 μL, 12 μM) by incubation at room temperature for at least 16 h with gently stirring and an additional 24 h after the concentration of NaCl had been increased to 100 mM. In order to obtain the DNA-conjugated Ag NPs, dependence of SERS intensity for 1.0 pM target thrombin on the concentration of DNA have been investigated in Supporting information. The resulting detection probe attached Ag NPs were purified three times by centrifugation at 8000 rpm for 15 min, redispersed in 10 mM PBS and stored at 4 °C. 10 μL of R6G solution (1 mM) was added to 1.0 mL of probe attached Ag NPs (25 nM) for reaction under stirring for 12 h. The R6G co-assembled with the probe on Ag NPs surface by thiol group. The obtained reporter Ag NPs were rinsed by centrifugation and redispersed in 1 mL PBS (0.01 M, pH 7.4).
Scheme 1. Schematic illustration of SERS assay for thrombin detection based on DNAzyme assistant DNA recycling and rolling circle amplification.
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
425
Table 1 Oligonucleotides used in the present work. Oligonucleotide
Sequence (5′-3′)
Probe 1 MB Padlock probe Detection probe
ACCACGGACTCATCTCTTCTCCGAGCCGGTCGAAATAGTGATGAGTCCGTGGTAGGGCAGGTTGGGGTGACT NH2-CCACCACATTGAAATTGACCCACTATrAGGAAGAGATGTTACGAGGCGGTGGTGG p-GGTCAAACTAACGGTGGCCGGTTGAAATTCAGTCGGCTTCGAATGATAGTG SH-CGGTTGAAATTCAGT
2.3. Immobilization of MB on the glass slide surface A glass substrate was first immersed in piranha solution (30% hydrogen peroxide and 70% sulfuric acid) for 12 h, washed thoroughly with water, and then dried under a stream of nitrogen. The obtained substrate was silylanized by dipping it in a toluene solution of 1% GPTMS overnight at room temperature. Afterward, the substrate was washed thoroughly with toluene and ethanol to remove the physically absorbed GPTMS and dried under a stream of nitrogen. The immobilization of MB on the silylanized substrate was performed by dropping 10 μL of MB solution (1 μM) on the substrate and reacting at room temperature for 2 h. 2.4. Dual amplification detection of thrombin To detect target thrombin, the hybridization between probe 1 (5 μL, 0.1 μM) and different concentrations of target thrombin (5 μL) was performed for 30 min. Then, 10 μL hybridization solutions and 2 μL of 0.8 mM Zn2 þ were dropped on the glass slides surface for 80 min. The glass slide was then washed three times with buffer subsequently. Afterward, a volume of 50 μL of solution containing 1 ligase buffer, 1 μM padlock probe, 10 U T4 ligase was hybridized with the MB fragments on the substrate at 37 °C for 1 h. The introduction of the T4 ligase made the 5′ and 3′ termini of the padlock probe link together to form a circular template. After ligation, T4 DNA ligase was inactivated by heating. The excess circular template was removed by washing three times with 100 μL of rinsing buffer and twice with 100 μL of ultrapure water. The RCA reaction was initiated by addition of 10 U of phi29 DNA polymerase and 10 mM dNTP in 50 μL of RCA buffer and incubated for 2 h at 37 °C. After RCA reaction, the solution was removed from the surface of the electrode. The above glass slide was immerged in 100 μL of detection probe-modified Ag NPs for 1 h at 37 °C. The glass slide was then washed three times with buffer subsequently. 2.5. Apparatus SERS measurements were performed using a Renishaw inViaReflex Raman microscope system (Renishaw, U.K.). A He–Ne laser at 514 nm and at laser powers of 10 mW was used for excitation, and spectra were acquired using a 10 working objective lens on a sample. The stable testing result of Raman microscope system is in Supporting information. Tapping mode atomic force microscopic (AFM) image was acquired under ambient conditions using an Agilent 5500 AFM/SPM system. X-ray photoelectron spectroscopic (XPS) measurements were performed using an ESCALAB 250 spectrometer (Thermo-VG Scientific) with an ultrahigh vacuum generator. The UV–vis absorption spectrum was observed with a UV-3600 UV–vis spectrophotometer (Shimadzu). X-ray photoelectron spectroscopic (XPS) measurements were performed using an ESCALAB 250 spectrometer (Thermo-VG Scientific) with an ultrahigh vacuum generator. The transmission electron microscopic (TEM) image was observed on a JEM-2100 transmission electron microscope (JEOL Ltd., Japan). X-ray diffraction (XRD) patterns were obtained using a Bruker D8 Discover X-ray
diffractometer (German).
3. Results and discussion 3.1. The principle of SERS sensor for amplification detection of thrombin In order to realize the sensitive detection of target thrombin, the cascade signal amplification was performed with DNAzyme assistant DNA recycling, RCA, Ag NPs tagging, and SERS analysis. As shown in Scheme 1, the amino groups functionalized MB is immobilized on to the glass slide surface by amino–epoxy interaction, which perform the amplification procedure as recognition probe. In the presence of thrombin, which facilitates the opening of the hairpin structure of probe 1, the DNAzyme is liberated from the caged structure. The activated DNAzyme hybridizes with the MB substrate and catalyze the cleavage of the MB substrate with cofactor Zn2 þ . After cleavage, the MB is cleaved into two pieces, resulting in DNAzyme strand spontaneously dissociated from the MB structure at the surface of the substrate. Eventually, each target-induced activated DNAzyme recycles many times to trigger the cleavage of MB substrates for formation of numerous MB fragments. After the circular template was formed by incubating the padlock probe and T4 ligase on the MB fragment captured substrate, the RCA reaction was initiated by adding Phi29 DNA polymerase and dNTPs. Subsequently, the detection probe modified Ag NPs hybridize with the long amplified RCA product which contained hundreds of tandem-repeat sequences, resulting in the multiplication of Ag NPs reporters on the glass slide surface, thus carried more Raman dye (R6G) molecules to the substrate. Consequently, the SERS signal increased due to the binding of the amplified RCA products with the detection probe modified Ag NPs–R6G, resulting in improved sensitivity for low-abundance thrombin detection. On the contrary, in the absence of target thrombin, although probe 1 has some matched bases with the MB, they could not form a double-stranded structure due to the hairpin structure of probes 1 and could not form MB fragments for initiation the RCA, which provides low background for the sensing system. 3.2. Characterization of Ag NPs-DNA probe XPS measurements were performed to obtain the elemental composition of the films in order to confirm the immobilization of MB. Fig. 1 showed the N 1s region of the high-resolution XPS spectra obtained for the glass slide substrate. The N (1s) at 399 eV (Fig. 1A, curve a) did not show any peak indicating the non-existence of nitrogen on the glass slide surface. After MB was covalently linked to the glass slide, the intensity of the N (1s) peak at 399 eV increased sharply (Fig. 1A, curve b), which was obviously due to the covalent binding of MB on the surfaces of glass slides. The binding of the SH-modified probes to Ag NPs were demonstrated by UV–vis spectra (Fig. 1B). The size of the Ag NPs could be estimated to be 25 nm from the absorption peak at 428 nm (curve a). The UV–vis spectrum of probes attached Ag NPs
426
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
Fig. 1. (A) XPS analysis of (a) glass slides and (b) MB immobilized glass slides; (B) UV–vis absorption spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; (C) TEM image of DNA functionalized Ag NPs; (D) XRD spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; (E) XPS spectra of (a) Ag NPs and (b) DNA functionalized Ag NPs; and (F) SERS spectra of (a) blank, (b) no target and (c) 1.0 pM target thrombin followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles.
showed a slight redshift of the absorption peak to 433 nm compared with Ag NPs (curve b), indicating that the latter possessed better dispersion due to the presence of negatively charged oligonucleotides (Qian et al., 2014; Zong et al., 2013). Meanwhile, the probes attached Ag NPs showed a strong absorption peak at about
260 nm (curve b), which could be attributed to the adsorption of the DNA strand (Su et al., 2014; Zhang et al., 2014), indicating the successful binding of probes to the surfaces of Ag NPs. The transmission electron microscopy (TEM) image reveals that DNA-Ag NPs are spherical particles with good monodispersibility
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
427
(Fig. 1C) and an average size of 26 72 nm (Fig. 1C), which was slightly greater than the size of unfunctionalized Ag NPs and consistent with the result obtained from the UV–vis absorption. The inset is a TEM imager of Ag NPs-DNA conjugates, from which the DNA can be seen loading on Ag NPs clearly, as indicated by the light gray cloud surrounding the particles. The size is advantageous for their use in SERS. The deprotected thiol oligonucleotides do not lead to aggregate formation. The X-ray diffraction (XRD) spectra of DNA-Ag NPs is displayed in Fig. 1D. The scanning range (2θ) was selected between 20° and 90°. Diffraction peaks were observed at 2θ values of 38.17°, 44.37°, 64.56°, and 77.54°, which corresponded to the (111), (200), (220), and (311) reflections of face-centered Ag NPs, respectively (Prasad et al., 2005). However, a much more significant reduction in intensity is seen after modifying of DNA on the Ag NPs (curve d), which confirming the assembly of DNA on the Ag NPs surface. X-ray photoelectron spectroscopy (XPS), which is a typical surface analytical tool, was also used to analyze the surface chemical compositions of the Ag NPs, and DNA-Ag NPs. The characteristic Ag (3d) peaks at 374 and 368 eV are in the Fig. 1E. This is direct evidence that Ag exists in DNA-Ag NPs. P (2p) peak occurred at 133.1 eV, which corresponded to the phosphate group, confirming the assembly of DNA on the Ag NPs surface.
in Fig. 2A, the Ag NPs were either well-separated within the entangled and coalesced parts of the DNA, because the fluidic flow created during removal of the solution droplet cause the long assemblies to be entangled. And Ag NPs were observed only along the DNA skeletons indicating that the probes on the Ag NPs only hybridize with RCA product, and no specific adsorption on the glass slide. The associated height profile showed that the size of Ag NPs was about 25 nm. The tagging of Ag NPs on RCA product could be confirmed by TEM. It could be seen from Fig. 2B, that a large number of Ag NPs regularly aligned on the stretched RCA products. Thus, the RCA procedure produced the tandem-repeat oligonucleotide sequences complementary with the Ag NPs-DNA probe, leading to the tagging of Ag NPs on RCA product. Thus, the SERS signal might be significantly amplified as a result of the increase of Ag NPs reporters’ number. In addition, the XPS spectrum of nanoassembled superstructures on the glass slide showed an Ag (3d) peak at 367.8 and 373.8 eV (Fig. 2C, curve a) compared with blank (Fig. 2C, curve b), which confirming the assembly of Ag NPs on the glass slide surface.
3.3. The viability of the design
Several factors, including the reaction time of DNAzyme and RCA, the concentration of Zn2 þ , Raman dye, Ag NPs, and polymerase, could affect the assay performance of the proposed method. To achieve optimal analytical performance, these experimental parameters were optimized. As we all know, the SERS intensity was dependent on the amount of the Ag NPs reporters bound to the RCA product. The greater the number of MB fragment produced by DNAzyme reaction, the greater the number of long RCA products DNA. The greater the number of repeated sequences produced by RCA reaction, the greater the amount of Ag NPs reporters bound on the substrate. In theory, a long RCA reaction time was expected to generate more repeated sequences. As shown in Fig. 3A and B, the Raman intensity increased rapidly with the time of the reaction duration trended to a constant value. Thus the optimal reaction time of DNAzyme and RCA were chosen as 80 min and 2 h, respectively. As shown in Fig. 3C, D, E, and F, the Raman intensity responses increased with the increasing amount and then levelled off, which corresponded to the saturated state. Consequently, the optimal amount of Raman dyes, Zn2 þ , polymerase, and Ag NPs, were selected at 10 μL, 0.8 mM, 10 U and 100 μL for the test, respectively.
In order to verify the amplification ability of the proposed assay strategy, the SERS intensity of the system was tested. In the absence of thrombin before (Fig. 1F, curve a) and after (Fig. 1F, curve b) RCA, and the followed Ag NPs adsorption on the MB modified substrate did not show any detectable Raman signal, indicating no Ag NPs was assembled or R6G was absorbed on the glass slide surface. Because probe 1 could not hybridize with the loop of the MB to produce the MB fragment as prime for initiating RCA reaction, due to the DNAzyme caged by hairpin structure of probe 1. When the thrombin molecules were added into the SERS assay, a typical Raman vibration band of R6G appeared at 772, 1130, 1184, 1312, 1363, 1508, and 1651 cm 1(Fig. 1F, curve c), which were attributed to the carbon–hydrogen bend mode, ethylamine group wag modes, and xanthenes ring stretch mode, respectively. The RCA amplified the attachment of Ag NPs reporters on the glass slide surface and greatly improved the sensitivity of detection. The experimental results confirmed that DNAzyme assistant DNA recycling and RCA did occur as expected for signal amplification. The formation of Ag-nanoassembled superstructures along the long RCA products were further characterized by AFM. As shown
3.4. Optimization of the reaction conditions
Fig. 2. (A) AFM height image of MB modified glass slides followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles; (B) TEM image of RCA and Ag NPs assembles; (C) XPS spectra of (a) blank and (b) glass slides followed with DNAzyme assistant DNA recycling, RCA and Ag NPs assembles.
428
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
Fig. 3. Dependence of SERS intensity for 1.0 pM target thrombin on (A) the reaction time of RCA; (B) the reaction time of DNAzyme assistant DNA recycling; (C) the amount of Raman dye; (D) the amount of Zn2 þ ; (E) the amount of polymerase, and (F) the volume of Ag NPs. When one parameter changes the others are under their optimal conditions.
3.5. Analytical performance of the aptasensor Under the optimized experiment conditions, the proposed aptasensor was incubated with a series of thrombin solution with various concentrations and the corresponding Raman spectra were recorded. The relative Raman intensity of R6G at 1508 cm 1 was monitored and used as a quantitative evaluation of the thrombin levels. As shown in Fig. 4, the SERS signal increased linearly with the logarithm of thrombin concentration with a linear range from 10 fM to 1 nM. The linear equation was I ¼674.7 log cþ 9721.3, and the detection limit were 2.3 fM (3s). The detection limit of the proposed thrombin aptasensor was comparable or even lower
than that obtained from previous electrochemical (0.15 pM) (Sun et al., 2014), fluorescent (1 nM) (Chi et al., 2011), and colorimetric (0.6 nM) (Li et al., 2014) methods with aptamers as the molecular recognition elements. The concentration of thrombin in healthy people blood can change considerably nM levels; thrombin only reaches pM levels even in the blood of patients suffering from diseases related to coagulation abnormalities (Bichler et al., 1996; Yoon et al., 2013). The limit of detection achieved relates to physiological thrombin concentrations and the enhanced sensitivity could use in monitoring thrombin levels in patients. The SERS biosensor developed in this work exhibits a very low Limit of detection, which due to the following reason: the amplification of
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
429
Fig. 4. SERS spectra for 10 15, 10 14, 10 13, 10 12, 10 11, 10 10, and 10 9 M target thrombin (from a to g) with dual signal amplification and (B) linear calibration of SERS intensity vs logarithm of thrombin concentration.
DNAzyme and the RCA process, which increased the number of Raman dyes on the surface of MB modified glass slide. To check the selectivity of our SERS-based assay platform, we also tested the response of negative control samples with aptamer-conjugated nanoprobes. Three proteins (BSA, IgG and fibrinogen) were selected as negative control targets on the basis of previous reports for the aptamer-based thrombin assay ( Fig. 5). It was found that the presence of the interferences did not show any significant responses compared with the blank. Moreover, the presence of high concentration of interfering components (0.1 μM BSA and 0.1 μM IgG) also did not interfere with the assay for thrombin (1.0 pM). These results clearly demonstrated the high specificity of the proposed assay for thrombin detection. To examine the reproducibility, ten equally proposed aptasensors incubated with the same concentration thrombin (10 pM) were used. All the glass slides displayed the similar SERS responses. Also, a relative standard deviation (RSD) of 5.1% was obtained, indicating acceptable reproducibility of the aptasensor. Additionally, the stability of the proposed aptasensor was evaluated long-term storage assay. After 10 days storage at 4 °C, the aptasensor retained 93.8% of initial signal. And, over 86.8% of initial response remained after storage of 30 days. The results suggested the apatasensor could be used for protein analysis with acceptable stability.
Fig. 5. The selectivity of the aptasensor examined by being incubated in the following samples under the same experimental conditions: (a) blank; (b) 1.0 pM BSA; (c) 1.0 pM IgG; (d) 1.0 pM fibrinogen; (e) 1.0 pM thrombinþ0.1 μM BSA; (f) 1.0 pM thrombinþ0.1 μM IgG; and (g) 1.0 pM thrombin.
Table 2 Determination of thrombin added in human blood serum (n¼5) with the proposed aptasensor. Serum samples
Concentration of thrombin added
Concentration obtained with aptasensor
RSD (%) Recovery (%)
1 2
1 nM 10 pM
0.98 nM 10.53 pM
4.7 6.6
98.1 105.3
3.6. Analysis of thrombin in human serum To further assess its biomedical and diagnostic applications, our SERS detector was investigated for detecting thrombin in human serum samples. According to the standard addition method, a series of different concentration of thrombin were added into human serum samples obtained from the affiliated hospital of Xuzhou medical college. The data are given in Table 2. At the concentration of 10 11 and 10 9 M, the recovery was 98.1% and 105.3% and the RSD was ranging from 4.7% to 6.6%. Our method demonstrated the potential of the method for application in complex matrix and future biomarker development.
4. Conclusions In summary, we have demonstrated the construction of a universal and sensitive SERS aptasensor for detection of thrombin based on DNAzyme assistant DNA recycling and rolling circle amplification. On the basis of dual signal amplification strategy, the prepared aptasensors exhibited high response sensitivity, a low detection limit, and a wide linear range to thrombin. Firstly, a large quantity of single strand capture probes could be obtained via DNAzyme-catalyzed DNA recycling, which provides sufficient primers for the following RCA. Secondly, plenty of Ag NPs reporters would be immobilized onto the electrode surface via the interaction between of Ag NPs reporters and the long amplified RCA product which contained hundreds of tandem-repeat sequences, resulting in amplified SERS response of Raman dyes. Besides the high reproducibility and stability of sensing platform, the special selectivity and simple regeneration of the sensing system were illustrated. Compared to standard laboratory analysis techniques (conventional microplate-based enzyme-linked immunosorbent assay) (Funano et al., 2013), this method do not need such long incubation time of 180 min for enzyme-linked reaction.
430
F. Gao et al. / Biosensors and Bioelectronics 66 (2015) 423–430
In addition, it is indeed not a quick enough time to result to deploy in the field, and efforts are currently being made to shorten the time in our lab. In view of these advantages, the proposed aptasensor showed a promising way in clinic application and other protein monitoring.
Acknowledgment The authors gratefully acknowledge the financial support of the National Natural Science Foundation of China (21405130) and Excellent Talents of Xuzhou Medical College (D2014007).
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.12.006.
References Baker, B.R., Lai, R.Y., Wood, M.S., Doctor, E.H., Heeger, A.J., Plaxco, K.W., 2006. J. Am. Chem. Soc. 128, 3138–3139. Bichler, J., Heit, J.A., Owen, W.G., 1996. Thromb. Res. 84, 289–294. Bichler, J., Siebeck, M., Maschler, R., Pelzer, H., Fritz, H., 1991. Blood Coagul. Fibrinolysis 2, 129–133. Breaker, R.R., 2000. Science 290, 2095–2096. Brown, A.K., Li, J., Pavot, C.M.B., Lu, Y., 2003. Biochemistry 42, 7152–7161. Chi, C.W., Lao, Y.H., Li, Y.S., Chen, L.C., 2011. Biosens. Bioelectron. 26, 3346–3352. Cho, H., Baker, B.R., Wachsmann-Hogiu, S., Pagba, C.V., Laurence, T.A., Lane, S.M., Lee, L.P., Tok, J.B.H., 2008. Nano Lett. 8, 4386–4390. Funano, S., Henares, T.G., Kurata, M., Sueyoshi, K., Endo, T., Hisamoto, H., 2013. Anal. Biochem. 440, 137–141. Gao, T., Ning, L.M., Li, C., Wang, H.Y., Li, G.X., 2013. Anal. Chim. Acta 788, 171–176. He, P., Shen, L., Cao, Y., Li, D., 2007. Anal. Chem. 79, 8024–8029. He, P., Zhang, Y., Liu, L.J., Qiao, W.P., Zhang, S.S., 2013. Chem. Eur. J. 19, 7452–7460. Holland, C.A., Henry, A.T., Whinna, H.C., Church, F.C., 2000. FEBS Lett. 484, 87–91. Huang, D.W., Niu, C.G., Qin, P.Z., Ruan, M., Zeng, G.M., 2010. Talanta 83, 185–189. Huang, C.C., Huang, Y.F., Cao, Z., Tan, W., Chang, H.T., 2005. Anal. Chem. 77, 5735–5741. Huang, H.P., Zhu, J.J., 2009. Biosens. Bioelectron. 25, 927–930. Hu, J., Zheng, P.C., Jiang, J.H., Shen, G.L., Yu, R.Q., Liu, G.K., 2008. Anal. Chem. 81, 87–93. Hu, J., Zhang, C.Y., 2010. Anal. Chem. 82, 8991–8997. Kim, N.H., Lee, S.J., Moskovits, M., 2010. Nano Lett. 10, 4181–4185. Lee, P.C., Meisel, D., 1982. J. Phys. Chem. 86, 3391–3395. Li, B.L., Wang, Y.L., Wei, H., Dong, S.J., 2008. Biosens. Bioelectron. 23, 965–970. Li, J.S., Deng, T., Chu, X., Yang, R.H., Jiang, J.H., Shen, G.L., Yu, R.Q., 2010. Anal. Chem. 82, 2811–2816. Li, J., Fu, H.E., Wu, L.J., Zheng, A.X., Chen, G.N., Yang, H.H., 2012a. Anal. Chem. 84,
5309–5315. Li, Y.F., Liu, L.L., Fang, X.L., Bao, J.C., Han, M., Dai, Z.H., 2012b. Electrochim. Acta 65, 1–6. Li, Y., Lei, C.C., Zeng, Y., Ji, X.T., Zhang, S.S., 2012c. Chem. Commun. 48, 10892–10894. Li, M., Zhang, J.M., Suri, S., Sooter, L.J., Ma, D.L., Wu, N.Q., 2012d. Anal. Chem. 84, 2837–2842. Li, J., Li, W., Qiang, W.B., Wang, X., Li, H., Xu, D.K., 2014. Anal. Chim. Acta 807, 120–125. Lin, C., Katilius, E., Liu, Y., Zhang, J., Yan, H., 2006. Angew. Chem. Int. Ed. 45, 5296–5301. Liu, J.W., Cao, Z.H., Lu, Y., 2009. Chem. Rev. 109, 1948–1998. Liu, S.F., Ming, J.J., Lin, Y., Wang, C.F., Cheng, C.B., Liu, T., Wang, L., 2014a. Biosens. Bioelectron. 55, 225–230. Liu, X.T., Xue, Q.W., Ding, Y.S., Zhu, J., Wang, L., Jiang, W., 2014b. Analyst 139, 2884–2889. Lu, C.H., Wang, F., Willner, I., 2012. J. Am. Chem. Soc. 134, 10651–10658. Peng, K.F., Zhao, H.W., Yuan, Y.L., Yuan, R., Wu, X.F., 2014. Biosens. Bioelectron. 55, 366–371. Prasad, B.L.V., Arumugam, S.K., Bala, T., Sastry, M., 2005. Langmuir 21, 822–826. Qian, R.C., Ding, L., Yan, L.W., Lin, M.F., Ju, H.X., 2014. J. Am. Chem. Soc. 136, 8205–8208. Qiu, L.P., Wu, Z.S., Shen, G.L., Yu, R.Q., 2011. Anal. Chem. 83, 3050–3057. Su, S., Fan, J.W., Xue, B., Yuwen, L.H., Liu, X.F., Pan, D., Fan, C.H., Wang, L.H., 2014. ACS Appl. Mater. Interfaces 6, 1152–1157. Sun, A.L., Qi, Q.G., Wang, X.N., Bie, P., 2014. Biosens. Bioelectron. 57, 16–21. Shuman, M.A., Majerus, P.W., 1976. J. Clin. Investig. 58, 1249–1258. Wang, Y.L., Li, D., Ren, W., Liu, Z.J., Dong, S.J., Wang, E.K., 2008. Chem. Commun. 22, 2520–2522. Wang, X.L., Li, F., Su, Y.H., Sun, X., Li, X.B., Schluesener, H.J., Tang, F., Xu, S.Q., 2004. Anal. Chem. 76, 5605–5610. Wang, J.L., Munir, A., Zhu, Z.Z., Zhou, H.S., 2010. Anal. Chem. 82, 6782–6789. Wang, J., Meng, W.Y., Zhou, X.F., Liu, S.L., Li, G.X., 2009. Biosens. Bioelectron. 24, 1598–1602. Wang, J., Shan, Y., Zhao, W.W., Xu, J.J., Chen, H.Y., 2011a. Anal. Chem. 83, 4004–4011. Wang, F., Elbaz, J., Orbach, R., Magen, N., Willner, I., 2011b. J. Am. Chem. Soc. 133, 17149–17151. Xue, L.Y., Zhou, X.M., Xing, D., 2010. Chem. Commun. 46, 7373–7375. Xue, L.Y., Zhou, X.M., Xing, D., 2012. Anal. Chem. 84, 3507–3513. Xiao, Y., Arica, A.L., Alan, J.H., Kevin, W.P., 2005. Angew. Chem. Int. Ed. 44, 5456–5459. Ye, S.J., Guo, Y.Y., Xiao, J., Zhang, S.S., 2013. Chem. Commun. 49, 3643–3645. Yoon, J., Choi, N., Ko, J., Kim, K., Lee, S., Choo, J., 2013. Biosens. Bioelectron. 47, 62–67. Zhang, S.B., Wu, Z.S., Shen, G.L., Yu, R.Q., 2009a. Biosens. Bioelectron. 24, 3201–3207. Zhang, X.R., Qi, B.P., Li, Y., Zhang, S.S., 2009b. Biosens. Bioelectron. 25, 259–262. Zhang, C.L., Yan, J., Liu, C., Ji, X.H., He, Z.K., 2014. ACS Appl. Mater. Interfaces 6, 3189–3194. Zhao, J., Chen, G.F., Zhu, L., Li, G.X., 2011. Electrochem. Commun. 13, 31–33. Zheng, A.X., Wang, J.R., Li, J., Song, X.R., Chen, G.N., Yang, H.H., 2012. Chem. Commun. 48, 374–376. Zheng, J., Hu, Y.P., Bai, J.H., Ma, C., Li, J.S., Li, Y.H., Shi, M.L., Tan, W.H., Yang, R.H., 2014. Anal. Chem. 86, 2205–2212. Zong, C., Wu, J., Xu, J., Ju, H.X., Yan, F., 2013. Biosens. Bioelectron. 43, 372–378. Zhu, H., Klemic, J.F., Chang, S., Bertone, P., Casamayor, A., Klemic, K.G., Smith, D., Gerstein, M., Reed, M.A., Snyder, M., 2000. Nat. Genet. 26, 283–289.
