Vol. 66, No. 8
JOURNAL OF VIROLOGY, Aug. 1992, p. 4686-4692
0022-538X/92/084686-07$02.00/0
Copyright X) 1992, American Society for Microbiology
A Block in Full-Length Transcript Maturation in Cells Nonpermissive for B19 Parvovirus JOHNSON M. LIU, SPENCER W. GREEN, TAKASHI SHIMADA,t AND NEAL S. YOUNG*
Clinical Hematology Branch, National Heart, Lung, and Blood Institute, Building 10, Room 7C103, Bethesda, Maryland 20892 Received 14 January 1992/Accepted 25 April 1992
Vertebrate parvoviruses share a similar genomic organization, with the capsid proteins encoded by genes on the right side and nonstructural proteins encoded by genes on the left side. The temporal and cell-specific appearances of these two types of gene products are regulated by a variety of genetic mechanisms. Rodent parvovirus structural proteins, for example, are encoded by a separate promoter which is positively regulated by nonstructural-gene products. In contrast, for the human B19 parvovirus, the analogous structural-gene promoter is nonfunctional, and both left- and right-side transcripts originate from a single promoter and are highly processed. Using a combination of sensitive RNA analyses of wild-type and mutant templates, we have found that the relative abundance of these alternatively processed transcripts appears to be governed by unique postinitiation events. In permissive cells, the steady-state level of right-side structural-gene transcripts predominates over that of left-side nonstructural-gene transcripts. In nonpermissive cells transfected with the B19 virus genome, nonstructural-gene transcripts predominate. Removal of 3' processing signals located in the middle of the viral genome increases transcription of the far right side. Disruption of a polyadenylation signal in this region makes readthrough of full-length right-side transcripts possible. These results suggest that the abundance of B19 virus RNAs is determined by active 3' processing and is coupled to DNA template replication. Parvoviruses are small, nonenveloped viruses with singlestranded linear DNA genomes (6). The family Parvovindae includes many common agents of disease in animals. In humans, B19 parvovirus is the causative agent of anemia and bone marrow failure in patients with underlying hemolysis or immunodeficiency (34). The pathogenicity of B19 parvovirus reflects its extreme tropism for erythroid progenitor cells. B19 virus can be propagated only in vitro in erythropoietindependent primary cultures from bone marrow (22) or fetal liver (33) and in erythropoietin-dependent leukemic cell lines (26). The virus is a potent inhibitor of erythroid colony formation (34) and is directly cytotoxic to late erythroid progenitors (30). The extraordinary cell specificity of B19 parvovirus is unexplained but could be due to specific receptor binding, nuclear translocation, or intranuclear events. For the autonomous parvovirus minute virus of mice, target cell specificity is mediated by intracellular factors (27). By analogy, we have focused on cis-acting genetic influences, particularly because the unusual B19 virus transcriptional pattern has suggested a potential strategy for specific regulation. Despite their simple organization, parvovirus genes are controlled by complex mechanisms. In other animal parvoviruses, expression of right-sided structural proteins is regulated by transactivation of a second, middle promoter by left-sided nonstructural (NS) proteins (5). In contrast, we have found that the analogous middle B19 virus promoters near map unit 44 do not drive reporter expression after transfection into semipermissive cells, even when cotransfected with the NS gene (13). All B19 virus transcripts originate from a single, strong, left-sided promoter at map unit 6 (termed P6) (14). The right-sided structural genes (VP1
and VP2) are driven through short leader sequences with subsequent splicing of large introns; left-sided NS genes, either spliced or unspliced, terminate in the middle of the genome (Fig. 1) (20). The use of a single promoter, failure of all transcripts to coterminate at the far right side, use of unusual polyadenylation signals, and multiple large introns are all features that set B19 virus apart from other Parvoviridae. We propose here that differential transcript accumulation might be controlled not at the level of promoter initiation but by RNA processing events or by recognition of variant termination signals. Furthermore, we suggest that permissivity determines this transcriptional program.
MATERIALS AND METHODS Construction of plasmids. Recombinant DNA molecules constructed by standard methods (15). MID and END probes for RNase protection assays (Fig. 1A) were constructed by insertion of sequences from the cloned B19 virus genome, pYT103c (19, 25), into pGEM-3Zf(-) vectors (Promega): HindIII (nucleotide [nt] 2430) to HincIl (nt 2879) and PvuII (nt 4397) to EcoRI (nt 5107), respectively. Numbering corresponds to the sequence by Shade et al. (25). For characterization of 3' processing signals in the middle and at the end of the B19 virus genome, these two fragments were subcloned into pUC8X (13) (Fig. 4). A reporter construct lacking polyadenylation signals was made by linking an NcoI-to-BamHI fragment excised from the human ,-globin gene to the B19 virus P6 promoter. Expression plasmids were then constructed by placing the B19 virus P6-driven P-globin gene fragment upstream from either the middle or the end 3' processing signals. Alternatively, a herpes simplex virus thymidine kinase promoter-driven neomycin resistance gene lacking polyadenylation signals (pMC1 Neo; Stratagene) was inserted as an XhoI-BamHI fragment upstream from either the middle or the end 3' processing signals. Probes for RNase protection assays were generated were
* Corresponding author. t Present address: Department of Biochemistry, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo 113, Japan.
4686
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING
by excising AccI-EcoRI fragments from the P-globin-B19 virus 3' processing plasmids and inserting these fragments into pGEM-3Zf(-) vectors. Recombinant sequences from the RNase protection probes and the expression plasmids were partially sequenced by the chain termination method to confirm accurate construction and orientation. The base vector pLTN-1 contains the simian virus 40 (SV40) origin of replication as well as SV40 enhancer sequences within pBR322 (11). B19 virus pYT103c sequences from SmaI (nt 2071) to EcoRI (nt 5107), which are driven by the B19 virus P6 promoter from AatII (nt 102) to XbaI (nt 477), were inserted between the AatII and EcoRI sites of pLTN-1 to create pCP97 (shown schematically in Fig. 1B). Plasmid 103-SN was made by removing the region from SmaI (nt 2071) to NcoI (nt 3380) of pYT103c and religating. Strategy for site-specific mutagenesis. Mutagenesis of the polyadenylation signals in the middle and at the end of the B19 virus genome was accomplished by using the polymerase chain reaction (PCR) (10). For mutating either signal, sense and antisense oligonucleotides were synthesized (Applied Biosystems model 380B DNA synthesizer) and termed p-mut and n-mut. Each oligonucleotide was 41 nt long and more than 90% homologous to the region of wild-type DNA targeted for mutation. Within p-mut and n-mut, there was a 3-nt mutation of the polyadenylation signal. Oligonucleotide p-mut was matched with a downstream antisense primer, n, while n-mut was matched with an upstream sense primer, p. PCR (Perkin Elmer Cetus DNA Thermal Cycler) was run for 30 cycles at 94, 55, and 72°C with Vent polymerase (Bethesda Research Laboratories). The products from the first rounds of PCR (see above) were combined again with p and n primers, and PCR was repeated. The final products, approximately 1,300 bp long, were purified by agarose gel electrophoresis, cut with restriction enzymes, and subcloned into pYT103c to generate plasmids MPA-1 and MPA-2. MPA-3 was constructed in the same manner except that the introduced mutation was a 12-nt BamHI recognition sequence. The introduced mutation and some of the adjacent wild-type B19 virus nucleotides of each plasmid were sequenced by the chain termination method prior to use. Cell culture, DNA transfection, and virus propagation. HeLa and COS cells were grown in improved minimal essential medium (Biofluids) supplemented with gentamicin and 10% fetal bovine serum. Adherent cells (106/100-mmdiameter dish) were transfected by coprecipitation with CaPO4 (32). B19 parvovirus (Minor II serum; 60 ,ug of B19 virus DNA per ml) was propagated in suspension cultures of human erythroid bone marrow cells obtained after informed consent from patients with sickle cell disease (21). Infections were routinely monitored by morphology of cytospin preparations to detect characteristic giant pronormoblasts, the cytopathic marker of active B19 virus replication. RNA analysis. RNA isolation, Northern (RNA) analysis, and RNase protection assays were performed as previously described (9). RNase protection assays were repeated, with identical results, at least twice for HeLa cell and bone marrow RNAs from in vitro-infected cell cultures for two patients with sickle cell anemia.
the B19 virus genome also can be transcribed and translated after transfection into nonpermissive HeLa or COS cells (3, 19). The abundance of viral transcripts derived from infected permissive cells differs strikingly from that derived from nonpermissive cells transfected with the viral genome. In Fig. 1, Northern analysis of total cellular RNA from infected bone marrow cells using a full-length genomic probe shows that the viral structural-gene transcript VP2 predominated over the NS transcript. Smaller spliced mRNAs of 0.8 and 0.65 kb, which apparently have translation potential (29), were also abundant. In contrast, in HeLa or COS cells transfected with pYT103c, the 2.3-kb left-sided NS transcript predominated over the right-sided VP1 transcript and was even slightly more abundant than the VP2 transcript. The smaller spliced species of 0.8 and 0.65 kb were similarly abundant, as in bone marrow cells. These findings suggested a difference in viral transcription patterns in permissive and nonpermissive cells. To directly compare the relative abundance of NS and VP1 mRNA species in a single reaction mixture, we designed a probe for RNase protection assays which spanned the polyadenylation signal and cleavage site of the NS transcripts located in the middle of the genome. The probe (labeled MID in Fig. 1A) was 3' to the four potential splice donor sites (nt 2177 to 2195) from the middle exon and 5' to the splice acceptor sites from the third exon of the VP2 transcripts. Spliced and unspliced NS transcripts would be expected to undergo cleavage and poly(A) addition approximately 15 nt downstream from the variant polyadenylation signal ATTAAA (nt 2639) or AATAAC (nt 2645), yielding a protected fragment of approximately 229 nt. (Sequencing of cloned cDNA from B19 virus-infected leukemic cells has not only confirmed that the middle polyadenylation signal is functional but has also determined that the mRNA species terminate in the middle of the genome at nt 2659 [29].) The readthrough fragment of 449 nt would detect the 3.15- and 3.03-kb VP1 transcripts. As shown in Fig. 2, abundant NS transcripts were detected from RNAs of transfected HeLa cells. In contrast, VP1 transcripts predominated over NS transcripts from RNAs of infected bone marrow cells. These results confirmed that NS transcripts were more abundant than VP1 and VP2 transcripts in nonpermissive cells but that VP1 and VP2 transcripts were more abundant in permissive cells. With the pattern of NS transcripts terminating in the middle of the B19 genome, we hypothesized a block in transcriptional processing as explanation for our findings. Coordinate regulation of transcript maturation and template replication. Could the differential abundance of VP1 and NS transcripts be a transfection artifact? To test whether template replication influenced transcript processing, we constructed plasmid pCP97, linking part of the B19 virus genome with the SV40 viral origin of replication (Fig. 1B). In COS cells, these circular DNAs contain the functional SV40 replicon and should be replicated to a high copy number (17). After transfection into COS cells, total cellular RNA was isolated and analyzed by RNase protection with probes which spanned either the middle or the end 3' processing region (Fig. 3). As shown in Fig. 3A, significant readthrough (449-nt transcript) from the middle 3' polyadenylation signal occurred; abundant spliced transcripts of 306 nt were detected by the end 3' processing probe. In contrast, RNAs from HeLa cells (lacking the SV40 T antigen) transfected with pCP97 or from COS cells transfected with pYT103c (lacking the SV40 replication origin) showed almost no readthrough transcription (Fig. 3B). These results imply that readthrough was not specific either to the plasmid
RESULTS AND DISCUSSION Differential B19 virus transcript accumulation in bone marrow and nonpermissive cells. The transcription map of B19 parvovirus was previously determined by analysis of RNA from infected human bone marrow cells (Fig. 1A) (20). Although B19 virus infects only erythroid progenitor cells,
4687
4688
J. VIROL.
LIU ET AL.
A. (kb)
PROTEINS (kD)
3.1
VP 1 183) 8
2
_
2.3
NS (78)
I'
VP 2 (58)
I
2.2-2.3
o
E 0
C
C
L)
r
o
o
cu
I
(kb)
- 3.1----VP1 =- 2.3 ---- NS y2_ - 2 2-VP2
I
0
s.~~~
w
0.7-0.8
-
0 65
-0.3
O11)
0.5-0.6 Hd
P
Hc
I
R END
MID
B.
S P-9-FIG. 1. Transcription pattern of B19 parvovirus
R
pCP97
in permissive and nonpermissive cells. (A) Sizes of transcripts are in kilobases; known encoded proteins are indicated with molecular sizes in kilodaltons. Positions of MID and END probes for RNase protection assays are shown schematically. Restriction enzyme sites for probes: Hd, HindIII; Hc, HincII; P, PvuII; R, EcoRI. (B) Schematic depiction of plasmid pCP97. The black box represents the P6 promoter; the open box represents B19 virus DNA sequences from SmaI (S) to EcoRI (R). At right, Northern analysis compares RNAs from infected bone marrow cells with RNAs from HeLa or COS cells transfected with pYT103c.
or to COS cells but was dependent on plasmid amplification. DNase I digestion of RNAs from transfected COS cells confirmed very little plasmid DNA contamination of RNA used for protection assays (Fig. 3C). We concluded that full-length transcript maturation was dependent on either template replication or viral replication.
construct pCP97
2 E
62252 7-
I
a °
0
bone
404-
1
2
3
marrow
HeLa 309-
242
238-
bone marrow HeLa
Hind III (2430)
I
.
POLY A
Hinc 11 (28791
449 229
FIG. 2. Differential transcript accumulation in bone marrow and nonpermissive cells. RNase protection assays directly compared the relative abundance of NS and VP1 mRNA species from infected bone marrow cells and transfected HeLa cells. Molecular size standards are shown to the left in kilobases. The right panel depicts the relative densitometric intensities of autoradiographic bands. The schema for RNase protection probe and the predicted transcript sizes are shown in bottom panel.
Cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome. One mechanism which might account for various amounts of processed transcripts is the selective use of poly(A) sites in the middle or at the end of the B19 virus genome. Studies on the selective use of poly(A) sites in the 3' long terminal repeat of human immunodeficiency virus demonstrate that the site is inactive or occluded when positioned adjacent to an active promoter such as the homologous human immunodeficiency virus promoter (31). Could the poly(A) signal at the far right end of the B19 virus genome be inactive in HeLa cells, leading to abundant NS transcripts? How efficient are B19 virus 3' processing signals when linked to heterologous promoter elements, and what influence do B19 virus sequences have on the activity of these signals? To characterize the activity of B19 virus cleavage and polyadenylation signals in isolation, we constructed expression plasmids linking the middle or end 3' processing regions to fragments of the neomycin resistance gene driven by the herpes simplex virus thymidine kinase promoter or of the 1-globin gene driven by the B19 virus P6 promoter (Fig. 4). Figure 5 shows the results of RNase protection assays of RNAs from HeLa cells transfected with the TK-neo-B19 virus (panel A) or the P-globin-B19 virus (panel B) 3' processing plasmid. For either the TK-neo or the ,B-globin reporter, plasmids bearing the middle or end 3' processing signal were cotransfected. Polyadenylation of the heterologous TK-neo-MID transcript should yield a protected fragment of 229 nt with a readthrough fragment of 449 nt, whereas the TK-neo-END transcript should yield a 613-nt fragment (panel A), assuming polyadenylation at approximately nt 5010 as suggested by sequencing of cloned cDNA from infected leukemic cells (29). Polyadenylation of the 1-globin-MID transcript should yield a protected fragment
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING Hind III (2430)
00
-z
A
rL
J
a)
O
D
X-
uu CL CL
A
° c.n
B
4689
Hinc II (2879) MID
TK-NEO
o
'J >
A TCTTTAAAACCTAAATCCPOLY
622527-
TCGTATT^AAAAACCTT^AAAAACTCTCCAGACTTATATAGTCATCATTTT
622527404 -
404 -
Pvu 11
EcoR
(4397)
309309-
C
242 238
I
(5107) END
/
= a
POLY A
242 238
GAAAAATAAACATTTGTTGTGGTTAAAAAATTATGTTGTTGCGCTTTAAAAA
Hind III (2430)
POLY A
Hinc II
1
(2879)
MID
449 229 SA
Pvu 11
(4397) I
POLY A
1
EcoR
15107)
END
306
FIG. 4. Plasmids used in the analysis of 3' processing in the middle and at the end of the B19 virus genome. A middle or end poly(A) signal was placed downstream from either a herpes simplex virus thymidine kinase promoter-driven neomycin resistance gene fragment or a B19 virus P6 promoter-driven human ,-globin gene fragment. Variant TAA sequences are underlined.
z
a c
2X
L.)
FIG. 3. Coordinate regulation of transcript maturation and template replication. Shown are results of RNase protection assays of transfected plasmids pCP97 (described in the text) and pYT103c. Probes spanned either the middle or end 3' processing region. (A) RNAs from COS cells transfected with pCP97 were analyzed with either the MID or the END probe. Molecular sizes are given to the left in kilobases. (B) The MID probe was used to analyze RNAs from HeLa cells transfected with pCP97 or from COS cells transfected with (C) RNAs from transfected COS cells were treated with RQ1 RNase-free DNase I (Promega Biotec) prior to MID probe hybridization. Again, note the difference in abundance of 229- and 449-nt protected fragments in HeLa and COS cell RNAs.
p~YT103c.
of 429 nt with a readthrough of 649 nt; the 13-globin-END plasmid should yield an 813-nt fragment and a 306-nt spliced fragment generated by the splice acceptor sites at nt 4702 to 4703 (panel B). We believe that the smaller protected fragment below the 306-nt species was generated by cryptic splicing. As shown in lanes 6 and 7 (Fig. 5B), very little readthrough (beyond 813 nt) occurred from the end 3' polyadenylation signal, thus confirming that readthrough from the middle 3' polyadenylation signal represented authentic 'VP1 transcript. From these experiments, we inferred that (i) cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome are active irrespective of the type of promoter, and (ii) selective accumulation of NS gene transcripts in HeLa cells is not strictly due to inactivity of the conventional polyadenylation signal at the far right end of the genome but may be secondary to preferential activity of the unusual middle polyadenylation signal. To determine whether coexpression of B19 virus NS genes might influence 3' end formation, pYT103c was cotransfected with P3-globin-MID and I0-globin-END plasmids. For comparison, transcripts from pYTl03c alone are shown in lanes 4 and 8 of Fig. 5B. Although the relative ratio of
transcripts was unchanged, cotransfection with pYT103c significantly increased the abundance of total RNAs. This may be due to positive regulation of the P6 promoter by the B19 virus NS protein acting to enhance its own gene transcription (7). As in Fig. 2, RNase protection did not reveal significant readthrough from the middle 3' polyadenylation signal in HeLa cells transfected with pYT103c alone (lanes 4 and 8, Fig. 5B). 3' processing and functional attenuation may account for differential transcript abundance. Examination of the transcription map shown in Fig. 1A suggested two alternative mechanisms to account for differential NS (spliced and unspliced) versus VP1-VP2 transcript abundance. One possibility was that splicing activity is specific to permissive erythroid cells and is inefficient in HeLa cells, leading to abundance of the 2.3-kb unspliced NS transcript. To test this possibility, we constructed plasmid 103-SN, in which the region from SmaI (nt 2071) to NcoI (nt 3380) was deleted, thus removing the middle termination site. In HeLa cells, inefficient splicing would lead to accumulation of a 3.7-kb transcript derived from 103-SN. Instead, Northern analysis of RNA from HeLa cells transfected with 103-SN showed abundant spliced transcripts of approximately 300 to 500 nt (Fig. 6A). We concluded that tissue-specific splicing did not account for the abundance of NS transcripts in HeLa cells. A second possible mechanism for differential transcript abundance was preferential 3' RNA processing in the middle of the genome in HeLa cells. To test whether aberrant processing might account for our findings, we constructed two mutants of pYT103c by using polymerase chain amplification (Fig. 6B). In MPA-1, we altered the polyadenylation signal ATTAAA (nt 2639) to ATTGGG; in MPA-2, we altered the polyadenylation signal AATAAC (nt 2645) to AATGGG. After confirming the mutations by chain termination sequencing, the plasmids were transfected into HeLa cells. Northern analysis of MPA-1 RNAs (Fig. 6B) showed slightly more-abundant transcripts of approximately 3.1 kb when probed with the full-length genome, but it was unclear whether disruption of the signal enabled readthrough of the 2.2- to 2.3-kb VP2 species. To discriminate between the contribution of the 2.3-kb NS and the 2.2- to 2.3-kb VP2 transcripts to the band at 2.3 kb
4690
J. VIROL.
LIU ET AL. A
MID
B
END
END
MID 0
0
+ Xl WLAJLu
+
Z
+
+
+
.(
w w + +k
z
I-
.e.-1
622 527 404 -
I
622
242 238
(2430)
14
*
4 SPLICED
242 238
-
Hind III NEO
C
_
527404309 -
309 -
2 _
-
Hind III
Hinc III
POLY A
(2879)
GLOBIN
-
4I
(243
Hinc 11
POLY A
(2879)
I
449
429
229 Pvu Ii
NE97
EcoR I POLY A (5107) I
Pvu 11 ) GLOBIN (4
SA
POLY A
EcoR I 5107)
613
-__-__-----___306 FIG. 5. Analysis of cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome. Shown are results of RNase protection assays of RNAs from HeLa cells transfected with the TK-neo-B19 virus (A) or P-globin-B19 virus (B) 3' processing plasmids. Probes used for analysis (MID and END) are underlined. Transfected plasmids are indicated by M or E for the middle or end B19 virus 3' processing signal inserted in the construct and by 103 for pYT103c. For either the TK-neo or the 1-globin reporter, plasmids bearing the middle (M) or end (E) 3' processing signal were cotransfected (M + E). In panel B, the open arrowhead points to the readthrough 649-nt fragment; the closed arrowheads point to processed fragments of 429, 813, and 306 nt. tRNA was used as mock control. SA, splice acceptor.
(Fig. 6B), we repeated the Northern analysis with the subgenomic MID probe illustrated in Fig. 1A. Since this probe does not hybridize to either the 2.2- to 2.3-kb VP2 or the 0.5- to 0.6-kb transcript, it should detect only the transcripts terminating in the middle of the genome and the 3.1-kb VP1 species (Fig. 7). As predicted, pYT103c and MPA-2 templates generated abundant transcripts which terminated in the middle of the genome, whereas MPA-1 yielded only small amounts of the 2.3-kb NS species as well as some of the 3.1-kb VP1 species (Fig. 7). MPA-3, a third plasmid which contained a BamHI site (5'-CGCGGATCC GCG-3') in place of the two polyadenylation signals, yielded transcripts similar in size and abundance to those of MPA-1. Rehybridization of the blot shown in Fig. 7 with a full-length genomic probe demonstrated the 2.2- to 2.3-kb VP2 transcripts from MPA-1 and MPA-3 templates (data not shown). We interpreted these data to indicate that disruption of the first polyadenylation signal ATTAAA made readthrough of the 3.1-kb VP1 and the 2.2- to 2.3-kb VP2 processed transcripts possible. Our findings demonstrate a block in full-length transcript maturation in cells which are nonpermissive for B19 parvovirus propagation. Conversely, full-length transcript production is dependent on template replication in vitro or in vivo, suggesting coordinate regulation of RNA and DNA synthesis. Deletion of 3' processing signals from the middle of the viral genome increases transcription of the far right side. Disruption of a polyadenylation signal in this region enables
readthrough of full-length processed transcripts. Taken together, these results suggest that active 3' processing and/or termination of transcription is involved in determining viral gene expression in a replication-dependent manner. Attenuator elements, or cis elements which mediate termination of RNA transcription within genes, have been described in animal virus and rodent parvovirus genomes (4). Attenuators probably impede RNA polymerization because of their stem-loop structures. These elements often are positioned near a promoter and generate prematurely terminated short RNAs. Possibly, functional attenuation could account for our results by analogy to the transcriptional program of adenovirus type 2 (18). During late adenovirus type 2 infection, transcription from the major late promoter terminates mainly at the end of the genome. In contrast, during early infection, the same promoter is utilized, but transcripts terminate in the middle of the genome, yielding L1 transcripts. The 3' ends of L1 RNAs can be configured in stem-loop structures analogous to those of rodent parvoviruses. Conceivably, attenuator signals located near the ends of the B19 virus NS RNAs might play a similar role. Alternatively, the ratio of left- versus right-side B19 virus transcripts may be determined by 3' end processing events such as differential utilization of poly(A) sites, perhaps generating RNAs of various stabilities. These events could be linked to DNA template changes during the course of entry into the permissive cell, nuclear localization, and/or synthesis of viral DNA. While rare, there is precedent for
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING
4691
B
A
(kb) 5.0
-1
0 7
3.1
7-1
7 7--
I1
3.7
7-
71-
7-
7--
I
5
1.8
2.3
2.2-2.3
0.4-0.5
0.7-0.8
0.3-0.4
0.5-0.6
.-L
>a-
(kb)
m
(kb)
2e
-3.1 - -2.3
-0.8
-0.8
-
_.
-
FIG. 6. Northern analysis of RNA from HeLa cells transfected with processing mutants. Schemata are of predicted RNA species from mutant and wild-type plasmids. (A) Analysis of 103-SN (see text); (B) analysis of MPA-1 and MPA-2 mutants (see text).
alternative poly(A) site selection of gene transcripts specific 2, 8, 24). Whatever enzymatic machinery implements this complex program may also act in concert with viral (7) and cellular (14) proteins involved in DNA replication and transactivation of the P6 promoter (Fig. 5B). This model presupposes that the abundance of transcription and processing factors varies between permissive and nonpermissive cells and somehow mediates specificity (16). Predominant expression of the left side of the B19 genome as a result of functional attenuation would result in expresto particular cell types (1,
P6
B= 1ON
I VPI ----n
N
0
JOURNAL OF VIROLOGY, Aug. 1992, p. 4686-4692
0022-538X/92/084686-07$02.00/0
Copyright X) 1992, American Society for Microbiology
A Block in Full-Length Transcript Maturation in Cells Nonpermissive for B19 Parvovirus JOHNSON M. LIU, SPENCER W. GREEN, TAKASHI SHIMADA,t AND NEAL S. YOUNG*
Clinical Hematology Branch, National Heart, Lung, and Blood Institute, Building 10, Room 7C103, Bethesda, Maryland 20892 Received 14 January 1992/Accepted 25 April 1992
Vertebrate parvoviruses share a similar genomic organization, with the capsid proteins encoded by genes on the right side and nonstructural proteins encoded by genes on the left side. The temporal and cell-specific appearances of these two types of gene products are regulated by a variety of genetic mechanisms. Rodent parvovirus structural proteins, for example, are encoded by a separate promoter which is positively regulated by nonstructural-gene products. In contrast, for the human B19 parvovirus, the analogous structural-gene promoter is nonfunctional, and both left- and right-side transcripts originate from a single promoter and are highly processed. Using a combination of sensitive RNA analyses of wild-type and mutant templates, we have found that the relative abundance of these alternatively processed transcripts appears to be governed by unique postinitiation events. In permissive cells, the steady-state level of right-side structural-gene transcripts predominates over that of left-side nonstructural-gene transcripts. In nonpermissive cells transfected with the B19 virus genome, nonstructural-gene transcripts predominate. Removal of 3' processing signals located in the middle of the viral genome increases transcription of the far right side. Disruption of a polyadenylation signal in this region makes readthrough of full-length right-side transcripts possible. These results suggest that the abundance of B19 virus RNAs is determined by active 3' processing and is coupled to DNA template replication. Parvoviruses are small, nonenveloped viruses with singlestranded linear DNA genomes (6). The family Parvovindae includes many common agents of disease in animals. In humans, B19 parvovirus is the causative agent of anemia and bone marrow failure in patients with underlying hemolysis or immunodeficiency (34). The pathogenicity of B19 parvovirus reflects its extreme tropism for erythroid progenitor cells. B19 virus can be propagated only in vitro in erythropoietindependent primary cultures from bone marrow (22) or fetal liver (33) and in erythropoietin-dependent leukemic cell lines (26). The virus is a potent inhibitor of erythroid colony formation (34) and is directly cytotoxic to late erythroid progenitors (30). The extraordinary cell specificity of B19 parvovirus is unexplained but could be due to specific receptor binding, nuclear translocation, or intranuclear events. For the autonomous parvovirus minute virus of mice, target cell specificity is mediated by intracellular factors (27). By analogy, we have focused on cis-acting genetic influences, particularly because the unusual B19 virus transcriptional pattern has suggested a potential strategy for specific regulation. Despite their simple organization, parvovirus genes are controlled by complex mechanisms. In other animal parvoviruses, expression of right-sided structural proteins is regulated by transactivation of a second, middle promoter by left-sided nonstructural (NS) proteins (5). In contrast, we have found that the analogous middle B19 virus promoters near map unit 44 do not drive reporter expression after transfection into semipermissive cells, even when cotransfected with the NS gene (13). All B19 virus transcripts originate from a single, strong, left-sided promoter at map unit 6 (termed P6) (14). The right-sided structural genes (VP1
and VP2) are driven through short leader sequences with subsequent splicing of large introns; left-sided NS genes, either spliced or unspliced, terminate in the middle of the genome (Fig. 1) (20). The use of a single promoter, failure of all transcripts to coterminate at the far right side, use of unusual polyadenylation signals, and multiple large introns are all features that set B19 virus apart from other Parvoviridae. We propose here that differential transcript accumulation might be controlled not at the level of promoter initiation but by RNA processing events or by recognition of variant termination signals. Furthermore, we suggest that permissivity determines this transcriptional program.
MATERIALS AND METHODS Construction of plasmids. Recombinant DNA molecules constructed by standard methods (15). MID and END probes for RNase protection assays (Fig. 1A) were constructed by insertion of sequences from the cloned B19 virus genome, pYT103c (19, 25), into pGEM-3Zf(-) vectors (Promega): HindIII (nucleotide [nt] 2430) to HincIl (nt 2879) and PvuII (nt 4397) to EcoRI (nt 5107), respectively. Numbering corresponds to the sequence by Shade et al. (25). For characterization of 3' processing signals in the middle and at the end of the B19 virus genome, these two fragments were subcloned into pUC8X (13) (Fig. 4). A reporter construct lacking polyadenylation signals was made by linking an NcoI-to-BamHI fragment excised from the human ,-globin gene to the B19 virus P6 promoter. Expression plasmids were then constructed by placing the B19 virus P6-driven P-globin gene fragment upstream from either the middle or the end 3' processing signals. Alternatively, a herpes simplex virus thymidine kinase promoter-driven neomycin resistance gene lacking polyadenylation signals (pMC1 Neo; Stratagene) was inserted as an XhoI-BamHI fragment upstream from either the middle or the end 3' processing signals. Probes for RNase protection assays were generated were
* Corresponding author. t Present address: Department of Biochemistry, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo 113, Japan.
4686
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING
by excising AccI-EcoRI fragments from the P-globin-B19 virus 3' processing plasmids and inserting these fragments into pGEM-3Zf(-) vectors. Recombinant sequences from the RNase protection probes and the expression plasmids were partially sequenced by the chain termination method to confirm accurate construction and orientation. The base vector pLTN-1 contains the simian virus 40 (SV40) origin of replication as well as SV40 enhancer sequences within pBR322 (11). B19 virus pYT103c sequences from SmaI (nt 2071) to EcoRI (nt 5107), which are driven by the B19 virus P6 promoter from AatII (nt 102) to XbaI (nt 477), were inserted between the AatII and EcoRI sites of pLTN-1 to create pCP97 (shown schematically in Fig. 1B). Plasmid 103-SN was made by removing the region from SmaI (nt 2071) to NcoI (nt 3380) of pYT103c and religating. Strategy for site-specific mutagenesis. Mutagenesis of the polyadenylation signals in the middle and at the end of the B19 virus genome was accomplished by using the polymerase chain reaction (PCR) (10). For mutating either signal, sense and antisense oligonucleotides were synthesized (Applied Biosystems model 380B DNA synthesizer) and termed p-mut and n-mut. Each oligonucleotide was 41 nt long and more than 90% homologous to the region of wild-type DNA targeted for mutation. Within p-mut and n-mut, there was a 3-nt mutation of the polyadenylation signal. Oligonucleotide p-mut was matched with a downstream antisense primer, n, while n-mut was matched with an upstream sense primer, p. PCR (Perkin Elmer Cetus DNA Thermal Cycler) was run for 30 cycles at 94, 55, and 72°C with Vent polymerase (Bethesda Research Laboratories). The products from the first rounds of PCR (see above) were combined again with p and n primers, and PCR was repeated. The final products, approximately 1,300 bp long, were purified by agarose gel electrophoresis, cut with restriction enzymes, and subcloned into pYT103c to generate plasmids MPA-1 and MPA-2. MPA-3 was constructed in the same manner except that the introduced mutation was a 12-nt BamHI recognition sequence. The introduced mutation and some of the adjacent wild-type B19 virus nucleotides of each plasmid were sequenced by the chain termination method prior to use. Cell culture, DNA transfection, and virus propagation. HeLa and COS cells were grown in improved minimal essential medium (Biofluids) supplemented with gentamicin and 10% fetal bovine serum. Adherent cells (106/100-mmdiameter dish) were transfected by coprecipitation with CaPO4 (32). B19 parvovirus (Minor II serum; 60 ,ug of B19 virus DNA per ml) was propagated in suspension cultures of human erythroid bone marrow cells obtained after informed consent from patients with sickle cell disease (21). Infections were routinely monitored by morphology of cytospin preparations to detect characteristic giant pronormoblasts, the cytopathic marker of active B19 virus replication. RNA analysis. RNA isolation, Northern (RNA) analysis, and RNase protection assays were performed as previously described (9). RNase protection assays were repeated, with identical results, at least twice for HeLa cell and bone marrow RNAs from in vitro-infected cell cultures for two patients with sickle cell anemia.
the B19 virus genome also can be transcribed and translated after transfection into nonpermissive HeLa or COS cells (3, 19). The abundance of viral transcripts derived from infected permissive cells differs strikingly from that derived from nonpermissive cells transfected with the viral genome. In Fig. 1, Northern analysis of total cellular RNA from infected bone marrow cells using a full-length genomic probe shows that the viral structural-gene transcript VP2 predominated over the NS transcript. Smaller spliced mRNAs of 0.8 and 0.65 kb, which apparently have translation potential (29), were also abundant. In contrast, in HeLa or COS cells transfected with pYT103c, the 2.3-kb left-sided NS transcript predominated over the right-sided VP1 transcript and was even slightly more abundant than the VP2 transcript. The smaller spliced species of 0.8 and 0.65 kb were similarly abundant, as in bone marrow cells. These findings suggested a difference in viral transcription patterns in permissive and nonpermissive cells. To directly compare the relative abundance of NS and VP1 mRNA species in a single reaction mixture, we designed a probe for RNase protection assays which spanned the polyadenylation signal and cleavage site of the NS transcripts located in the middle of the genome. The probe (labeled MID in Fig. 1A) was 3' to the four potential splice donor sites (nt 2177 to 2195) from the middle exon and 5' to the splice acceptor sites from the third exon of the VP2 transcripts. Spliced and unspliced NS transcripts would be expected to undergo cleavage and poly(A) addition approximately 15 nt downstream from the variant polyadenylation signal ATTAAA (nt 2639) or AATAAC (nt 2645), yielding a protected fragment of approximately 229 nt. (Sequencing of cloned cDNA from B19 virus-infected leukemic cells has not only confirmed that the middle polyadenylation signal is functional but has also determined that the mRNA species terminate in the middle of the genome at nt 2659 [29].) The readthrough fragment of 449 nt would detect the 3.15- and 3.03-kb VP1 transcripts. As shown in Fig. 2, abundant NS transcripts were detected from RNAs of transfected HeLa cells. In contrast, VP1 transcripts predominated over NS transcripts from RNAs of infected bone marrow cells. These results confirmed that NS transcripts were more abundant than VP1 and VP2 transcripts in nonpermissive cells but that VP1 and VP2 transcripts were more abundant in permissive cells. With the pattern of NS transcripts terminating in the middle of the B19 genome, we hypothesized a block in transcriptional processing as explanation for our findings. Coordinate regulation of transcript maturation and template replication. Could the differential abundance of VP1 and NS transcripts be a transfection artifact? To test whether template replication influenced transcript processing, we constructed plasmid pCP97, linking part of the B19 virus genome with the SV40 viral origin of replication (Fig. 1B). In COS cells, these circular DNAs contain the functional SV40 replicon and should be replicated to a high copy number (17). After transfection into COS cells, total cellular RNA was isolated and analyzed by RNase protection with probes which spanned either the middle or the end 3' processing region (Fig. 3). As shown in Fig. 3A, significant readthrough (449-nt transcript) from the middle 3' polyadenylation signal occurred; abundant spliced transcripts of 306 nt were detected by the end 3' processing probe. In contrast, RNAs from HeLa cells (lacking the SV40 T antigen) transfected with pCP97 or from COS cells transfected with pYT103c (lacking the SV40 replication origin) showed almost no readthrough transcription (Fig. 3B). These results imply that readthrough was not specific either to the plasmid
RESULTS AND DISCUSSION Differential B19 virus transcript accumulation in bone marrow and nonpermissive cells. The transcription map of B19 parvovirus was previously determined by analysis of RNA from infected human bone marrow cells (Fig. 1A) (20). Although B19 virus infects only erythroid progenitor cells,
4687
4688
J. VIROL.
LIU ET AL.
A. (kb)
PROTEINS (kD)
3.1
VP 1 183) 8
2
_
2.3
NS (78)
I'
VP 2 (58)
I
2.2-2.3
o
E 0
C
C
L)
r
o
o
cu
I
(kb)
- 3.1----VP1 =- 2.3 ---- NS y2_ - 2 2-VP2
I
0
s.~~~
w
0.7-0.8
-
0 65
-0.3
O11)
0.5-0.6 Hd
P
Hc
I
R END
MID
B.
S P-9-FIG. 1. Transcription pattern of B19 parvovirus
R
pCP97
in permissive and nonpermissive cells. (A) Sizes of transcripts are in kilobases; known encoded proteins are indicated with molecular sizes in kilodaltons. Positions of MID and END probes for RNase protection assays are shown schematically. Restriction enzyme sites for probes: Hd, HindIII; Hc, HincII; P, PvuII; R, EcoRI. (B) Schematic depiction of plasmid pCP97. The black box represents the P6 promoter; the open box represents B19 virus DNA sequences from SmaI (S) to EcoRI (R). At right, Northern analysis compares RNAs from infected bone marrow cells with RNAs from HeLa or COS cells transfected with pYT103c.
or to COS cells but was dependent on plasmid amplification. DNase I digestion of RNAs from transfected COS cells confirmed very little plasmid DNA contamination of RNA used for protection assays (Fig. 3C). We concluded that full-length transcript maturation was dependent on either template replication or viral replication.
construct pCP97
2 E
62252 7-
I
a °
0
bone
404-
1
2
3
marrow
HeLa 309-
242
238-
bone marrow HeLa
Hind III (2430)
I
.
POLY A
Hinc 11 (28791
449 229
FIG. 2. Differential transcript accumulation in bone marrow and nonpermissive cells. RNase protection assays directly compared the relative abundance of NS and VP1 mRNA species from infected bone marrow cells and transfected HeLa cells. Molecular size standards are shown to the left in kilobases. The right panel depicts the relative densitometric intensities of autoradiographic bands. The schema for RNase protection probe and the predicted transcript sizes are shown in bottom panel.
Cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome. One mechanism which might account for various amounts of processed transcripts is the selective use of poly(A) sites in the middle or at the end of the B19 virus genome. Studies on the selective use of poly(A) sites in the 3' long terminal repeat of human immunodeficiency virus demonstrate that the site is inactive or occluded when positioned adjacent to an active promoter such as the homologous human immunodeficiency virus promoter (31). Could the poly(A) signal at the far right end of the B19 virus genome be inactive in HeLa cells, leading to abundant NS transcripts? How efficient are B19 virus 3' processing signals when linked to heterologous promoter elements, and what influence do B19 virus sequences have on the activity of these signals? To characterize the activity of B19 virus cleavage and polyadenylation signals in isolation, we constructed expression plasmids linking the middle or end 3' processing regions to fragments of the neomycin resistance gene driven by the herpes simplex virus thymidine kinase promoter or of the 1-globin gene driven by the B19 virus P6 promoter (Fig. 4). Figure 5 shows the results of RNase protection assays of RNAs from HeLa cells transfected with the TK-neo-B19 virus (panel A) or the P-globin-B19 virus (panel B) 3' processing plasmid. For either the TK-neo or the ,B-globin reporter, plasmids bearing the middle or end 3' processing signal were cotransfected. Polyadenylation of the heterologous TK-neo-MID transcript should yield a protected fragment of 229 nt with a readthrough fragment of 449 nt, whereas the TK-neo-END transcript should yield a 613-nt fragment (panel A), assuming polyadenylation at approximately nt 5010 as suggested by sequencing of cloned cDNA from infected leukemic cells (29). Polyadenylation of the 1-globin-MID transcript should yield a protected fragment
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING Hind III (2430)
00
-z
A
rL
J
a)
O
D
X-
uu CL CL
A
° c.n
B
4689
Hinc II (2879) MID
TK-NEO
o
'J >
A TCTTTAAAACCTAAATCCPOLY
622527-
TCGTATT^AAAAACCTT^AAAAACTCTCCAGACTTATATAGTCATCATTTT
622527404 -
404 -
Pvu 11
EcoR
(4397)
309309-
C
242 238
I
(5107) END
/
= a
POLY A
242 238
GAAAAATAAACATTTGTTGTGGTTAAAAAATTATGTTGTTGCGCTTTAAAAA
Hind III (2430)
POLY A
Hinc II
1
(2879)
MID
449 229 SA
Pvu 11
(4397) I
POLY A
1
EcoR
15107)
END
306
FIG. 4. Plasmids used in the analysis of 3' processing in the middle and at the end of the B19 virus genome. A middle or end poly(A) signal was placed downstream from either a herpes simplex virus thymidine kinase promoter-driven neomycin resistance gene fragment or a B19 virus P6 promoter-driven human ,-globin gene fragment. Variant TAA sequences are underlined.
z
a c
2X
L.)
FIG. 3. Coordinate regulation of transcript maturation and template replication. Shown are results of RNase protection assays of transfected plasmids pCP97 (described in the text) and pYT103c. Probes spanned either the middle or end 3' processing region. (A) RNAs from COS cells transfected with pCP97 were analyzed with either the MID or the END probe. Molecular sizes are given to the left in kilobases. (B) The MID probe was used to analyze RNAs from HeLa cells transfected with pCP97 or from COS cells transfected with (C) RNAs from transfected COS cells were treated with RQ1 RNase-free DNase I (Promega Biotec) prior to MID probe hybridization. Again, note the difference in abundance of 229- and 449-nt protected fragments in HeLa and COS cell RNAs.
p~YT103c.
of 429 nt with a readthrough of 649 nt; the 13-globin-END plasmid should yield an 813-nt fragment and a 306-nt spliced fragment generated by the splice acceptor sites at nt 4702 to 4703 (panel B). We believe that the smaller protected fragment below the 306-nt species was generated by cryptic splicing. As shown in lanes 6 and 7 (Fig. 5B), very little readthrough (beyond 813 nt) occurred from the end 3' polyadenylation signal, thus confirming that readthrough from the middle 3' polyadenylation signal represented authentic 'VP1 transcript. From these experiments, we inferred that (i) cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome are active irrespective of the type of promoter, and (ii) selective accumulation of NS gene transcripts in HeLa cells is not strictly due to inactivity of the conventional polyadenylation signal at the far right end of the genome but may be secondary to preferential activity of the unusual middle polyadenylation signal. To determine whether coexpression of B19 virus NS genes might influence 3' end formation, pYT103c was cotransfected with P3-globin-MID and I0-globin-END plasmids. For comparison, transcripts from pYTl03c alone are shown in lanes 4 and 8 of Fig. 5B. Although the relative ratio of
transcripts was unchanged, cotransfection with pYT103c significantly increased the abundance of total RNAs. This may be due to positive regulation of the P6 promoter by the B19 virus NS protein acting to enhance its own gene transcription (7). As in Fig. 2, RNase protection did not reveal significant readthrough from the middle 3' polyadenylation signal in HeLa cells transfected with pYT103c alone (lanes 4 and 8, Fig. 5B). 3' processing and functional attenuation may account for differential transcript abundance. Examination of the transcription map shown in Fig. 1A suggested two alternative mechanisms to account for differential NS (spliced and unspliced) versus VP1-VP2 transcript abundance. One possibility was that splicing activity is specific to permissive erythroid cells and is inefficient in HeLa cells, leading to abundance of the 2.3-kb unspliced NS transcript. To test this possibility, we constructed plasmid 103-SN, in which the region from SmaI (nt 2071) to NcoI (nt 3380) was deleted, thus removing the middle termination site. In HeLa cells, inefficient splicing would lead to accumulation of a 3.7-kb transcript derived from 103-SN. Instead, Northern analysis of RNA from HeLa cells transfected with 103-SN showed abundant spliced transcripts of approximately 300 to 500 nt (Fig. 6A). We concluded that tissue-specific splicing did not account for the abundance of NS transcripts in HeLa cells. A second possible mechanism for differential transcript abundance was preferential 3' RNA processing in the middle of the genome in HeLa cells. To test whether aberrant processing might account for our findings, we constructed two mutants of pYT103c by using polymerase chain amplification (Fig. 6B). In MPA-1, we altered the polyadenylation signal ATTAAA (nt 2639) to ATTGGG; in MPA-2, we altered the polyadenylation signal AATAAC (nt 2645) to AATGGG. After confirming the mutations by chain termination sequencing, the plasmids were transfected into HeLa cells. Northern analysis of MPA-1 RNAs (Fig. 6B) showed slightly more-abundant transcripts of approximately 3.1 kb when probed with the full-length genome, but it was unclear whether disruption of the signal enabled readthrough of the 2.2- to 2.3-kb VP2 species. To discriminate between the contribution of the 2.3-kb NS and the 2.2- to 2.3-kb VP2 transcripts to the band at 2.3 kb
4690
J. VIROL.
LIU ET AL. A
MID
B
END
END
MID 0
0
+ Xl WLAJLu
+
Z
+
+
+
.(
w w + +k
z
I-
.e.-1
622 527 404 -
I
622
242 238
(2430)
14
*
4 SPLICED
242 238
-
Hind III NEO
C
_
527404309 -
309 -
2 _
-
Hind III
Hinc III
POLY A
(2879)
GLOBIN
-
4I
(243
Hinc 11
POLY A
(2879)
I
449
429
229 Pvu Ii
NE97
EcoR I POLY A (5107) I
Pvu 11 ) GLOBIN (4
SA
POLY A
EcoR I 5107)
613
-__-__-----___306 FIG. 5. Analysis of cleavage and polyadenylation signals in the middle and at the end of the B19 virus genome. Shown are results of RNase protection assays of RNAs from HeLa cells transfected with the TK-neo-B19 virus (A) or P-globin-B19 virus (B) 3' processing plasmids. Probes used for analysis (MID and END) are underlined. Transfected plasmids are indicated by M or E for the middle or end B19 virus 3' processing signal inserted in the construct and by 103 for pYT103c. For either the TK-neo or the 1-globin reporter, plasmids bearing the middle (M) or end (E) 3' processing signal were cotransfected (M + E). In panel B, the open arrowhead points to the readthrough 649-nt fragment; the closed arrowheads point to processed fragments of 429, 813, and 306 nt. tRNA was used as mock control. SA, splice acceptor.
(Fig. 6B), we repeated the Northern analysis with the subgenomic MID probe illustrated in Fig. 1A. Since this probe does not hybridize to either the 2.2- to 2.3-kb VP2 or the 0.5- to 0.6-kb transcript, it should detect only the transcripts terminating in the middle of the genome and the 3.1-kb VP1 species (Fig. 7). As predicted, pYT103c and MPA-2 templates generated abundant transcripts which terminated in the middle of the genome, whereas MPA-1 yielded only small amounts of the 2.3-kb NS species as well as some of the 3.1-kb VP1 species (Fig. 7). MPA-3, a third plasmid which contained a BamHI site (5'-CGCGGATCC GCG-3') in place of the two polyadenylation signals, yielded transcripts similar in size and abundance to those of MPA-1. Rehybridization of the blot shown in Fig. 7 with a full-length genomic probe demonstrated the 2.2- to 2.3-kb VP2 transcripts from MPA-1 and MPA-3 templates (data not shown). We interpreted these data to indicate that disruption of the first polyadenylation signal ATTAAA made readthrough of the 3.1-kb VP1 and the 2.2- to 2.3-kb VP2 processed transcripts possible. Our findings demonstrate a block in full-length transcript maturation in cells which are nonpermissive for B19 parvovirus propagation. Conversely, full-length transcript production is dependent on template replication in vitro or in vivo, suggesting coordinate regulation of RNA and DNA synthesis. Deletion of 3' processing signals from the middle of the viral genome increases transcription of the far right side. Disruption of a polyadenylation signal in this region enables
readthrough of full-length processed transcripts. Taken together, these results suggest that active 3' processing and/or termination of transcription is involved in determining viral gene expression in a replication-dependent manner. Attenuator elements, or cis elements which mediate termination of RNA transcription within genes, have been described in animal virus and rodent parvovirus genomes (4). Attenuators probably impede RNA polymerization because of their stem-loop structures. These elements often are positioned near a promoter and generate prematurely terminated short RNAs. Possibly, functional attenuation could account for our results by analogy to the transcriptional program of adenovirus type 2 (18). During late adenovirus type 2 infection, transcription from the major late promoter terminates mainly at the end of the genome. In contrast, during early infection, the same promoter is utilized, but transcripts terminate in the middle of the genome, yielding L1 transcripts. The 3' ends of L1 RNAs can be configured in stem-loop structures analogous to those of rodent parvoviruses. Conceivably, attenuator signals located near the ends of the B19 virus NS RNAs might play a similar role. Alternatively, the ratio of left- versus right-side B19 virus transcripts may be determined by 3' end processing events such as differential utilization of poly(A) sites, perhaps generating RNAs of various stabilities. These events could be linked to DNA template changes during the course of entry into the permissive cell, nuclear localization, and/or synthesis of viral DNA. While rare, there is precedent for
VOL. 66, 1992
REGULATED B19 PARVOVIRUS RNA PROCESSING
4691
B
A
(kb) 5.0
-1
0 7
3.1
7-1
7 7--
I1
3.7
7-
71-
7-
7--
I
5
1.8
2.3
2.2-2.3
0.4-0.5
0.7-0.8
0.3-0.4
0.5-0.6
.-L
>a-
(kb)
m
(kb)
2e
-3.1 - -2.3
-0.8
-0.8
-
_.
-
FIG. 6. Northern analysis of RNA from HeLa cells transfected with processing mutants. Schemata are of predicted RNA species from mutant and wild-type plasmids. (A) Analysis of 103-SN (see text); (B) analysis of MPA-1 and MPA-2 mutants (see text).
alternative poly(A) site selection of gene transcripts specific 2, 8, 24). Whatever enzymatic machinery implements this complex program may also act in concert with viral (7) and cellular (14) proteins involved in DNA replication and transactivation of the P6 promoter (Fig. 5B). This model presupposes that the abundance of transcription and processing factors varies between permissive and nonpermissive cells and somehow mediates specificity (16). Predominant expression of the left side of the B19 genome as a result of functional attenuation would result in expresto particular cell types (1,
P6
B= 1ON
I VPI ----n
N
0
