Appl Microbiol Biotechnol DOI 10.1007/s00253-014-5806-4

APPLIED MICROBIAL AND CELL PHYSIOLOGY

6S RNA modulates growth and antibiotic production in Streptomyces coelicolor Karel Mikulík & Jan Bobek & Jarmila Zídková & Jurgen Felsberg

Received: 6 March 2014 / Revised: 26 April 2014 / Accepted: 29 April 2014 # Springer-Verlag Berlin Heidelberg 2014

Abstract The aim of this study was to contribute to clarifying the role of 6S RNA in the development and control of antibiotic biosynthesis in Streptomyces coelicolor. Due to the low energetic cost of gene silencing via 6S RNA, it is an easy and rapid means of down-regulating the expression of specific genes in response to signals from changes in the environment. The expression of 6S RNA in S. coelicolor is not constitutive, and its accumulation is adapted to changes in nutritional conditions. The 6S RNA of S. coelicolor is capable of interacting with RNA polymerase β β′ subunits and is a template for the transcription of short pRNAs. Deletion of the ssrS gene from S. coelicolor affects the growth rate and causes changes in the expression of several pathway-specific genes involved in actinorhodin biosynthesis. The complementation of the ΔssrS strain with ssrS gene restored the wild-type levels of growth and actinorhodin production. We conclude that 6S RNA contributes to the optimization of cellular adaptation and is an important factor involved in the regulation of growth and expression of key genes for the biosynthesis of actinorhodin.

Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-5806-4) contains supplementary material, which is available to authorized users. K. Mikulík (*) : J. Felsberg Institute of Microbiology, Academy of Sciences of the Czech Republic, Vídeňská 1083 14220, Prague, Czech Republic e-mail: [email protected] J. Bobek Institute of Immunology and Microbiology of the First Faculty of Medicine, Charles University in Prague, Studničkova 7, 12800, Prague, Czech Republic J. Zídková Department of Biochemistry and Microbiology, Institute of Chemical Technology, Prague, Czech Republic

Keywords 6S RNA . Secondary structure . pRNAs . Streptomyces coelicolor . Actinorhodin

Introduction Streptomycetes are soil microorganisms that are exposed to various changes in their natural environment and respond to a specific cascade of adaptive reactions to survive and resume growth in new conditions. During the transition from primary to secondary metabolism, streptomycetes undergo a variety of metabolic changes in response to the depletion of essential nutrients and are able to survive even in the presence of antibiotics they produce. The transition from the exponential to the stationary phase of growth is controlled by regulatory molecules that can alter gene expression to allow the cell to adapt to changes in the environment and nutrition. In Streptomyces coelicolor, 65 genes are predicted to encode sigma factors (Bentley et al. 2002). The sigma factor hrdB gene encodes the principal σ factor, which is essential for growth (Brown et al. 1992) as well as for the expression of pathwayspecific regulatory genes related to actinorhodin and undecylprodigiosin expression (Gramajo et al. 1993; Aigle et al. 2000). The important role of the principal σ factor in the production of various antibiotics has been demonstrated: overexpression of this factor enhances the production of pyoluteorin and 2, 4-diacetylphloroglucinol in Pseudomonas fluorescens (Schnider et al. 1995), and engineering of σhrdB increases the production of avermectin in an industrial strain of Streptomyces avermitilis (Zhuo et al. 2010). Many bacteria survive nutrient limitation and environmental stress by altering the promoter specificity of RNA polymerases. Guanosine tetraphosphate (ppGpp) binds to RNA polymerase and regulates the transcription of target genes involved in the biosynthesis of amino acids and rRNA (Barker et al. 2001), and an increased level of ppGpp induces the production of antibiotics

Appl Microbiol Biotechnol

in S. coelicolor (Bibb 2005; Ochi 2007). The small noncoding 6S RNA of Escherichia coli participates in a transcriptional response by binding to the σ70-containing RNA polymerase holoenzyme (Wassarman and Storz 2000; Trotochaud and Wassarman 2005). Transcriptional analysis has shown that σ70-specific promoters exhibiting an extended −10 motif are susceptible to 6S RNA inhibition, while certain σ38-dependent promoters are activated (Gildehaus et al. 2007; Wassarman 2007; Trotochaud and Wassarman 2004, 2006). Additional observations indicate that promoter elements determine this specificity (Cavanagh et al. 2008). The critical role in RNA polymerase interactions with 6S RNA is played by region 4.2 of σ70, which binds the −35 element during the initiation phase. Studies addressing the characterization of the spatial arrangement of 6S RNA within the three-dimensional structure of RNA polymerase have demonstrated a close proximity between the 6S RNA internal hairpin and σ70 domain 4.2. Defined sections of the internal 6S RNA stem structure flanking the central bubble are positioned near conserved σ70 domains 3.1, 2.3, and 2.1, which are implicated in the binding and melting of DNA promoters between the −10 and −35 elements (Steuten et al. 2013). It was shown that 6S RNA is widespread among various microorganisms and exhibits high conserved structures (Wassarman and Saecker 2006; Beckmann et al. 2012; Cavanagh et al. 2012). Expression profile of 6S RNA in bacteria is not uniform as shown in E. coli, with accumulation during stationary phase of growth (Neusser et al. 2008). Alternative expression characteristics have been observed in cyanobacteria. In Synechococcus, 6S RNA expression is maximal during exponential phase (Watanabe et al. 1997). More complex regulation of expression occurs in Prochorococcus where there are two 6S RNA transcripts probably linked to light and S- and G2-like phases (Axmann et al. 2007). Two differentially expressed forms of 6S RNA with different functions and expression profile, 6S1RNA and 6S-2RNA, have been identified in Bacillus subtilis. 6S-1RNA is an ortholog of E. coli 6S RNA and has a similar expression profile as E. coli in contrast to 6S-2RNA with relative constant levels during cell cycle (Cavanagh et al. 2012; Barrick et al. 2005). 6S-1 RNA was recently shown to be involved in timing of the onset of sporulation (Cavanagh and Wassarman 2013). Two differentially expressed forms of 6S RNA (6S RNA and 6S 2RNA) were identified in Legionella pneumonia. More detailed analysis demonstrated that 6S RNA positively affected the expression of many genes included in stress response and genes encoding type IVB secretion system effectors (Faucher et al. 2010). Knowledge about expression and function of 6S RNA from antibiotic-producing streptomycetes has been limited until recently. Streptomycetes are soil microorganisms exposed to various physical and chemical stresses that activate specialized response including synthesis of antibiotics, hydrolytic enzymes, and/or

morphological differentiation from vegetative cells to aerial mycelium and aerial spores. Many stress conditions can induce the heat or cold shock responses. These observations suggest that there may be multiple cellular targets or sensors that generate the inducing signal. We have shown previously that S. coelicolor possesses a segment of 192 nucleotides in length with a high degree of structural similarity that was computationally identified as streptomycete 6S RNA (Pánek et al. 2008). The base composition of the ssrS gene encoding 6S RNA of streptomycetes differ from that of E. coli ssrS, and searches of GenBank/EMBO data reveal that they share only 16 % base identity. The arrangement of the motifs can serve as structural scaffolding and act in a functionally and topographically equivalent manner despite the sequential differences. We show that of S. coelicolor 6S RNA is capable of interacting with RNA polymerase β β′ subunits, subunit ω, and is a template for the transcription of short pRNAs that destabilize the RNAPσhrdB:6S RNA complex. To establish the potential role of ssrS, we deleted the gene from S. coelicolor M145, and the growth and production of actinorhodin were compared with the parental strain. A deletion mutation of the ssrS gene encoding 6S RNA leads to a specific slowing down of growth and in reduction of actinorhodin production. Changes in antibiotic production are correlated with the transcription of pathway-specific regulatory genes for actinorhodin synthesis.

Materials and methods S. coelicolor M145 (ATCC BAA-471/A2(3) M145) cells were cultivated in 500-ml flasks with 80 ml of NMMP medium (Kieser et al. 2000), at 28 °C, on a rotary shaker run at 145 rpm. A null mutant strain was constructed using ReDirect technology (Gust et al. 2000). Deletion of the scr3559 gene (ΔssrS) was accomplished via gene replacement with an apramycin resistance cassette (apr) in the StH5 cosmid, followed by introduction of the knockout cosmid into wildtype S. coelicolor M145 and selection for a double-crossover recombination event. To complement the scr3559 mutant phenotype, the integrative plasmid pSET82-scr3559 derived from plasmid pSET125 (Bierman et al. 1992) was introduced into scr3559 null mutant strain. This gene is situated between positions 3,934,644 and 3,934,888, oriented downstream of SCO3559 (minus strand). The length of the RNA is 244 nt, its 5′ transcription start site was determined via RACE mapping, and its 3′ end was estimated based on a potential terminal stem loop preceding a U-rich stretch.

Appl Microbiol Biotechnol

Sequencing analysis and in vitro transcription of ssrS The complete ssrS gene was obtained via PCR amplification of S. coelicolor DNA using the upstream primer 5′TAATAC GAGTCATAGGGAGAAGTGCGGCGAGCACTTCCG3′ and the downstream oligonucleotide 5′GTGACCTGGTGC TGGCCCGT3′, derived from the 3′ and 5′ ends of the 6S RNA and the T7 phage promoter. The obtained PCR fragment was cloned into pGEM-T to generate pGEM-6S. The ssrS gene was obtained from the pGEM-6S plasmid following digestion with EcoRI. The fragment was then sequenced with the ABI PRISM BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Warrington, UK). The chain termination reaction was performed through the cycle sequencing technique according to the manufacturer’s protocol. Isolation of RNA polymerase and hrdB A cell-free extract of S. coelicolor M145 was prepared from 24-h cultures using the French press method. The homogenate was extracted with a buffer consisting of 20 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 0.15 M NaCl, 5 mM EDTA, 0.1 mM dithiothreitol (DTT), 1 mM phenylmethane sulphate (PMSF), and 8 % glycerol. The extract was fractionated with polyethylenimine and heparin-Sepharose (Hahn et al. 2003). The hrdB protein was overexpressed in E. coli BL21(DE3) pLysS using the pIJ 2072 plasmid (from M. Buttner) and purified via preparative electrophoresis. The integrity of the protein was confirmed through MS spectrometry. Primer extension analysis of RNAs Primer oligonucleotides for the actII-ORF4 mRNA, 5′AGAA TAGGGCCGATGATTCCG3′, hrdB: 5′AAGGAAGACGGC GAGCTTCT3′, and relA: 5′ACATGTACCAGTCGCTGC AC3′, were used in these analyses. The primers were 5′radiolabeled with T4 polynucleotide kinase and [γ32P] ATP (4,000 Ci/mmol). The primers were incubated in annealing buffer containing 1.25 M KCl, 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA, pH 8.0, with total RNAs (1 μg) isolated from cells collected at 24, 30, 48, 72, and 164 h for 5 min at 80 °C, 30 min at 65 °C, and 30 min at 48 °C. These reactions were then mixed with 23 μl of primer extension buffer consisting of 20 mM Tris-HCl, pH 8.7, 10 mM MgCl2, 0.33 mM each dNTPs, 5 mM DTT, and 15 U of reverse transcriptase, followed by incubation for 1 h at 42 °C. The reactions were terminated with 0.3 ml of cold ethanol and chilled at −80 °C. The mixtures were subsequently centrifuged for 10 min at 4 °C, washed with 70 % ethanol, and air-dried, after which the samples were dissolved in 4 μl of formamide loading buffer, heated for 2 min at 95 °C, and loaded onto a sequencing gel. The dry gel was exposed to phosphorimaging screening and scanned. All RNA samples were analyzed by PCR without

reverse transcriptase to exclude contamination with DNA (“Electronic supplementary material”, Fig. S1). Isolation of 6S RNA The ssrS gene was obtained from the pGEM-6S plasmid following digestion with EcoRI. The in vitro transcription reaction was performed with the Ribo MAX Large-Scale RNA Production System (Promega) with T7 reaction components. After 4 h of incubation at 37 °C, the DNA was hydrolyzed with RQ1 DNase (RNase-free) for 20 min at 37 °C, and 6S RNA was extracted with phenol–chloroform–isoamyl alcohol (25:24:1). The water phase was then re-extracted with chloroform–isoamyl alcohol (24:1) and precipitated in the presence of 0.1 volumes of 3 M CH3COONa using 2.5 vol of ethanol. After 30 min at −20 °C, the mixture was centrifuged at 14,000 ×g for 20 min at 4 °C. The 6S RNA was subsequently washed with 75 % ethanol, and unincorporated nucleotides were removed using nuclease-free NucAway Spin columns (Amicon). Following elution with RNase-free water, the 6S RNA was frozen in small aliquots and stored at −80 °C. The purity of the 6S RNA was examined via electrophoresis in 7 % polyacrylamide–6 M urea gels. The RNA concentration and quality were checked using a NanoDrop ND-1000 (Thermo Fisher Scientific). Isolation of RNA from vegetative cells Cells (0.5 g) collected at different time periods, as indicated in the figures, were mixed with l ml of 10 mM Tris-HCl, pH 8.0, and contained 5 mg of lysozyme. After a 10-min incubation at 37 °C, nucleic acids were extracted with 100 μl 0.5 M EDTA, 100 μl of 10 % SDS, and 1 ml of phenol/chloroform/isoamyl alcohol (125:40:1) at 65 °C for 5 min and vortexed for 3 min at maximum speed. The homogenate was centrifuged at 7,000 ×g for 10 min at 4 °C, and the supernatant was re-extracted three times with phenol/chloroform/isoamyl alcohol. The resulting supernatant was mixed with 0.1 vol. of 3 M CH3COONa, pH 6.0, and an equal volume of isopropanol and then held at −20 °C. The sample was subsequently centrifuged at 10,000 ×g for 10 min at 4 °C. The pellet was washed twice with 70 % ethanol and solubilized in 450 μl of RNase-free water and 50 μl of 10× DNase buffer. The DNA was then digested with 7 units of RQ1RNase-free DNase (Promega) at 37 °C for 1 h, and the sample was extracted three times with phenol/chloroform/isoamyl alcohol (125:24:1) and twice with chloroform. The resulting water phase was precipitated in the presence of CH3COONa with an equal volume of isopropanol. After 1 h at −20 °C, the samples were centrifuged at 14,500 ×g at 4 °C. The supernatant was subsequently removed, and the sediment total RNA was washed twice with cold 70 % ethanol. The dried sediment was solubilized in RNase-free water and stored at −80 °C. The

Appl Microbiol Biotechnol

purity of RNA was analyzed via electrophoresis in 7 % acrylamide–6 M urea gels. Northern blotting Northern blotting was performed to detect 6S RNA via blot hybridization following electrophoresis on polyacrylamideurea denaturing gels. Dig-11-dUTP-labeled DNA probes were generated through PCR amplification (Roche) using genomic DNA as a template. The upstream primer 5′GTGACCTGGT GCGGCTGGCCCGT3′ and downstream primer 5′GAAGTG CGGCGAGCACTTCCG3′ were employed. RNAs were transferred to nylon membranes via semi-dry electroblotting. The blots were then UV-cross-linked and hybridized with the probe overnight at 62 °C. Following incubation in blocking solution, 6S RNA and 5S RNA were detected using an antiDig-alkaline phosphatase conjugate and a colorimetric substrate. The detection reaction was stopped by rinsing the membrane with water. UV cross-linking of proteins to 6S RNA The S. coelicolor RNA polymerase holoenzyme (10 μg) was added to a precooled microtiter plate and mixed with 2 μl of 32 P-labeled 6S RNA (106 cpm). The plates were placed on ice, and a UV lamp (254 nm) was set on top of the microtiter plate. The samples were exposed to UV radiation for 35 min, and the reactions were subsequently transferred to microcentrifugation tubes and incubated with RNaseA (0.1 μg/μl) at 37 °C for 20 min. The samples were then mixed with the SDS loading buffer; heat-denatured, and analyzed in 10 % SDS-polyacrylamide gels. The gels were fixed for 1 h in MeOH–H3PO4–H2O (40:5:55) and stained with Coomassie blue R250. The radioactivity of the gel was monitored using PhosphorImager. Enzymatic in-gel digestion, μLC mass spectrometric analysis, and protein identification Coomassie blue-stained bands were excised from gels, cut into small pieces, and destained using 0.1 M 4ethylmorpholine acetate (pH 8.1) in 50 % acetonitrile (MeCN). The gel pieces were further washed with water, shrunk via dehydration in MeCN, and re-swelled in water. Following removal of the supernatant, the gel was partially dried in a SpeedVac concentrator and then reconstituted in cleavage buffer containing 0.01 % 2-mercaptoethanol, 0.1 M 4-ethyl-morpholine acetate, 10 % MeCN, and sequencinggrade trypsin (20 ng/μl; Promega, Madison, WI, USA). Following digestion overnight at 37 °C, the resulting peptides were extracted twice with 40 % MeCN/0.1 % formic acid (FA), and the extracts were pooled, dried, dissolved in 0.1 % FA, and applied to a microtrap packed with polymeric reverse-

phase material (Michrom BioResources, Auburn, CA, USA). The trapped peptides were washed with 0.1 % FA, eluted with 100 μl of 40 % MeCN/0.1 % FA, and completely dried. The peptides were dissolved in 5 % MeCN/0.5 % acetic acid and loaded onto a column (0.180 × 100 mm) packed with MAGIC C18 (5 μm, 200 A) reverse-phase resin (Michrom BioResources) and separated over a gradient of 5 % MeCN/0.5 % acetic acid to 40 % MeCN/0.5 % acetic acid for 70 min. Co-immunoprecipitation analysis The RNA polymerase holoenzyme was mixed with immunoprecipitation buffer containing 10 mM Tris-Cl, pH 7.5, Nonidet NP 40, 2 mM EDTA, 0.15 M NaCl, and 4 μl of preimmune serum. The mixture was incubated at 4 °C for 1 h. Protein G-agarose (20 μl) was then added, and after 3 h of incubation, the immune complexes were removed via centrifugation. The supernatant solution was mixed with 32P-labeled 6S RNA and incubated for 2 h. Next, antibodies against the RNAP holoenzyme and peptides against the β and β′ subunits were added, and the mixtures were incubated overnight at 4 °C. Protein G-agarose (35 μl) was then added to each mixture, and the incubation was continued for an additional 2 h. The immune complexes were separated via centrifugation and washed twice with IP buffer containing 1 % serum albumin and five times with IP buffer. The final sediments were analyzed in 10 % denaturing polyacrylamide gels, and the radioactivity of the 6S RNA was monitored.

Results Conserved regions of streptomycete 6S RNA The ssrS gene, encoding a 6S RNA-like structure, is localized between SCO3558 and SCO3559 as shown in the following diagram:

The 244 nt transcript is processed from the 5′ end to 192 nt to form a 6S RNA-like secondary structure. The orientation of gene transcription was examined via reverse transcription using specific 3′ and 5′ primers and purified total RNA (Pánek et al. 2008). The DNA PCR amplification product obtained with primers derived from the 3′ and 5′ ends was

Appl Microbiol Biotechnol

sites as in many cases only one chain of the helix is cleaved, while the second chain is not accessible to the enzyme. RNaseT1 cleaves the phosphodiester bonds of singlestranded RNAs at the 3′ position of guanidine nucleotides with a high specificity. RNaseT1 cleavage is intensive at single-stranded loops (A-G). The central bulge contains a relatively large single-stranded region (18 nt) with eight U residues (Fig. 2b). This region is highly conserved in many bacteria and is analogous to the −10 DNA promoter elements. The phylogenetically conserved “−35” region located between structures connecting the G bulge with tetraloop 2 is important for competitive interactions with σhrdB, as suggested for the analogous structures of 6S RNA and σ70 in E. coli (Wassarman and Storz 2000).

ligated into the pGEM-T plasmid and amplified in E. coli to generate pGEM 6S, which carries the complete ssrS gene of S. coelicolor under the control of the T7 phage RNA polymerase promoter. The nucleotide sequences of the ssrS gene of S. coelicolor and another species of streptomycetes were aligned on the basis of structural similarities (Fig. 1). These genomic sequences consist of approximately 181–192 nucleotides and exhibit a high degree of similarity. The variable regions of the genes are localized mostly in the terminal portion in the 150–160 and 180–190-bp regions. The relatively high degree of sequence homology indicates that ssrS is conserved in all of the examined streptomycetes species, and it may therefore play an important role. To find some functionally important secondary structures of the bioinformatic model 6S RNA (Pánek et al. 2011), enzymatic probing was performed using RNaseT1 and RNaseVl. The structure of 5′ region up to 110 nt predicted in bioinformatic model was confirmed by enzymatic probing. It was apparent from the digestion patterns of the 6S RNA molecule (Fig. 2a) that not all of the base-paired nucleotides were cleaved and that there was prevalent variation in the intensity of cleavages within a stem loop. RNaseV1 probing contributes to our understanding of helix formation. In addition, due to the bulkiness of the enzymatic probes, RNaseV1 has the potential to reveal solvent-exposed sites of the RNA molecules. The preference for digestion sites between bulges D-E and D-F and the secondary structure connecting the G bulge with tetraloop 2 might indicate that these regions are more exposed to solvents and therefore accessible to RNaseV1. The secondary structure consists of seven Wobble base pairs and seven A-U/U-A base pairs, most of which are localized at the beginning or end of the internal loops. There is asymmetry in terms of cleavage

To obtain information on the growth-dependent abundance of 6S RNA, total RNA was isolated from the parental strain M145. Samples (10 μg) collected at 24, 48, 72, and 96 h were analyzed using probes specific for 6S RNA and 5S RNA. The results of Northern blotting analysis revealed (Fig. 3a) an increase in 6S RNA expression from the transition (48 h) to the stationary phase of growth. The levels of 5S RNA in the exponential and stationary phases were relatively unchanged. During the transition from the exponential to the stationary phase of growth, many different regulators are involved in altering gene expression to facilitate the adaptation of the cell to changes in the availability of essential nutrients.

Fig. 1 Nucleotide sequences of the ssrS-like genes of several streptomycetes. The ssrS gene of S. coelicolor was aligned to a common primary sequence via direct sequencing, and ssrS genes from S. griseus,

S. avermitilis, and S. cyaneus were obtained from database. The sequences were compared and aligned using the ClustalW ver.2 method (Larkin et al. 2007)

Expression of 6S RNA during growth

Appl Microbiol Biotechnol

Fig. 2 a Structure-specific enzymatic probing of 6S RNA. Probing of in vitro-transcribed 6S RNA was performed at room temperature for 5 min with two RNases: RNase T1 (0.1 U each) and the RNaseVl nuclease (0.01 U). The 5′ end 32P-labeled 6S RNA (106 cpm) was digested in a 9-μl reaction mixture containing 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 0.3 M KCl, 1 mM DTT, and 2 μg tRNA. The reaction was stopped by the addition of inactivation/precipitation buffer (Ambion). Following centrifugation, the pellet was washed with 70 % ethanol, solubilized in RNase-free water, and analyzed in 10 %

polyacrylamide-urea gel. Dephosphorylated φX174DNA/Hinf l was used as a nucleotide marker. b Highly conserved residues in S. coelicolor 6S RNA. Native T1 (filled circle) and V1 RNase (open triangle). Digestion of 5′ 32P-end labeled 6S RNA. Cleavage sites were identified based on comparison with a ladder of bands generated via limited alkaline hydrolysis of 6S RNA (OH) and the position of φ X174 DNA/Hinf I markers. C 6S RNA negative control without RNases. Internal loops are designated loops A–G and hairpin loops 1 and 2

Effect of 6S RNA on growth and the production of actinorhodin

tested on an NMMP agar plate (Fig. 3c). Considerable production of Act was observed in the strain M145 after 36 h of cultivation. In contrast, in the ΔssrS mutant, low Act synthesis was detected after 120 h. Cultivation of the parent and ΔssrS mutant strains in liquid NMMP medium resulted in a significant decrease in the growth of the mutant strain and decline in actinorhodin production. In the parent strain, synthesis of Act was detected after 28-30 h of cultivation, while in the deletion mutation the synthesis of Act was not reliably detected until after 48 h of cultivation, and at 120 h, the production in the mutant was more than three times lower than that of the parental strain (Fig. 3d). To determine whether 6S RNA is responsible for the observed phenotypic changes, a complementation strain carrying scr3559 gene on pSET82 integrative plasmid was prepared. The complementation strain restored

We examined the effect of 6S RNA on growth and the production of antibiotics in the strain M145 and the ΔssrS knockout mutant of S. coelicolor. The correct gene disruption was verified by hybridization with the corresponding probe. Under a similar spore inoculum density (5×106 spores/ml), the ΔssrS deletion mutation causes changes in the growth rate (Fig. 3b) and the morphology of the mycelium, and differentiation into pellets is observed after 96 h of cultivation, whereas the hyphae of the parental strain form pellets and clumps after 24–36 h of cultivation. The pelleting characteristics were related to the production of blue-pigmented actinorhodin (Act) (Manteca et al. 2008). The Act production was first

Appl Microbiol Biotechnol

Fig. 3 a Abundance of 6S RNA in 12-, 24-, 48-, 72-, and 96-h cultures of S. coelicolor. Aliquots of total RNA (10 μg) were used for Northern blotting analysis. Northern blotting was performed to detect 6S RNA via blot hybridization following electrophoresis on polyacrylamide-urea denaturing gels. Dig-11-dUTP-labeled DNA probes were generated through PCR amplification (Roche) using genomic DNA as a template. The upstream primer 5′GTGACCTGGTGCGGCTGGCCCGT3′ and downstream primer 5′GAAGTGCGGCGAGCACTTCCG3′ were employed. For 5S RNA, 5′TGAGTGTTTCATAGTGTTTCGGT3′ and 5′AATAAT TGTTCGGCGGCGTC3′ were used. RNAs were transferred to nylon membranes via semi-dry electroblotting. The blots were then UV-crosslinked and hybridized with probes overnight at 62 °C. Following incubation in blocking solution, 6S RNA and 5S RNA were detected using an anti-Dig-alkaline phosphatase conjugate and a colorimetric substrate. The detection reaction was stopped by rinsing the membrane with water. b Growth of the wild strain (filled square), ΔssrS mutant (filled triangle),

and complementation mutation ΔssrS:: pSET ssrS (filled diamond). At the indicated time intervals, 2-ml samples were collected, filtered, washed, and dried at 105 °C for 12 h. The presented data are the average of three independent experiments. c Antibiotic production on solid NMMP medium after 6 days at 29 °C. Left parental M145 strain, right ΔssrS mutant. Deletion of ssrS leads to reduced actinorhodin production. d Actinorhodin production in NMMP liquid medium in the parental strain (filled triangle) of S. coelicolor in the ΔssrS deletion mutant (filled square) and in the complementation mutation with plasmid ΔssrS:: pSET ssrS (filled circle) was examined after 24, 48, 72, 96, 120, and 168 h of cultivation. Submersion cultivation in rotatory shaker was conducted at 29 °C at 145 rpm. The results correspond to the average of four independent experiments. Error bars correspond to ± standard deviations from the average. e Complementation of mutation ΔssrS with integrative pSET 82-ssrS plasmid leads to increased growth and production of actinorhodin. Left ΔssrS mutant, right plasmid ΔssrS:: pSET ssrS

growth and the Act production on the level of parental strain (Fig. 3e). To determine the structural basis for the observed differences in growth and actinorhodin production between the wild strain and the ssrS deletion mutant, we examined the role of 6S RNA in the regulation of the expression of certain genes that are essential for growth and the production of actinorhodin.

RNAPσhrdB. It was necessary to prepare the core RNAP and sigma factor Hrd B . Following in vitro association, RNAPσhrdB was incubated with 32P-labeled 6S RNA and UV-cross-linked at 245 nm. The mixture was subsequently digested with RNaseA, after which cross-linked proteins containing fragments of 32P-labeled 6S RNA were analyzed via SDS-PAGE, and the radioactivity of the proteins was monitored (Fig. 4a). Radioactive spots were eluted and analyzed via μLC mass spectrometry. As shown in Table 1, radioactivelabeled spots (140 kDa) were identified as the β β′ subunits of RNA polymerase, a spot at 58 kDa was identified as sigma factor HrdB, and an 11-kDa polypeptide was identified as sigma ω. A similar course of radioactivity was obtained following UV irradiation of 32P-6S RNA with the partially

Interaction of 6S RNA with RNA polymerase and σhrdB Gene disruption experiments suggest that hrdB is an essential gene in S. coelicolor (Kang et al. 1997) required for morphogenesis and antibiotic biosynthesis (Buttner et al. 1990). We examined the binding of 6S RNA from S. coelicolor to

Appl Microbiol Biotechnol

Fig. 4 Cross-linking of RNA polymerase σhrdB to 6S RNA. a RNA polymerase and 32P 6S RNA were mixed in microtiter plate and exposed to UV radiation for 35 min on ice. Reactions were transferred to microcentrifugation tubes and incubated with RNaseA (0.1 μg/μl) at 37 °C for 20 min. The sample was analyzed in 10% SDS-PAGE. The gel was fixed for 1 h in MeOH–H3PO4–H2O (40:5:55) and stained with Coomassie blue. Stained bands from left standards of m.w., HrdB, RNA polymerase, and radioactivity of cross-linked of 6S RNA products digested with RNaseA were detected with Phosphorimaginer. b Co-

immunoprecipitation analysis of 6S RNA binding to RNA polymerase. The RNA polymerase holoenzyme was incubated with 32P-6S RNA, and the complexes were precipitated with antibodies against specific peptides corresponding to the RNA polymerase β and β′ subunits or the RNAP holoenzyme. The complexes were washed and isolated using protein Gagarose. Control experiment was performed with 32P-5S RNA and no complex with RNA polymerase was detected. The sediments were then solubilized and analyzed via 10 % PAGE. The radioactivity of the dry gels was monitored using PhosphorImager

purified RNAP holoenzyme obtained from the stationary phase of growth (not shown). To gain further insight into the association of 6S RNA with RNA polymerase, 32P-labeled 6S RNA was incubated with RNAPσhrdB, and the complex was precipitated with antibodies raised against peptides corresponding to the β or β′ subunit of S. coelicolor RNA polymerase or against the RNA polymerase holoenzyme. Control experiment was performed with 32P-5S RNA and no complex with RNA polymerase was detected. Washed complexes were analyzed via 10 % PAGE, and the radioactivity of resolved 6S RNA was monitored. The results of co-immunoprecipitation experiments again indicated that 6S RNA binding to the β and β′subunits is specific (Fig. 4b).

(pRNAs). The RNAPσhrdB holoenzyme was preincubated with gel-purified 6S RNA, and the annealing reaction was terminated using heparin (2 μM). The transcription reaction was initiated with a mixture of nucleotide triphosphates containing [α32P] UTP. The reaction products were subsequently isolated using the mirVana kit (Ambion) and analyzed in 8 M urea–18 % polyacrylamide gels (Fig. 5a). Radioactive transcripts of approximately 4–20 nt were produced in the presence of 6S RNA. When the complete reaction was performed in the presence of 0.1 mM rifampicin, transcription of pRNA from 6S RNA was inhibited. We further analyzed the transcription of RNAPσhrdB using 5′ labeled 6S RNA as a transcription template (Fig. 5b). The transcription reaction was dependent on the presence of NTPs (lane 0). The 6S RNA:pRNA band appeared within the first 20 min of incubation. After 180 min, the 6S RNA:pRNAP complex increased, and the amount of the free 6S RNA was substantially reduced. These data indicate that streptomycete 6S RNA may be

6S RNA acts as a template for RNA polymerase We tested whether streptomycete 6S RNA could serve as a template for RNAPσhrdB to generate short oligonucleotides Table 1 Interaction of 6S RNA with DNA-dependent RNA polymerase of S. coelicolor

Name

Accession

No peptides

Coverage %

MW (kDa)

RNA polymerase β RNA polymerase β′ Sigma factor hrdB ω-Protein

RPOB STRCO RPOC STRCO hrdB STRCO RpoZ STRCO

50 57 24 4

53 50 49 43

128 144 58 11

Appl Microbiol Biotechnol

Fig. 5 RNA polymerase synthesis activity. a 6S RNA serves as a template for the transcription of pRNAs. Reaction mixtures (50 μl): 30 mM Tris-HCl, pH 7.6, 8 mM MgCl2, 40 mM CH3 COOK, 0.1 mM EDTA, 0.8 mM DTT, 5 μg acetylated BSA, 0.05 mM each of ATP, GTP, and CTP, 0.25 mM UTP, and 10 μCi [α32P]-UTP, 6S RNA. The reactions were initiated by adding the RNA polymerase holoenzyme (50 nM) and incubated at 37 °C for 15 min. The reactions were performed either in the absence (−S) or the presence of 20 nM 6S RNA (+S). Rifampicin (0.1 mM) inhibits the reaction (Rif). St-20 nt oligonucleotide standard. RNA was precipitated in the presence of 5 μg of tRNA with 2.5 vol. of ethanol. The samples were centrifuged, and the sediment was washed with 1 ml of 75 % ethanol, suspended in 20 μl of RNA loading buffer, and then separated on 17 % denaturing polyacrylamide gels. The radioactivity of the RNA was monitored with PhosphorImager. b In vitro transcription of the RNAPσhrdB holoenzyme with 32P-6S RNA as a template 32P-6S RNA was preincubated with 500 ng of heparin, and activity buffer was added. The samples were incubated at 37 °C with 8 μl of RNAP (80 μg/ml) either with NTPs (200 μM each) or without them (0) for 20, 60, and 180 min. The samples were analyzed via 7 % native PAGE and radioactivity was monitored with PhosphorImager

involved in the regulation of RNAP activity by pRNA, which mediates the release of RNAP from 6S RNA similarly to what is observed for 6S RNA in E. coli and 6S-1 in B. subtilis. ppGpp levels in wild and ssrS-deleted strains Amino acid deficiencies are regulated by RelA, which is a ppGpp synthetase, responsible for activating and synthesizing ppGpp (Potrykus and Cashel 2008). In S. coelicolor, ppGpp synthesis induces changes in cellular physiology, associated mainly with the transcription of genes related to the stationary phase and in antibiotic gene clusters (Chakraburtty and Bibb 1997; Hesketh et al. 2007). We examine the level of ppGpp in the wild and ΔssrS-deleted strains of S. coelicolor. The cells were labeled with 32P-orthophosphate, and at the indicated time intervals, nucleotides were extracted with

formic acid and separated on PEI cellulose. Spots corresponding to ppGpp were excised, and their radioactivity was determined. The synthesis of ppGpp increased during the first 24 h of cultivation, and the level was approximately twice as high in the deletion strain as in the wild strain. Between 32 and 56 h, ppGpp levels slowly decreased in both strains, and a further decrease was observed in 72–96-h cultures (Fig. 6a). We next tested whether an increase in the 6S RNA level might induce changes in relA mRNA and consequently alter ppGpp levels. We monitored the expression of the relA gene in the parental M145 and ΔssrS mutant strains. The transcription of the relA gene was examined via primer extension, and two oligonucleotide primers were synthesized based on nucleotides at 2,003 and 2,252 positions of SCO1513 ppGpp synthetase. In the ΔssrS mutant strain, we observed an increase in relA expression at up to 48 h of cultivation, followed by a rapid decrease at 72 h. In the parental strain, the expression of relA during the exponential and transition phases was lower, and a slight increase was observed only in the stationary phase (96 h) (Fig. 6b). These data indicate that the expression of 6S RNA and relA and the accumulation of ppGpp are coordinated during the exponential and transition phases of growth. Therefore, it is tempting to speculate that 6S RNA is linked to the system controlling the abundance of ppGpp. Expression of actll-ORF 4 and hrdB in the wild and ssrS deletion strains The biosynthesis of actinorhodin occurs following transcriptional activation of the pathway-specific regulatory gene actllORF 4 (Aigle et al. 2000). The data from the reconstitution experiments suggest that actll-orf4 and redDp might be transcribed by the RNAP holoenzyme containing HrdB. These experiments also revealed a decrease of RNAPσhrdB in the stationary phase of growth, while immunodetection results demonstrated a relatively constant level of HrdB during growth. We observed higher hrdB expression in the parental strain in the exponential and transition phases, while no significant differences in the expression of hrdB were detected in the deletion mutant (Fig. 6c). To assess whether 6S RNA might be involved in the regulation of actinorhodin biosynthesis, the expression of the actll-ORF4 was examined in S. coelicolor M145 and the ΔssrS deletion mutant via primer extension. Transcription of the actII-ORF4 mRNA in the parental strain was relatively high from 24 to 160 h of cultivation. In the deletion mutant, expression of the actII-ORF4 gene was significantly lower than that of the parental strain (Fig. 6d). We conclude that S. coelicolor 6S RNA is able to modulate the function of specific regulatory genes involved in actinorhodin production.

Appl Microbiol Biotechnol

Fig. 6 a Intracellular ppGpp levels in the ΔssrS mutant (filled triangle) and parental strain (filled square). Samples were collected at the indicated time intervals and labeled with 32P-orthophosphate. For nucleotide extraction, 1 M formic acid was used. The extract was spotted onto a PEIcellulose plate and separated in 0.85 M KH2PO4, pH 3.4. The ppGpp pool size was expressed as pmol/mg. Assays were performed in triplicate. b Transcription of relA in the ssrS deletion mutant (filled triangle) and the parental strain (w). Total RNA (1 μg) from 24-, 30-, 72-, and 96-h cultures was used for primer extension. Samples were resolved in 2 % agarose and monitored with PhosphorImager. c Reverse transcription of hrdB mRNA

using RNA from the parental strain (w) and the ΔssrS deletion mutant (open triangle). Primer extension of the hrdB transcript was detected in all RNA samples from both strains. A significantly higher intensity of the hrdB transcript was obtained in RNA from the parental strain from 24- and 48-h cultures than in analogous preparations from the deletion mutant ΔssrS. d Primer extension of the actII-ORF4 mRNA from the parent strain M145 (w) and the ΔssrS mutant (open triangle) revealed a significant reduction in the transcription of the actII-ORF4 gene in the deletion strain. In the parental strain, the expression of actII-ORF4 transcripts was significantly higher than in ΔssrS

Discussion

aromatic residues that exhibit stacking interactions with the base. The role of positively charged residues in the binding of 6S RNA has been demonstrated. The binding of 6S RNA from S. coelicolor to the β β′ subunits of RNA polymerase is consistent with previous results obtained in experiments with RNA polymerase and E. coli 6S RNA (Klocko and Wassarman 2009). We detected significant radioactivity originating from 6S RNA in the 11-kDa protein, which was identified via MS spectrometry as omega factor. In E. coli, the ω subunit interacts with the β′ subunit and promotes the assembly of the RNA polymerase complex (Gentry and Burgess 1993). The rpoZ gene encoding the omega subunit of E. coli RNA polymerase constitutes a single operon with the spoT gene, which is responsible for the maintenance of a stringent response under starvation conditions. Through microarray and promoter expression analysis, it was found that deletion of rpoZ in E. coli eliminates the expression of relA. In the absence of rpoZ, the promoter for the relA is severely impaired, which is partly responsible for decreased ppGpp levels (Chatterji et al. 2007). The S. coelicolor 90-amino-acid RpoZ protein is highly conserved in all sequenced Streptomyces genomes. Deletion of rpoZ in S. coelicolor has a strong effect on antibiotic biosynthesis (Santos-Beneit et al. 2011). Further

In a systematic genome-based computational analysis of small non-coding RNAs in Streptomyces, the 6S RNA homologue of S. coelicolor was predicted (Pánek et al. 2008, 2011). The biocomputational model of the secondary structure of S. coelicolor 6S RNA consisted of seven helices and seven bulges of various sizes. The central bulge is rich in U residues. Helices 4, 5, and 6 possess U-G wobble base pairs. In spite of the low sequence similarities found between γ-proteobacteria and streptomycetes, their 6S RNAs include a preserved secondary structure consisting of two internal F and G loops and a hairpin loop 2, similar to the structures found in E. coli 6S RNA. The arrangement of the motifs can serve as structural scaffolding and act in a functionally and topographically equivalent manner despite the sequential differences (Fig. 2b). Small RNAs bind specifically to their target molecules in a manner involving sequence complementarity or secondary structure. In approximately 20 known RNA recognition motif structures, RNA recognition occurs on the surface of the β-sheet. In many cases, binding is mediated by three conserved residues: Arg or Lys, forming a salt bridge to the phosphodiester backbone, and two

Appl Microbiol Biotechnol

experiments may clarify the potential role of 6S RNA in the regulation of sigma ω activity during the ppGpp-mediated modification of the promoter selectivity of RNA polymerase. Microorganisms reprogram their gene expression in response to environmental changes, partially via the levels of alternative sigma factors. The relatively lower affinity of alternative sigma factors for RNAP requires effectors that facilitate the transcriptional switch during nutritional limitation. Here, we describe the functional activity of 6S RNA from antibiotic-producing streptomycetes for the first time. Due to the low energetic cost of gene silencing via 6S RNA, it is an easy and rapid means of down-regulating the expression of specific genes in response to signals from changes in the environment. We found that the 6S RNA of S. coelicolor is not expressed constitutively, but its accumulation is adapted to changes in nutritional conditions during the transition from the exponential to the stationary phase of growth. The most surprising outcome of this study is that deletion of ssrS gene leads to a very strong phenotype in a reduction of growth and actinorhodin production. The decline in the growth rate is consistent with the results of a microarray analysis of the translational and transcription system of E. coli, which showed that in the absence of 6S RNA, ribosome biogenesis is inhibited, and the lack of 6S RNA is apparently compensated through an increase in the ppGpp concentration (Neusser et al. 2010). The accumulation of ppGpp increases the turnover rate of its own ribosome-dependent synthesis by RelA, resulting in direct positive regulation of an enzyme by its product. Positive allosteric regulation constitutes a new mechanism of enzyme activation. It was found that 6S-1 RNA is essential for the appropriate timing of sporulation in B. subtilis. Cells lacking 6S-1 RNA sporulate earlier than wild-type cells. These cells lacking 6S1RNA reduce the nutrient content of their environment earlier than wild-type cells (Steuten and Wagner 2012). The potential role of 6S RNA in the regulation of RNA polymerase was determined in experiments demonstrating the binding of 6S RNA to the RNA polymerase holoenzyme and when 6S RNA was used as a template to synthesize short oligonucleotides (pRNA) in the presence of a high level of NTPs (Beckmann et al. 2012). We do not know yet how the transcription of streptomycete 6S RNA is regulated. 6S RNA is involved in the modification of transcription upon changes to environmental growth condition. In E. coli, 6S RNA is transcribed from two promoters: P1 and P2. P1 is σ70 dependent promoter and P2 is both σ70 and σs dependent (Kim and Lee 2004). This might be the important regulation mechanism, using switching σ factors for the formation of specific RNAP holoenzymes in response to environmental signals. It remains to be established whether the 6S RNA transcription is regulated by several promoters of various strength. There is currently no comprehensive description of the network that integrates various nutritional and growth signals in relation to pathwayspecific regulatory genes that cause changes in the expression

of antibiotic biosynthesis genes. Additionally, there is little available information on how different signals are integrated into the global regulatory circuit. Decoy oligonucleotides were used to study the regulation of the actinorhodin in S. coelicolor. This method is an effective tool for the rapid identification of cis-acting regulatory sequences controlling both specific genes and regulatory networks. Two of the identified regulatory elements occurred upstream of gene SCO5812, the deletion of which reduced actinorhodin production (McArtur and Bibb. 2008). Intracellular accumulation of ppGpp regulates the transcription of ppGpp-sensitive promoters and causes enhanced production of antibiotics (Hesketh et al. 2001; Wendrich and Marahiel 1997). Sigma factors belonging to the extracytoplasmic function subfamily are important regulators of stress responses in bacteria. Transcriptional analyses showed that SigT controls the expression of relA and, consequently, affects actinorhodin production upon nitrogen starvation (Feng et al. 2011). The transcription factor AtrA regulates the transcription of ActII-ORF4, which is a pathway-specific activator of the actinorhodin gene cluster in S. coelicolor. Disruption of the atrA gene reduces the production of actinorhodin, without any effect on other antibiotics produced by S. coelicolor (Uguru et al. 2005). Here, we showed that deletion of ssrS affects the growth rate and reduces the expression of essential regulatory genes related to the production of actinorhodin. The results of these experiments indicate that 6S RNA is another factor involved in the regulation of expression of key genes for the biosynthesis of actinorhodin and helps to clarify the complexity of the regulatory mechanisms of production of antibiotics in S. coelicolor. Acknowledgments This work was supported by Grants GAAV IAA, 600110902, PRVOUK-P24/LF1/3, and MŠMT6046137305 and the Grant Agency of the Czech Republic P302/10/0468 and 1309685S.

References Aigle B, Wietzorrek A, Takano E, Bibb MJ (2000) A single amino acid substitution in region 1.2 of the principal σ factor of Streptomyces coelicolor A3(2): results in pleiotropic loss of antibiotic production. Mol Microbiol 3:995–1004 Axmann IM, Holtzendorff J, Voss B, Kensche P, Hess WR (2007) Two distinct types of 6S RNA in Prochlorococcus. Gene 406:69–78 Barker MM, Gaal T, Josaitis CA, Gourse RL (2001) Mechanism of regulation of transcription initiation by ppGpp. Effect of ppGpp on transcription initiation in vivo and in vitro. J Mol Biol 305:673–688 Barrick JE, Sudarsan N, Weinberg Z, Ruzzo WL, Breaker RR (2005) 6S RNA is a widespread regulator of eubacterial RNA polymerase that resembles an open promoter. RNA 11:774–784 Bentley SD, Chater F, Cerdeño-Tárraga AM, Challis GL, Thomson NR, James KD, Harris DE, Quail MA, Kieser H, Harper D, Bateman A, Brown S, Chandra G, Chen CW, Collins M, Cronin A, Fraser A, Goble A, Hidalgo J, Hornsby T, Howarth S, Huang CH, Kieser T, Larke L, Murphy L, Oliver K, O'Neil S, Rabbinowitsch E,

Appl Microbiol Biotechnol Rajandream MA, Rutherford K, Rutter S, Seeger K, Saunders D, Sharp S, Squares R, Squares S, Taylor K, Warren T, Wietzorrek A, Woodward J, Barrell BG, Parkhill J, Hopwood DA (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141–147 Beckmann B, Hoch PH, Marz M, Willkomm DK, Salas M, Hartmann RK (2012) A pRNA-induced structural rearrangement triggers 6S-1 RNA release from RNA polymerase in Bacillus subtilis. EMBO J 31:1727–1738 Bibb MJ (2005) Regulation of secondary metabolism in streptomycetes. Curr Opin Microbiol 8:208–215 Bierman R, Logan K, O'Brien ET, Seno R, Nagaraja R, Schoner BE (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43–49 Brown KL, Wood S, Buttner MJ (1992) Isolation and characterization of the major vegetative RNA polymerase of Streptomyces coelicolor A3(2): renaturation of a sigma subunit using GroEL. Mol Microbiol 6:1133–1139 Buttner MJ, Chater KF, Bibb MJ (1990) Cloning, disruption, and transcriptional analysis of the three RNA polymerase sigma factor genes of Streptomyces coelicolor A3(2). J Bacteriol 172:3367–3378 Cavanagh AT, Klocko AD, Liu X, Wassarman KM (2008) Promoter specificity for 6S RNA regulation of transcription is determined by core promoter sequences and competition for region 4.2 of sigma70. Mol Microbiol 67:1242–1256 Cavanagh AT, Sperger JM, Wassarman KM (2012) Regulation of 6S RNA by pRNA synthesis is required for efficient recovery from stationary phase in E. coli and B. subtilis. Nucleic Acid Res 40: 2234–2246 Cavanagh AT, Wassarman KM (2013) 6S-1 RNA function leads to a delay in sporulation in Bacillus subtilis. J Bacteriol 195:2079–2086 Chakraburtty R, Bibb M (1997) The ppGpp synthetase gene (relA) of Streptomyces coelicolor A3 (2) plays a conditional role in antibiotic production and morphological differentiation. J Bacteriol 179:5854– 5861 Chatterji D, Ogawa Y, Shimada T, Ishihama A (2007) The role of omega subunit of RNA polymerase in expression of the relA gene in Escherichia coli. FEMS Microbiol Lett 267:51–55 Faucher SP, Friedlander G, Livny J, Margalit H, Shuman HA (2010) Legionella pneumophila 6S RNA optimizes intracellular multiplication. Proc Natl Acad Sci U S A 107:7533–7538 Feng WH, Mao XM, Liu ZH, Li YQ (2011) The ECF sigma factor SigT regulates actinorhodin production in response to nitrogen stress in Streptomyces coelicolor. Appl Microbiol Biotechnol 92:1009–1021 Gildehaus N, Neusser T, Wurm R, Wagner R (2007) Studies on the function of the riboregulator 6S RNA from E. coli: RNA polymerase binding, inhibition of in vitro transcription and synthesis of RNA-directed de novo transcripts. Nucleic Acids Res 35:1885–1896 Gramajo HC, Takano E, Bibb MJ (1993) Stationary-phase production of the antibiotic actinorhodin in Streptomyces coelicolor A3(2) is transcriptionally regulated. Mol Microbiol 7:837–845 Gentry D, Burgess RR (1993) Cross-linking of Escherichia coli RNA polymerase subunits: identification of β′ as the binding site of ω. Biochemistry 32:11224–11227 Gust B, Kieser T, Chater KF (2000) REDIRECT technology: PCRtargeting system in Streptomyces coelicolor. John Innes Centre, Norwich Hahn MY, Bae JB, Park JH, Roe JH (2003) Isolation and characterization of Streptomyces coelicolor RNA polymerase, its sigma and antisigma factors. Methods Enzymol 370:73–82 Hesketh A, Sun J, Bibb M (2001) Induction of ppGpp synthesis in Streptomyces coelicolor A3(2) grown under conditions of nutritional sufficiency elicits actII-ORF4 transcription and actinorhodin biosynthesis. Mol Microbiol 39:136–144

Hesketh A, Chen WJ, Ryding J, Chang S, Bibb MJ (2007) The global role of ppGpp synthesis in morphological differentiation and antibiotic production in Streptomyces coelicolor A3(2). Genome Biol 8:R161 Kang J-G, Hahn MY, Ishiham A, Roe J-H (1997) Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerases from Streptomyces coelicolor A3(2). Nucleic Acid Res 25: 2566–2573 Kieser T, Bibb MJ, Buttner MJ, Chate KF, Hopwood DA (2000) Practical Streptomyces genetics. John Innes Centre, Norwich Research Park Kim KS, Lee Y (2004) Regulation of 6S RNA biogenesis by switching utilization of both sigma factors and endoribonucleases. Nucleic Acids Res 32:6057–6068 Klocko AD, Wassarman KM (2009) 6S RNA binding to Eσ70 requires a positively charged surface of σ70 region 4.2. Mol Microbiol 73:152– 164 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and ClustalX version 2.0. Bioinformatics 23:2947–2948 Manteca A, Alvarez R, Salazar N, Yague P, Sanchez J (2008) Mycelial differentiation and antibiotic production in submerged cultures of Streptomyces coelicolor. Appl Environ Microbiol 74:3877–3886 McArtur M, Bibb MJ (2008) Manipulating and understanding antibiotic production in Streptomyces coelicolor A3(2) with decoy oligonucleotides. Proc Natl Acad Sci U S A 105:1020–1025 Neusser T, Gildehaus N, Wurm R, Wagner R (2008) Studies on the expression of 6S RNA from E. coli; involvement of regulators important for stress and growth adaptation. Biol Chem 389:285–297 Neusser T, Polen T, Geissen R, Wagner R (2010) Depletion of the noncoding regulatory 6S RNA in E. coli causes a surprising reduction in the expression of the translation machinery. BMC Genomics 11:165 Ochi K (2007) From microbial differentiation to ribosome engineering. Biosci Biotechnol Biochem 71:1373–1386 Pánek J, Bobek J, Mikulík K, Basler M, Vohradský J (2008) Biocomputational prediction of small non-coding RNAs in Streptomyces. BMC Genomics 9:217–227 Pánek J, Krásny L, Bobek J, Jezková E, Korelusová J, Vohradský J (2011) The suboptimal structures find the optimal RNAs: homology search for bacterial non-coding RNAs using suboptimal RNA structures. Nucleic Acids Res 39:3418–3426 Potrykus K, Cashel M (2008) (p)ppGpp: still magical? Annu Rev Microbiol 62:35–51 Steuten B, Setny P, Zacharias M, Wagner R (2013) Mapping the spatial neighborhood of the regulatory 6S RNA bound to Escherichia coli RNA polymerase holoenzyme. J Mol Biol 425:3649–3661 Santos-Beneit F, Barriuso-Iglesias M, Fernández-Martínez LT, MartínezCastro M, Sola-Landa A, Rodríguez-García A, Martín JF (2011) The RNA polymerase omega factor RpoZ is regulated by PhoP and has an important role in antibiotic biosynthesis and morphological differentiation in Streptomyces coelicolor. Appl Environ Microbiol 77:7586–7594 Schnider U, Keel C, Blumer C, Troxler J, Defago G, Haas D (1995) Amplification of the housekeeping sigma factor in Pseudomonas fluorescens CHA0 enhances antibiotic production and improves biocontrol abilities. J Bacteriol 177:5387–5392 Steuten B, Wagner R (2012) A conformational switch is responsible for the reversal of the 6S RNA-dependent RNA polymerase inhibition in Escherichia coli. Biol Chem 393:1513–1522 Trotochaud AE, Wassarman KM (2004) 6S RNA function enhances long-term cell survival. J Bacteriol 186:4978–4985 Trotochaud AE, Wassarman KM (2005) A highly conserved 6S RNA structure is required for regulation of transcription. Nat Struct Mol Biol 12:313–319 Trotochaud AE, Wassarman KM (2006) 6S RNA regulation of pspF transcription leads to altered cell survival at high pH. J Bacteriol 188:3938–3943

Appl Microbiol Biotechnol Uguru GC, Stephens KE, Stead JA, Towle JE, Baumberg S, McDowall KJ (2005) Transcription activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor. Mol Microbiol 58:131–150 Wassarman KM, Storz G (2000) 6S RNA regulates E. coli RNA polymerase activity. Cell 101:613–623 Wassarman KM, Saecker RM (2006) Synthesis-mediated release of a small RNA inhibitor of RNA polymerase. Science 314:1601–1603 Wassarman KM (2007) 6S RNA: a small RNA regulator of transcription. Curr Opin Microbiol 10:164–168

Watanabe TM, Sugiura M, Sugita M (1997) A novel small stable RNA, 6Sa RNA, from the cyanobacterium Synechococcus sp. strain PCC6301. FEBS Lett 416:302–306 Wendrich TM, Marahiel MA (1997) Cloning and characterization of a relA/spoT homologue from Bacillus subtilis. Mol Microbiol 26:65–79 Zhuo Y, Zhang W, Chen D, Gao H, Tao J, Liu M, Gou Z, Zhou X, Ye BC, Zhang Q, Zhang S, Zhang L-X (2010) Reverse biological engineering of hrdB to enhance the production of avermectins in an industrial strain of Streptomyces avermitilis. Proc Natl Acad Sci U S A 107:11250–11254