2520 Nucleic Acids Research, Vol. 19, No. 9
A BamHl polymorphism in the human EV12A gene (human homolog of the murine gene Evi-2) W.Xu*, L.Liu and B.A.J.Ponder CRC Human Cancer Genetics Group, Department of Pathology, University of Cambridge, UK
Source and Description: A 648 bp fragment corresponding to nucleotide 1 to 648 of the published cDNA sequence (1) for the human EVI-2 gene was amplified by PCR using 5'- ATGGAACACACAGGACATTACCTA as the forward primer and 5'-TTCCCTTGTAGCTGTGAGCACTCC as the reverse primer. This PCR produced was used as a probe for hybridization of southern blots made from human DNA samples. Polymorphism: BamHI digestion yields two bands of 9.5 kb and 4.0 kb without constant band. Frequency: Studied in a total of 40 unrelated Caucasians (20 males and 20 females). A1 9.5 kb allele: 0.5 A2 4.0 kb allele: 0.5 Not Polymorphic For: BglII, Pvull and Taq-I in 10 unrelated Caucasians. Chromosomal Localization: Assigned to 17ql 1.2 within NFI gene
(2) (3). Mendelian Inheritance: Co-dominant segregation of the BamHI RFLP was observed in three informative von Recklinghausen Neurofibromatosis (NF-1) families (12 meioses). Cosegregation with the NF-l phenotype was observed in all these families. Acknowledgement: This work was supported by LINK, the UK Neurofibromatosis association. References: 1) Cawthon,R.M. et al. (1990) Genomics 7, 555 -565. 2) Wallace,M. et al. (1990) Science 249, 181-186. 3) Viskochil,D. et al. (1990) Cell 62, 187-192.
*
To whom correspondence should be addressed
A BamHl polymorphism in the human EV12A gene (human homolog of the murine gene Evi-2) W.Xu*, L.Liu and B.A.J.Ponder CRC Human Cancer Genetics Group, Department of Pathology, University of Cambridge, UK
Source and Description: A 648 bp fragment corresponding to nucleotide 1 to 648 of the published cDNA sequence (1) for the human EVI-2 gene was amplified by PCR using 5'- ATGGAACACACAGGACATTACCTA as the forward primer and 5'-TTCCCTTGTAGCTGTGAGCACTCC as the reverse primer. This PCR produced was used as a probe for hybridization of southern blots made from human DNA samples. Polymorphism: BamHI digestion yields two bands of 9.5 kb and 4.0 kb without constant band. Frequency: Studied in a total of 40 unrelated Caucasians (20 males and 20 females). A1 9.5 kb allele: 0.5 A2 4.0 kb allele: 0.5 Not Polymorphic For: BglII, Pvull and Taq-I in 10 unrelated Caucasians. Chromosomal Localization: Assigned to 17ql 1.2 within NFI gene
(2) (3). Mendelian Inheritance: Co-dominant segregation of the BamHI RFLP was observed in three informative von Recklinghausen Neurofibromatosis (NF-1) families (12 meioses). Cosegregation with the NF-l phenotype was observed in all these families. Acknowledgement: This work was supported by LINK, the UK Neurofibromatosis association. References: 1) Cawthon,R.M. et al. (1990) Genomics 7, 555 -565. 2) Wallace,M. et al. (1990) Science 249, 181-186. 3) Viskochil,D. et al. (1990) Cell 62, 187-192.
*
To whom correspondence should be addressed
