Cell Mol Neurobiol DOI 10.1007/s10571-014-0063-8
ORIGINAL RESEARCH
3D Porous Chitosan Scaffolds Suit Survival and Neural Differentiation of Dental Pulp Stem Cells Xingmei Feng • Xiaohui Lu • Dan Huang • Jing Xing • Guijuan Feng Guohua Jin • Xin Yi • Liren Li • Yuanzhou Lu • Dekang Nie • Xiang Chen • Lei Zhang • Zhifeng Gu • Xinhua Zhang
•
Received: 26 February 2014 / Accepted: 9 April 2014 Ó Springer Science+Business Media New York 2014
Abstract A key aspect of cell replacement therapy in brain injury treatment is construction of a suitable biomaterial scaffold that can effectively carry and transport the therapeutic cells to the target area. In the present study, we created small 3D porous chitosan scaffolds through freezedrying, and showed that these can support and enhance the differentiation of dental pulp stem cells (DPSCs) to nerve cells in vitro. The DPSCs were collected from the dental pulp of adult human third molars. At a swelling rate of *84.33 ± 10.92 %, the scaffold displayed high porosity and interconnectivity of pores, as revealed by SEM. Cell counting kit-8 assay established the biocompatibility of the chitosan scaffold, supporting the growth and survival of DPSCs. The successful neural differentiation of DPSCs was assayed by RT-PCR, western blotting, and immunofluorescence. We found that the scaffold-attached DPSCs showed high expression of Nestin that decreased sharply following induction of differentiation. Exposure to the differentiation media also increased the expression of
neural molecular markers Microtubule-associated protein 2, glial fibrillary acidic protein, and 20 ,30 -cyclic nucleotide phosphodiesterase. This study demonstrates that the granular 3D chitosan scaffolds are non-cytotoxic, biocompatible, and provide a conducive and favorable microenvironment for attachment, survival, and neural differentiation of DPSCs. These scaffolds have enormous potential to facilitate future advances in treatment of brain injury. Keywords Chitosan porous scaffold Neural differentiation Dental pulp stem cells (DPSCs) Brain injury Biocompatibility
Introduction Despite the existence of two neurogenic regions in the adult central nervous system (CNS), the subgranular zone (SGZ) of the dentate gyrus (DG) and the subventricular zone (SVZ), both of which can generate new neurons throughout adulthood, the ability of the adult CNS to
Xingmei Feng and Xiaohui Lu contributed equally to this work. X. Feng X. Lu D. Huang J. Xing G. Feng Department of Stomatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China G. Jin X. Yi X. Chen L. Zhang X. Zhang (&) Department of Human Anatomy, Medical College, Nantong University, Nantong 226001, Jiangsu, People’s Republic of China e-mail: [email protected] L. Li Department of Gastroenterology and Hepatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China
Y. Lu Department of Cardiology Medical, Tongzhou First People’s Hospital, Nantong 226300, Jiangsu, People’s Republic of China D. Nie Department of Neurosurgery, Yancheng First People’s Hospital, Yancheng 224005, Jiangsu, People’s Republic of China Z. Gu (&) Department of Rheumatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China e-mail: [email protected]
123
Cell Mol Neurobiol
produce new neurons and glial cells is still very limited. Consequently, its ability to self-renew, differentiate, and replenish lost neurons after acute or degenerative CNS injury is very low (Bjorklund and Lindvall 2000). Hence, induction of endogenous nerve repair following brain injury is a challenging problem, compelling researchers to explore new treatment avenues to minimize neuronal death and loss of neurological function (Shi et al. 2012). As an adult mesenchymal stem cell (MSC), the dental pulp stem cells (DPSCs) have high self-renewal potential, and can undergo more than 80 passages without losing their stem cell characteristics and showing clear signs of senescence (d’Aquino et al. 2009). Importantly, studies on animal models of brain injury and neurodegeneration have shown that under defined conditions, DPSCs can be induced to differentiate into neuron-like cells that can be transplanted into affected regions to replenish lost neural cells (Arthur et al. 2009; Sakai et al. 2012; Tamaki et al. 2013; Yamagata et al. 2013). The above findings, together with the easy availability from extracted teeth (a waste product of medical procedures) and non-ethics, make the DPSCs a promising candidate in tissue engineering and cell replacement therapy. A technical challenge in applying DPSCs to treat brain lesions is their effective transfer to the affected area. Therefore, choosing a suitable biomaterial scaffold that can effectively transport the cells to the target area is critical for successful cellular treatment of brain injury (Shi et al. 2012). Advances in tissue engineering have enabled the utilization of biomaterials as scaffolds intended to act as three-dimensional (3D) structures that could support cell growth and differentiation, promote cell–cell adhesion, and facilitate migration (Nakashima and Akamine 2005). These scaffolds can be prepared from different biocompatible and/or biodegradable materials, including both natural and synthetic polymers. Chitosan, or B (1,4) 2-amino-2-deoxy-D-glucose, is a hydrophilic biopolymer obtained industrially by alkaline treatment-based hydrolysis of the aminoacyl groups of chitin, which is the main component of the exoskeleton of crustaceans like crabs, shrimps, and krill (Kas 1997). This polysaccharide has a number of properties that make it an ideal material for biomedical applications. These include anticholesterolemic and antimicrobial activity, biocompatibility, biodegradability, fungistaticity, hemostatic potential, non-carcinogenicity, accentuated affinity to proteins, and the ability to promote cell adhesion, proliferation, and differentiation (Kim et al. 2008; Muzzarelli 2010; Ribeiro et al. 2009). Many studies have investigated the applicability of biomaterials as scaffolds in tissue engineering-based repair and regeneration of injured body parts and organs (Dokmeci and Khademhosseini 2011). Chitosan is widely recommended due to its unique features, low toxicity, biodegradability, and the ability to be manufactured in different forms
123
and shapes for use in a wide range of applications (Fukuda et al. 2006; Itoh et al. 2003a, b; Li et al. 2005). Separate studies have demonstrated that 3D porous chitosan scaffolds can create a micro-environment for cells to attach and grow, both in vitro and in vivo. The porous chitosan scaffolds can transport cells effectively by carrying them in their specific 3D structure, and subsequently influence the regulation of cell biological functions (Li et al. 2009). While previous studies have demonstrated the utility of chitosan scaffolds to promote differentiation of MSCs into neural cells that can then be used to treat traumatic brain injury (Shi et al. 2012), thus far, there are no reports on the use of DPSCs in tissue engineering. The aim of the present study is to fabricate a porous chitosan scaffold and evaluate its cytotoxicity and the potential to favor and facilitate in vitro neural differentiation of DPSCs.
Materials and Methods Fabrication of Chitosan Porous Scaffolds Chitosan (92.3 % deacetylated, average molecular weight = 2.2 9 104; Sigma, Aldrich), 0.2 g, was dissolved in 10 ml acetic acid (1 %) to obtain a yellow-colored viscous and homogenous mixture. The solution was added into 24-well plates, and kept at 4 °C for 12 h. Next, the mold was placed at -20 °C and allowed to solidify for 24 h, followed by lyophilization of the chitosan scaffolds in a freeze dryer (Thermo Co., USA) for 24 h at -56 °C. The resulting scaffolds were removed and immersed in 0.1 M NaOH to neutralize the residual acetic acid. They were washed three times in 0.01 M PBS, 0.9 % NaCl, and 75 % ethanol, respectively. Next, they were air-dried and stored until further use (Shi et al. 2012). Determination of Scaffold Swelling Ratio The dry scaffolds were weighed on a precision balance (dry weight Wd) and immersed in PBS for different lengths of time. After removing excess liquid from the surface using a filter paper, they were weighed again (swollen weight Ws). The swelling ratio was calculated using the following equation: Swelling ratio ð%Þ ¼ ðWs Wd Þ=Wd 100. This test was performed repeatedly and independently on seven different samples. Scanning Electron Microscopy (SEM) Scanning electron microscopy was used to analyze the surface of the chitosan scaffolds containing attached DPSCs. The scaffolds were rinsed in PBS (pH 7.4), and
Cell Mol Neurobiol
fixed in a solution of 2 % glutaraldehyde and 0.6 % paraformaldehyde at 4 °C for 24 h. Next, they were dehydrated by passing through a gradient series of acetone, dried in a critical point dryer and coated with gold–palladium. Samples were analyzed using a scanning electron microscope (Hitachi S-2700, Tokyo, Japan) operated at an accelerating voltage of 20 kV. The test was repeated on seven different samples (Gaspar et al. 2011). Preparation of DPSCs To isolate DPSCs, healthy third molars were obtained from seven adults (ages 17–25 years) at the affiliated hospital of Nantong university, according to the ethics committee guidelines. The procedures is according to the description of previous report (Gronthos et al. 2000). Briefly, the teeth were sterilized by immersing in PBS-containing antibiotics, then cleaved to expose dental pulp. The pulp tissue was gently separated and digested in 1 % (w/v) collagenase type I (Sigma Aldrich, St. Louis, MO, USA). Single-cell suspensions were obtained by filtration through a 70-lm strainer (Falcon). The cells were cultured in DMEM/F12 (Kerkis et al. 2008) (Corning, USA) containing 10 % fetal bovine serum (FBS, Hyclone), 100 U/ml penicillin, and 100 lg/ml streptomycin (Invitrogen/GIBCO) at 37 °C in a humidified atmosphere containing 5 % CO2. The culture medium was replaced once every 3 days. Cells from the third to fifth passages were used for the follow-up experiments. DPSCs were analyzed by flow cytometry as described previously (Feng et al. 2013). For the growth of DPSCs on chitosan scaffolds, the DPSCs were collected in culture medium when the cell confluence reached C90 %. About 1 9 106 cells were added to each chitosan scaffold. According to the specific requirements of the experiment, the scaffolds were supplemented either with complete nutrient solution or neural differentiation medium. Viability of Co-Cultured Cells The chitosan scaffolds co-cultured with DPSCs for 24, 48, or 72 h were carefully removed from the 6-well plates and washed twice with PBS. The chitosan scaffolds attached with cells were digested using 0.25 % trypsin, and collected by centrifugation at 1,000 rpm for 5 min. In subsequent assays, cells detached from the chitosan scaffolds are referred to as chitosan cells, while fresh DPSCs not co-cultured with chitosan scaffolds are referred to as negative cells. Both chitosan cells and fresh DPSCs were cultured further in 96well plates at a density of 6000 cells per well, in 100 ll DMEM/F12 medium supplemented with 10 % FBS. They were incubated at 37 °C in a 5 % CO2 and 95 % air humidified incubator. Cell viability was measured using the
Cell Counting Kit-8 (CCK-8) assay (Beyotime, China), in conditioned media harvested from the following wells: the chitosan group (media incubated with chitosan cells), the positive control (media containing 0.01 g/l lead acetate), the normal group, also called the negative control (media incubated with fresh DPSCs), and the control group (media without any cells). Before measuring the absorbance (A), 10 ll CCK-8 was added to each well, incubated for 1 h at 37 °C. The optical density was then measured at 450 nm using a multi-mode microplate reader (BioTek, Synergy2, USA). Cell viability was calculated using the equation: Cell Viability ð%Þ ¼ Aexperiment Acontrol =Anormal 100. Neural Differentiation of DPSCs To induce neural differentiation of DPSCs, they were incubated with neural induction medium (NIM)-DMEM/F12 medium supplemented with 2 % B27, 2 % N2 (PAA Laboratories, Coelbe, Germany), 25 ng/ml BDNF, 40 ng/ ml NGF, and 25 ng/ml bFGF (R&D Systems, Minneapolis, MN, USA). Four culture conditions were set up: DPSC group (cultured in complete medium), DPSCs?NIM group (cultured in NIM medium), S?DPSC group (DPSCs seeded in chitosan scaffold and cultured in complete medium), and S?DPSC?NIM group (DPSCs seeded in chitosan scaffold and cultured in NIM). After 14 days in vitro, RTPCR, western blotting, and immunofluorescence assays were employed to detect neural differentiation of DPSCs (see below) (Xu et al. 2013).
RT-PCR Total RNA was extracted from DPSCs using the TRIzol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. RNA (2 lg) was reverse-transcribed into first-strand cDNA (Gibco BRL, Rockville, MD). Primer sequences targeting various differentiation markers are listed in Table 1. The PCR products were run on a 1 % agarose gel stained with ethidium bromide. The intensity of each band was recorded and quantified using a densitometer (Quantity One; Bio-Rad, Hercules, CA) and normalized to glyceraldehyde phosphate dehydrogenase (GAPDH). Western Blotting Total protein was extracted from cells of different experimental groups using a cell lysis buffer (Cell Signaling Celbio, Milan, Italy), and the concentration was determined using a BCA protein assay reagent (Pierce, Rockford, Celbio, Milan, Italy). Cell lysates (50 lg from each
123
Cell Mol Neurobiol Table 1 Primes and the reaction conditions of RT-PCR Name
Sense primer (50 –30 )
Antisense primer (50 –30 )
Prod. length (bp)
Ann. T (°C)
CNP
CACCATGCACCTCTCCCAGC
ATGGAGCCGATCCGGTCCAG
366
62
GFAP
GCTTCCTGGAACAGCAAAAC
GGCTTCATCTGCTTCCTGTC
624
58
Nestin
CTCTGACCT GTCAGAAGAAT
CCCACTTTCTTCCTCATCTG
172
32
MAP-2
CTGGGTCTACTGCCATCACTC
CCCCTTTAGGCTGGTATTTGA
282
36
GAPDH
CAGGTGGTCTCCTCTGACTTCAAC
AGGGTCTCTCTCTTCCTCTTG
225
68
sample) were separated by SDS–polyacrylamide gel electrophoresis (PAGE) on 10 % gels transferred to PVDF membranes (Amersham Biosciences, Piscataway, NJ, USA). Membranes were blocked with 5 % non-fat milk in 1 9 TBST solution for 2 h at RT, and incubated with the following primary antibodies diluted with 5 % non-fat milk in 1 9 TBST: mouse monoclonal anti-GAPDH (1:1000, Sigma-Aldrich), anti-nestin (1:200), anti-cyclic nucleotide phosphodiesterase (CNP) (1:200), anti-glial fibrillary acidic protein (GFAP) (1:200), and anti-Microtubuleassociated protein 2 (MAP-2) (1:200, Millipore) at 4 °C overnight. After washing with TBST, the membrane was incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Dako P0447) for 2 h at RT. Immunoreactive bands were visualized using the ECL Advance Western Blotting Detection Kit (GE Healthcare, Milan, Italy) and Hyper film-ECL film (GE Healthcare). Immunofluorescence Staining 14 days after co-culture of DPSCs with chitosan scaffold, the scaffold was fixed in 4 % PFA in 0.1 M PBS for 1 h, and washed in ice-cold PBS. After embedded in O.C.T. (SAKURA, USA), the scaffolds were sectioned into 15-lm-thick sections using a cryostat (Leica CM1950, Germany), and mounted on poly-lysine-coated glass slides. After drying at RT for 30 min, the sections were blocked, then incubated with mouse monoclonal anti-CNP, antiGFAP, and anti-MAP-2 for 2 h at RT. Sections were washed with PBS, incubated with Alexa Fluor 568-conjugated anti-mouse IgG for 2 h at RT, and then counterstained with Hoechst 33342 (1:2000, Sigma) for 15 min at 4 °C. The immunoreactive signals of cells were observed under a fluorescence microscope (Olympus, Japan). Statistical Analysis Statistical analysis was performed using GraphPad software (GraphPad Prism v4.0, GraphPad Software, San Diego, CA, USA). Data are represented as mean ± SEM, and were submitted to one-way (ANOVA) followed by Newman–Keuls’ multiple comparison test (as a post-hoc
123
test). A P value \0.05 was considered statistically significant.
Results Characterization of Chitosan Scaffolds We used a flat-bottomed 24-well plate to mold the shape of the chitosan scaffold (Fig. 1a). Scaffolds of *16-mm diameter and 5 mm thickness were created (Fig. 1b, c). Its swelling ratio in PBS at 37 °C was 84.33 ± 10.92 %, indicating that the scaffolds thus prepared are extremely hydrophilic, with the capacity to accommodate large quantities of saline solution within their 3D structure. Freeze-drying generated 3D chitosan scaffolds with a linearly aligned, highly porous microstructure. High-resolution imaging of the scaffolds using SEM enabled us to visualize morphological details without losing accuracy of analysis. From this examination, we found that the scaffolds are highly porous, that the pores are extensively interconnected, and that the internal surface of the chitosan scaffold appears to be smooth (Fig. 1d, e). Further examination indicated that the pore diameter of the chitosan scaffold was, on average, 269.87 ± 18.55 lm. Interestingly, the SEM images also indicated that many DPSCs successfully attached to the surface of the scaffold (Fig. 1f). Biocompatibility of DPSCs with the Chitosan Scaffold To determine the biocompatibility of DPSCs with the chitosan scaffold, the DPSCs harvested from the scaffolds by enzymatic digestion were seeded into 96-well plates at the same initial concentration, and subsequently examined for properties determining the health and viability of the cells. The brightfield images shown in Fig. 2 indicate that in the chitosan scaffold-conditioned media, DPSCs grew spindle-shaped (Fig. 2d–f), similar to the normal (negative control) group (Fig. 2a–c) at different time-points following seeding. On the other hand, the cells in the positive control group (DPSCs treated with conditioned media
Cell Mol Neurobiol
Fig. 1 Characterization of chitosan scaffold. a The shape of the 24-well plates for the CGB scaffold is a hollow well-shaped cavity, with a diameter and depth of 15 and 18 mm, respectively. b, c The size of the chitosan scaffold is about 5 and 16 mm in depth and diameter. Scanning electron microscope (SEM) images showing the
morphology and surface structure of the porous chitosan scaffold biomaterial (d, 91,000; e, 91,500) and the adhering with DPSCs (f, 1,5009). The surface of the CGB scaffold is smooth with complex 3D structures
containing lead acetate) lost their spindle shape and became rounded. Most of them appeared dead, and consequently were found floating in suspension in the media (Fig. 2g–i). CCK-8 assay was used to evaluate the cytotoxic profile of the biomaterials used in the chitosan scaffolds, on DPSCs. We found that when compared with the normal group (conditioned media harvested from fresh DPSCs), the viability of chitosan DPSCs was not influenced by co-culture with the scaffold. However, as expected, the lead acetate treatment markedly decreased cell viability (Fig. 2j). These findings suggest that DPSCs can survive and grow well within the chitosan scaffolds, while maintaining good viability.
differentiated neural cell-specific markers CNP (oligodendrocytes), GFAP (astrocytes), and MAP-2 (neurons) were expressed at low levels in DPSCs, but increased significantly at 10 % (CNP), 27 % (GFAP), and 29 % (MAP-2) when cultured in the differentiation-inducing NIM media (Fig. 3b–d). We found a similar pattern of expression of cell type-specific differentiation markers also at the protein level. As shown in Fig. 4, western blotting assay revealed high Nestin expression in undifferentiated DPSCs that decreased in the presence of NIM media, irrespective of the presence of the chitosan scaffold (Fig. 4a). Expression of neural cell type-specific markers CNP, GFAP, and MAP-2 also increased in the differentiated cells, regardless of their attachment to a scaffold, following incubation in NIM media (Fig. 4b–d). We further confirmed these observations by calculating the optical densities of the protein bands normalized to GAPDH. We found a significant decline in nestin expression and upregulation of CNP, GFAP, and MAP-2 expression in differentiation conditions, both with and without the scaffold (Fig. 4a–d). Our observations suggest that attachment to a chitosan scaffold does not impact the multipotency of DPSCs and their ability to successfully differentiate into cells expressing different neural cell type-specific biomarkers. To identify the cellular morphology of DPSC-derived neural cells, both chitosan scaffold-attached as well unattached cells were labeled by immunofluorescent staining against MAP-2, GFAP, and CNP, after induction of
Neural Differentiation of DPSCs within the Chitosan Scaffolds To determine the neural differentiation potential of DPSCs seeded within the chitosan scaffold, we examined the expression of neuronal, astrocytic, and oligodendrocytic markers in differentiated cells. First, we performed RT-PCR assays to determine gene expression at the mRNA level. We found that DPSCs expressed the pan-neural progenitor marker, Nestin, at high levels, irrespective of whether they were cultured with or without the chitosan scaffold (Fig. 3a). However, as expected, induction of differentiation by culturing in NIM media significantly decreased Nestin expression from about 50 to 10 % (normalized to GAPDH, Fig. 3a). In contrast,
123
Cell Mol Neurobiol
Fig. 2 Characterization of chitosan scaffold. a–i Optical microscopic photographs of DPSCs after 24, 48, and 72 h of being seeded. DPSCs cells seeded in the presence of chitosan scaffold; Original
magnification 1009. j The viability of chitosan DPSCs was not influenced by co-culture with the scaffold. However, as expected, the lead acetate treatment markedly decreased cell viability
differentiation. Approximately, 1 % cells were CNP-positive in the DPSC group without NIM induction (Fig. 5a–c, g–i and m). In contrast, *3 % and *5.2 % cells were found to be CNP-positive in the DPSC?NIM group and the S?DPSC?NIM group, respectively (Fig. 5d–f, j–m). While there were very few MAP-2-positive cells in the untreated groups (undifferentiated DPSCs, scaffoldattached or otherwise) (Fig. 6a–c, g–i and m), this percentage increased to 8–12 % after NIM treatment (Fig. 6d– f, j–m). Finally, as shown in Fig. 7, although undifferentiated DPSCs did not express GFAP, incubation in NIM
media induced 70–80 % cells to differentiate into GFAPpositive astrocytes.
123
Discussion Three-dimensional biomimetic scaffolds have wide application in biomedical tissue engineering because of their nanoscaled architecture, including nanofibers and nanopores, that are similar to the extracellular matrix found in vivo. These scaffolds are essential for cellular
Cell Mol Neurobiol Fig. 3 Analysis of DPSCs’s neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by RT-PCR. a RT-PCR analysis of Nestin mRNA expressions. b RT-PCR analysis of CNP mRNA expressions. c RT-PCR analysis of GFAP mRNA expressions. d RT-PCR analysis of MAP-2 mRNA expressions. The level of Nestin were decline, the other levels of these RNA were significantly increased in the DPSC?NIM and S?DPSC?NIM compared with that in DPSC and S?DPSC after culture for 14 days. (*P \ 0.05, n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7)
Fig. 4 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and SC?DPSC and SC?DPSC?NIM by Western blot. a Western blot analysis of Nestin expressions. b Western blot analysis of CNP expressions. c Western blot analysis of GFAP expressions. d Western blot analysis of MAP-2 expressions. The level of Nestin were decline, the other levels of these protein were significantly increased in the DPSC?NIM and S?DPSC?NIM compared with that in DPSC and S?DPSC after BDNF, NGF, and bFGF induction for 14 days. (*P \ 0.05, n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7)
123
Cell Mol Neurobiol Fig. 5 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of CNP (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and S?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM. In this study, CNP and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
organization and intercellular communication within the engineered tissue. However, use of any such scaffold in the closed micro-environment of the brain presents a critical challenge. Some scaffolds described in the literature have provided highly successful environments for
123
cell growth in vitro but are unsuitable for use in clinical practice. The chitosan scaffold is a porous scaffold that can be molded into any shape. It has been studied widely, and used and tested in clinical regenerative medicine.
Cell Mol Neurobiol Fig. 6 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of MAP-2 (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and S?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM. In this study, MAP-2 and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
As expected, due to the hydrophilic nature of the chitosan scaffolds, we obtained an average pore diameter of 269.87 ± 18.55 lm, and a high swelling efficiency of
84.33 ± 10.92 %. SEM analyses demonstrated the highly porous structure, albeit with irregular morphology, of the scaffolds. This is an important and desirable characteristic
123
Cell Mol Neurobiol Fig. 7 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of GFAP (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and SC?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM In this study, GFAP and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
for application in tissue engineering. The porosity is an especially important factor, since the primary purpose of the chitosan scaffolds is to enable and support improved neural differentiation of DPSCs. Porosity is also crucial for
123
cell proliferation, since they provide a conducive structural microenvironment to allow cell migration as well as efficient transport of nutrients and metabolic wastes (Lee et al. 2008).
Cell Mol Neurobiol
The cytotoxicity of biomaterials is an important property that will determine their clinical applicability. Materials used in tissue engineering should ideally not release any toxic products or facilitate adverse reactions, features that can be evaluated through in vitro cytotoxicity tests. There is evidence in the literature that chitosan biopolymers support and enhance cell proliferation (Ji et al. 2011). In addition, several studies have demonstrated that chitosan is a nontoxic, biodegradable, and biocompatible material that can potentially be used in various biomedical applications, including drug delivery, wound dressing, tissue engineering, skin substitutes, nerve regeneration, hemostatic action, implants, and antibacterial coating (Kean and Thanou 2010). Our results corroborate these findings and further show that DPSCs can adhere to and proliferate on the surface of the scaffold, demonstrating the latter’s biocompatibility and lack of cytotoxicity. Results from the CCK-8 assay strongly support this conclusion, implying that chitosan is a good candidate to be considered for use in tissue engineering for delivery of human DPSCs to sites of injury. In vitro neural differentiation studies of rat and human DPSCs have shown that these stem/precursor cell populations have the ability to differentiate into neurons, identified by expression of early neuronal markers and cellular morphology (Miura et al. 2003; Nosrat et al. 2004). In vivo studies have shown that rat DPSCs and human exfoliated deciduous teeth (SHED) survive and express neuronal markers when transplanted into the adult rodent brain (Miura et al. 2003; Nosrat et al. 2004). In this study, we investigated the neural differentiation potential of DPSCs isolated from dental pulp, and potentially derived from neural crest cells. These cells are highly proliferative MSCs and likely to be an optimal source of postnatal stem cells for neural cell replacement therapy (Chai et al. 2000) since they tend to express neural cell type-specific markers even before completing differentiation. This is in accordance with previous reports (Arthur et al. 2008). The growth and differentiation properties of human dental pulp cells was recently investigated on a variety of natural scaffolds, including different types of collagen, gelatin, and chitosan (Kim et al. 2009). In this study, we analyzed the potential of DPSCs to grow and differentiate into multiple types of neural cells within a 3D highly porous chitosan scaffold. Analysis of differentiated cells by immunostaining, western blotting, and RT-PCR proved that DPSCs could indeed differentiate into MAP-21 neurons, GFAP1 astrocytes and CNP1 oligodendrocytes. When DPSCs were seeded into the scaffold and cultured in neural induction media, the expression of these markers was upregulated. Our findings strongly suggest that the chitosan scaffold can be used as a vector to support and transport DPSCs to initiate and facilitate nerve repair.
In summary, the development of biocompatible 3D scaffolds that can be combined with stem cells to provide a suitable vehicle for regenerative therapy is an important new field of biomaterial research. The next step in the use of the chitosan scaffold for neural tissue engineering would be to examine and understand its behavior and properties in clinical conditions. More specifically, it will be important to determine if the physical and mechanical properties of these scaffolds are adequate for clinical use, and to understand if they enable the kind of complete neural differentiation seen in animal experiments. The current study represents the first step in this direction. We have successfully fabricated 3D porous chitosan scaffolds where DPSCs can attach, grow, and differentiate into neural cells. The successful co-culture of DPSCs within the chitosan scaffolds suggests that these stem cells are adequately compatible with this type of biomaterial. This work provides evidence that the use of a chitosan scaffold with DPSCs is a promising approach to pursue in devising therapeutic strategies to facilitate the healing and regeneration of injured brain tissues. Acknowledgments This work was supported by Graduate Student Innovation of Science and Technology Projects in Jiangsu Province and in Nantong University (Grants No.YKC13084); the ‘‘Top Six Types of Talents’’ Financial Assistance of Jiangsu Province Grant (No. 7 and No. 10); National Natural Science Foundation of China (Grant No. 31171038), Jiangsu Natural Science Foundation (BK2011385); the Grant of Nantong University for Innovation Talent and a project funded by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions. We thank Department of Human Anatomy of Medical College in Nantong University for technical assistance and equipment support.
References Arthur A, Rychkov G, Shi S, Koblar SA, Gronthos S (2008) Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 26:1787–1795 Arthur A, Shi S, Zannettino AC, Fujii N, Gronthos S, Koblar SA (2009) Implanted adult human dental pulp stem cells induce endogenous axon guidance. Stem Cells 27:2229–2237 Bjorklund A, Lindvall O (2000) Cell replacement therapies for central nervous system disorders. Nat Neurosci 3:537–544 Chai Y, Jiang X, Ito Y, Bringas P Jr, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 127:1671–1679 d’Aquino R, De Rosa A, Laino G, Caruso F, Guida L, Rullo R, Checchi V, Laino L, Tirino V, Papaccio G (2009) Human dental pulp stem cells: from biology to clinical applications. J Exp Zool B Mol Dev Evol 312B:408–415 Dokmeci MR, Khademhosseini A (2011) Preface to special topic: microfluidics in cell biology and tissue engineering. Biomicrofluidics 5:22101 Feng X, Xing J, Feng G, Sang A, Shen B, Xu Y, Jiang J, Liu S, Tan W, Gu Z, Li L (2013) Age-dependent impaired neurogenic
123
Cell Mol Neurobiol differentiation capacity of dental stem cell is associated with Wnt/beta-catenin signaling. Cell Mol Neurobiol 33:1023–1031 Fukuda J, Khademhosseini A, Yeo Y, Yang X, Yeh J, Eng G, Blumling J, Wang CF, Kohane DS, Langer R (2006) Micromolding of photocrosslinkable chitosan hydrogel for spheroid microarray and co-cultures. Biomaterials 27:5259–5267 Gaspar VM, Sousa F, Queiroz JA, Correia IJ (2011) Formulation of chitosan-TPP-pDNA nanocapsules for gene therapy applications. Nanotechnology 22:015101 Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 97:13625–13630 Itoh S, Suzuki M, Yamaguchi I, Takakuda K, Kobayashi H, Shinomiya K, Tanaka J (2003a) Development of a nerve scaffold using a tendon chitosan tube. Artif Organs 27:1079–1088 Itoh S, Yamaguchi I, Suzuki M, Ichinose S, Takakuda K, Kobayashi H, Shinomiya K, Tanaka J (2003b) Hydroxyapatite-coated tendon chitosan tubes with adsorbed laminin peptides facilitate nerve regeneration in vivo. Brain Res 993:111–123 Ji C, Khademhosseini A, Dehghani F (2011) Enhancing cell penetration and proliferation in chitosan hydrogels for tissue engineering applications. Biomaterials 32:9719–9729 Kas HS (1997) Chitosan: properties, preparations and application to microparticulate systems. J Microencapsul 14:689–711 Kean T, Thanou M (2010) Biodegradation, biodistribution and toxicity of chitosan. Adv Drug Deliv Rev 62:3–11 Kerkis I, Ambrosio CE, Kerkis A, Martins DS, Zucconi E, Fonseca SA, Cabral RM, Maranduba CM, Gaiad TP, Morini AC, Vieira NM, Brolio MP, Sant’Anna OA, Miglino MA, Zatz M (2008) Early transplantation of human immature dental pulp stem cells from baby teeth to golden retriever muscular dystrophy (GRMD) dogs: local or systemic? J Transl Med 6:35 Kim IY, Seo SJ, Moon HS, Yoo MK, Park IY, Kim BC, Cho CS (2008) Chitosan and its derivatives for tissue engineering applications. Biotechnol Adv 26:1–21 Kim NR, Lee DH, Chung PH, Yang HC (2009) Distinct differentiation properties of human dental pulp cells on collagen, gelatin, and chitosan scaffolds. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 108:e94–e100 Lee M, Wu BM, Dunn JC (2008) Effect of scaffold architecture and pore size on smooth muscle cell growth. J Biomed Mater Res A 87:1010–1016
123
Li Z, Ramay HR, Hauch KD, Xiao D, Zhang M (2005) Chitosanalginate hybrid scaffolds for bone tissue engineering. Biomaterials 26:3919–3928 Li X, Yang Z, Zhang A, Wang T, Chen W (2009) Repair of thoracic spinal cord injury by chitosan tube implantation in adult rats. Biomaterials 30:1121–1132 Muzzarelli RA (2010) Chitins and chitosans as immunoadjuvants and non-allergenic drug carriers. Mar Drugs 8:292–312 Nakashima M, Akamine A (2005) The application of tissue engineering to regeneration of pulp and dentin in endodontics. J Endod 31:711–718 Nosrat IV, Smith CA, Mullally P, Olson L, Nosrat CA (2004) Dental pulp cells provide neurotrophic support for dopaminergic neurons and differentiate into neurons in vitro; implications for tissue engineering and repair in the nervous system. Eur J Neurosci 19:2388–2398 Ribeiro MP, Espiga A, Silva D, Baptista P, Henriques J, Ferreira C, Silva JC, Borges JP, Pires E, Chaves P, Correia IJ (2009) Development of a new chitosan hydrogel for wound dressing. Wound Repair Regen 17:817–824 Sakai K, Yamamoto A, Matsubara K, Nakamura S, Naruse M, Yamagata M, Sakamoto K, Tauchi R, Wakao N, Imagama S, Hibi H, Kadomatsu K, Ishiguro N, Ueda M (2012) Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuroregenerative mechanisms. J Clin Invest 122:80–90 Shi W, Nie D, Jin G, Chen W, Xia L, Wu X, Su X, Xu X, Ni L, Zhang X, Chen J (2012) BDNF blended chitosan scaffolds for human umbilical cord MSC transplants in traumatic brain injury therapy. Biomaterials 33:3119–3126 Tamaki Y, Nakahara T, Ishikawa H, Sato S (2013) In vitro analysis of mesenchymal stem cells derived from human teeth and bone marrow. Odontology 101:121–132 Xu Y, Gu Z, Shen B, Xu G, Zhou T, Jiang J, Xing J, Liu S, Li M, Tan W, Feng G, Sang A, Li L (2013) Roles of Wnt/beta-catenin signaling in retinal neuron-like differentiation of bone marrow mesenchymal stem cells from nonobese diabetic mice. J Mol Neurosci 49:250–261 Yamagata M, Yamamoto A, Kako E, Kaneko N, Matsubara K, Sakai K, Sawamoto K, Ueda M (2013) Human dental pulp-derived stem cells protect against hypoxic-ischemic brain injury in neonatal mice. Stroke 44:551–554
ORIGINAL RESEARCH
3D Porous Chitosan Scaffolds Suit Survival and Neural Differentiation of Dental Pulp Stem Cells Xingmei Feng • Xiaohui Lu • Dan Huang • Jing Xing • Guijuan Feng Guohua Jin • Xin Yi • Liren Li • Yuanzhou Lu • Dekang Nie • Xiang Chen • Lei Zhang • Zhifeng Gu • Xinhua Zhang
•
Received: 26 February 2014 / Accepted: 9 April 2014 Ó Springer Science+Business Media New York 2014
Abstract A key aspect of cell replacement therapy in brain injury treatment is construction of a suitable biomaterial scaffold that can effectively carry and transport the therapeutic cells to the target area. In the present study, we created small 3D porous chitosan scaffolds through freezedrying, and showed that these can support and enhance the differentiation of dental pulp stem cells (DPSCs) to nerve cells in vitro. The DPSCs were collected from the dental pulp of adult human third molars. At a swelling rate of *84.33 ± 10.92 %, the scaffold displayed high porosity and interconnectivity of pores, as revealed by SEM. Cell counting kit-8 assay established the biocompatibility of the chitosan scaffold, supporting the growth and survival of DPSCs. The successful neural differentiation of DPSCs was assayed by RT-PCR, western blotting, and immunofluorescence. We found that the scaffold-attached DPSCs showed high expression of Nestin that decreased sharply following induction of differentiation. Exposure to the differentiation media also increased the expression of
neural molecular markers Microtubule-associated protein 2, glial fibrillary acidic protein, and 20 ,30 -cyclic nucleotide phosphodiesterase. This study demonstrates that the granular 3D chitosan scaffolds are non-cytotoxic, biocompatible, and provide a conducive and favorable microenvironment for attachment, survival, and neural differentiation of DPSCs. These scaffolds have enormous potential to facilitate future advances in treatment of brain injury. Keywords Chitosan porous scaffold Neural differentiation Dental pulp stem cells (DPSCs) Brain injury Biocompatibility
Introduction Despite the existence of two neurogenic regions in the adult central nervous system (CNS), the subgranular zone (SGZ) of the dentate gyrus (DG) and the subventricular zone (SVZ), both of which can generate new neurons throughout adulthood, the ability of the adult CNS to
Xingmei Feng and Xiaohui Lu contributed equally to this work. X. Feng X. Lu D. Huang J. Xing G. Feng Department of Stomatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China G. Jin X. Yi X. Chen L. Zhang X. Zhang (&) Department of Human Anatomy, Medical College, Nantong University, Nantong 226001, Jiangsu, People’s Republic of China e-mail: [email protected] L. Li Department of Gastroenterology and Hepatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China
Y. Lu Department of Cardiology Medical, Tongzhou First People’s Hospital, Nantong 226300, Jiangsu, People’s Republic of China D. Nie Department of Neurosurgery, Yancheng First People’s Hospital, Yancheng 224005, Jiangsu, People’s Republic of China Z. Gu (&) Department of Rheumatology, Affiliated Hospital of Nantong University, Nantong 226001, Jiangsu, People’s Republic of China e-mail: [email protected]
123
Cell Mol Neurobiol
produce new neurons and glial cells is still very limited. Consequently, its ability to self-renew, differentiate, and replenish lost neurons after acute or degenerative CNS injury is very low (Bjorklund and Lindvall 2000). Hence, induction of endogenous nerve repair following brain injury is a challenging problem, compelling researchers to explore new treatment avenues to minimize neuronal death and loss of neurological function (Shi et al. 2012). As an adult mesenchymal stem cell (MSC), the dental pulp stem cells (DPSCs) have high self-renewal potential, and can undergo more than 80 passages without losing their stem cell characteristics and showing clear signs of senescence (d’Aquino et al. 2009). Importantly, studies on animal models of brain injury and neurodegeneration have shown that under defined conditions, DPSCs can be induced to differentiate into neuron-like cells that can be transplanted into affected regions to replenish lost neural cells (Arthur et al. 2009; Sakai et al. 2012; Tamaki et al. 2013; Yamagata et al. 2013). The above findings, together with the easy availability from extracted teeth (a waste product of medical procedures) and non-ethics, make the DPSCs a promising candidate in tissue engineering and cell replacement therapy. A technical challenge in applying DPSCs to treat brain lesions is their effective transfer to the affected area. Therefore, choosing a suitable biomaterial scaffold that can effectively transport the cells to the target area is critical for successful cellular treatment of brain injury (Shi et al. 2012). Advances in tissue engineering have enabled the utilization of biomaterials as scaffolds intended to act as three-dimensional (3D) structures that could support cell growth and differentiation, promote cell–cell adhesion, and facilitate migration (Nakashima and Akamine 2005). These scaffolds can be prepared from different biocompatible and/or biodegradable materials, including both natural and synthetic polymers. Chitosan, or B (1,4) 2-amino-2-deoxy-D-glucose, is a hydrophilic biopolymer obtained industrially by alkaline treatment-based hydrolysis of the aminoacyl groups of chitin, which is the main component of the exoskeleton of crustaceans like crabs, shrimps, and krill (Kas 1997). This polysaccharide has a number of properties that make it an ideal material for biomedical applications. These include anticholesterolemic and antimicrobial activity, biocompatibility, biodegradability, fungistaticity, hemostatic potential, non-carcinogenicity, accentuated affinity to proteins, and the ability to promote cell adhesion, proliferation, and differentiation (Kim et al. 2008; Muzzarelli 2010; Ribeiro et al. 2009). Many studies have investigated the applicability of biomaterials as scaffolds in tissue engineering-based repair and regeneration of injured body parts and organs (Dokmeci and Khademhosseini 2011). Chitosan is widely recommended due to its unique features, low toxicity, biodegradability, and the ability to be manufactured in different forms
123
and shapes for use in a wide range of applications (Fukuda et al. 2006; Itoh et al. 2003a, b; Li et al. 2005). Separate studies have demonstrated that 3D porous chitosan scaffolds can create a micro-environment for cells to attach and grow, both in vitro and in vivo. The porous chitosan scaffolds can transport cells effectively by carrying them in their specific 3D structure, and subsequently influence the regulation of cell biological functions (Li et al. 2009). While previous studies have demonstrated the utility of chitosan scaffolds to promote differentiation of MSCs into neural cells that can then be used to treat traumatic brain injury (Shi et al. 2012), thus far, there are no reports on the use of DPSCs in tissue engineering. The aim of the present study is to fabricate a porous chitosan scaffold and evaluate its cytotoxicity and the potential to favor and facilitate in vitro neural differentiation of DPSCs.
Materials and Methods Fabrication of Chitosan Porous Scaffolds Chitosan (92.3 % deacetylated, average molecular weight = 2.2 9 104; Sigma, Aldrich), 0.2 g, was dissolved in 10 ml acetic acid (1 %) to obtain a yellow-colored viscous and homogenous mixture. The solution was added into 24-well plates, and kept at 4 °C for 12 h. Next, the mold was placed at -20 °C and allowed to solidify for 24 h, followed by lyophilization of the chitosan scaffolds in a freeze dryer (Thermo Co., USA) for 24 h at -56 °C. The resulting scaffolds were removed and immersed in 0.1 M NaOH to neutralize the residual acetic acid. They were washed three times in 0.01 M PBS, 0.9 % NaCl, and 75 % ethanol, respectively. Next, they were air-dried and stored until further use (Shi et al. 2012). Determination of Scaffold Swelling Ratio The dry scaffolds were weighed on a precision balance (dry weight Wd) and immersed in PBS for different lengths of time. After removing excess liquid from the surface using a filter paper, they were weighed again (swollen weight Ws). The swelling ratio was calculated using the following equation: Swelling ratio ð%Þ ¼ ðWs Wd Þ=Wd 100. This test was performed repeatedly and independently on seven different samples. Scanning Electron Microscopy (SEM) Scanning electron microscopy was used to analyze the surface of the chitosan scaffolds containing attached DPSCs. The scaffolds were rinsed in PBS (pH 7.4), and
Cell Mol Neurobiol
fixed in a solution of 2 % glutaraldehyde and 0.6 % paraformaldehyde at 4 °C for 24 h. Next, they were dehydrated by passing through a gradient series of acetone, dried in a critical point dryer and coated with gold–palladium. Samples were analyzed using a scanning electron microscope (Hitachi S-2700, Tokyo, Japan) operated at an accelerating voltage of 20 kV. The test was repeated on seven different samples (Gaspar et al. 2011). Preparation of DPSCs To isolate DPSCs, healthy third molars were obtained from seven adults (ages 17–25 years) at the affiliated hospital of Nantong university, according to the ethics committee guidelines. The procedures is according to the description of previous report (Gronthos et al. 2000). Briefly, the teeth were sterilized by immersing in PBS-containing antibiotics, then cleaved to expose dental pulp. The pulp tissue was gently separated and digested in 1 % (w/v) collagenase type I (Sigma Aldrich, St. Louis, MO, USA). Single-cell suspensions were obtained by filtration through a 70-lm strainer (Falcon). The cells were cultured in DMEM/F12 (Kerkis et al. 2008) (Corning, USA) containing 10 % fetal bovine serum (FBS, Hyclone), 100 U/ml penicillin, and 100 lg/ml streptomycin (Invitrogen/GIBCO) at 37 °C in a humidified atmosphere containing 5 % CO2. The culture medium was replaced once every 3 days. Cells from the third to fifth passages were used for the follow-up experiments. DPSCs were analyzed by flow cytometry as described previously (Feng et al. 2013). For the growth of DPSCs on chitosan scaffolds, the DPSCs were collected in culture medium when the cell confluence reached C90 %. About 1 9 106 cells were added to each chitosan scaffold. According to the specific requirements of the experiment, the scaffolds were supplemented either with complete nutrient solution or neural differentiation medium. Viability of Co-Cultured Cells The chitosan scaffolds co-cultured with DPSCs for 24, 48, or 72 h were carefully removed from the 6-well plates and washed twice with PBS. The chitosan scaffolds attached with cells were digested using 0.25 % trypsin, and collected by centrifugation at 1,000 rpm for 5 min. In subsequent assays, cells detached from the chitosan scaffolds are referred to as chitosan cells, while fresh DPSCs not co-cultured with chitosan scaffolds are referred to as negative cells. Both chitosan cells and fresh DPSCs were cultured further in 96well plates at a density of 6000 cells per well, in 100 ll DMEM/F12 medium supplemented with 10 % FBS. They were incubated at 37 °C in a 5 % CO2 and 95 % air humidified incubator. Cell viability was measured using the
Cell Counting Kit-8 (CCK-8) assay (Beyotime, China), in conditioned media harvested from the following wells: the chitosan group (media incubated with chitosan cells), the positive control (media containing 0.01 g/l lead acetate), the normal group, also called the negative control (media incubated with fresh DPSCs), and the control group (media without any cells). Before measuring the absorbance (A), 10 ll CCK-8 was added to each well, incubated for 1 h at 37 °C. The optical density was then measured at 450 nm using a multi-mode microplate reader (BioTek, Synergy2, USA). Cell viability was calculated using the equation: Cell Viability ð%Þ ¼ Aexperiment Acontrol =Anormal 100. Neural Differentiation of DPSCs To induce neural differentiation of DPSCs, they were incubated with neural induction medium (NIM)-DMEM/F12 medium supplemented with 2 % B27, 2 % N2 (PAA Laboratories, Coelbe, Germany), 25 ng/ml BDNF, 40 ng/ ml NGF, and 25 ng/ml bFGF (R&D Systems, Minneapolis, MN, USA). Four culture conditions were set up: DPSC group (cultured in complete medium), DPSCs?NIM group (cultured in NIM medium), S?DPSC group (DPSCs seeded in chitosan scaffold and cultured in complete medium), and S?DPSC?NIM group (DPSCs seeded in chitosan scaffold and cultured in NIM). After 14 days in vitro, RTPCR, western blotting, and immunofluorescence assays were employed to detect neural differentiation of DPSCs (see below) (Xu et al. 2013).
RT-PCR Total RNA was extracted from DPSCs using the TRIzol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. RNA (2 lg) was reverse-transcribed into first-strand cDNA (Gibco BRL, Rockville, MD). Primer sequences targeting various differentiation markers are listed in Table 1. The PCR products were run on a 1 % agarose gel stained with ethidium bromide. The intensity of each band was recorded and quantified using a densitometer (Quantity One; Bio-Rad, Hercules, CA) and normalized to glyceraldehyde phosphate dehydrogenase (GAPDH). Western Blotting Total protein was extracted from cells of different experimental groups using a cell lysis buffer (Cell Signaling Celbio, Milan, Italy), and the concentration was determined using a BCA protein assay reagent (Pierce, Rockford, Celbio, Milan, Italy). Cell lysates (50 lg from each
123
Cell Mol Neurobiol Table 1 Primes and the reaction conditions of RT-PCR Name
Sense primer (50 –30 )
Antisense primer (50 –30 )
Prod. length (bp)
Ann. T (°C)
CNP
CACCATGCACCTCTCCCAGC
ATGGAGCCGATCCGGTCCAG
366
62
GFAP
GCTTCCTGGAACAGCAAAAC
GGCTTCATCTGCTTCCTGTC
624
58
Nestin
CTCTGACCT GTCAGAAGAAT
CCCACTTTCTTCCTCATCTG
172
32
MAP-2
CTGGGTCTACTGCCATCACTC
CCCCTTTAGGCTGGTATTTGA
282
36
GAPDH
CAGGTGGTCTCCTCTGACTTCAAC
AGGGTCTCTCTCTTCCTCTTG
225
68
sample) were separated by SDS–polyacrylamide gel electrophoresis (PAGE) on 10 % gels transferred to PVDF membranes (Amersham Biosciences, Piscataway, NJ, USA). Membranes were blocked with 5 % non-fat milk in 1 9 TBST solution for 2 h at RT, and incubated with the following primary antibodies diluted with 5 % non-fat milk in 1 9 TBST: mouse monoclonal anti-GAPDH (1:1000, Sigma-Aldrich), anti-nestin (1:200), anti-cyclic nucleotide phosphodiesterase (CNP) (1:200), anti-glial fibrillary acidic protein (GFAP) (1:200), and anti-Microtubuleassociated protein 2 (MAP-2) (1:200, Millipore) at 4 °C overnight. After washing with TBST, the membrane was incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Dako P0447) for 2 h at RT. Immunoreactive bands were visualized using the ECL Advance Western Blotting Detection Kit (GE Healthcare, Milan, Italy) and Hyper film-ECL film (GE Healthcare). Immunofluorescence Staining 14 days after co-culture of DPSCs with chitosan scaffold, the scaffold was fixed in 4 % PFA in 0.1 M PBS for 1 h, and washed in ice-cold PBS. After embedded in O.C.T. (SAKURA, USA), the scaffolds were sectioned into 15-lm-thick sections using a cryostat (Leica CM1950, Germany), and mounted on poly-lysine-coated glass slides. After drying at RT for 30 min, the sections were blocked, then incubated with mouse monoclonal anti-CNP, antiGFAP, and anti-MAP-2 for 2 h at RT. Sections were washed with PBS, incubated with Alexa Fluor 568-conjugated anti-mouse IgG for 2 h at RT, and then counterstained with Hoechst 33342 (1:2000, Sigma) for 15 min at 4 °C. The immunoreactive signals of cells were observed under a fluorescence microscope (Olympus, Japan). Statistical Analysis Statistical analysis was performed using GraphPad software (GraphPad Prism v4.0, GraphPad Software, San Diego, CA, USA). Data are represented as mean ± SEM, and were submitted to one-way (ANOVA) followed by Newman–Keuls’ multiple comparison test (as a post-hoc
123
test). A P value \0.05 was considered statistically significant.
Results Characterization of Chitosan Scaffolds We used a flat-bottomed 24-well plate to mold the shape of the chitosan scaffold (Fig. 1a). Scaffolds of *16-mm diameter and 5 mm thickness were created (Fig. 1b, c). Its swelling ratio in PBS at 37 °C was 84.33 ± 10.92 %, indicating that the scaffolds thus prepared are extremely hydrophilic, with the capacity to accommodate large quantities of saline solution within their 3D structure. Freeze-drying generated 3D chitosan scaffolds with a linearly aligned, highly porous microstructure. High-resolution imaging of the scaffolds using SEM enabled us to visualize morphological details without losing accuracy of analysis. From this examination, we found that the scaffolds are highly porous, that the pores are extensively interconnected, and that the internal surface of the chitosan scaffold appears to be smooth (Fig. 1d, e). Further examination indicated that the pore diameter of the chitosan scaffold was, on average, 269.87 ± 18.55 lm. Interestingly, the SEM images also indicated that many DPSCs successfully attached to the surface of the scaffold (Fig. 1f). Biocompatibility of DPSCs with the Chitosan Scaffold To determine the biocompatibility of DPSCs with the chitosan scaffold, the DPSCs harvested from the scaffolds by enzymatic digestion were seeded into 96-well plates at the same initial concentration, and subsequently examined for properties determining the health and viability of the cells. The brightfield images shown in Fig. 2 indicate that in the chitosan scaffold-conditioned media, DPSCs grew spindle-shaped (Fig. 2d–f), similar to the normal (negative control) group (Fig. 2a–c) at different time-points following seeding. On the other hand, the cells in the positive control group (DPSCs treated with conditioned media
Cell Mol Neurobiol
Fig. 1 Characterization of chitosan scaffold. a The shape of the 24-well plates for the CGB scaffold is a hollow well-shaped cavity, with a diameter and depth of 15 and 18 mm, respectively. b, c The size of the chitosan scaffold is about 5 and 16 mm in depth and diameter. Scanning electron microscope (SEM) images showing the
morphology and surface structure of the porous chitosan scaffold biomaterial (d, 91,000; e, 91,500) and the adhering with DPSCs (f, 1,5009). The surface of the CGB scaffold is smooth with complex 3D structures
containing lead acetate) lost their spindle shape and became rounded. Most of them appeared dead, and consequently were found floating in suspension in the media (Fig. 2g–i). CCK-8 assay was used to evaluate the cytotoxic profile of the biomaterials used in the chitosan scaffolds, on DPSCs. We found that when compared with the normal group (conditioned media harvested from fresh DPSCs), the viability of chitosan DPSCs was not influenced by co-culture with the scaffold. However, as expected, the lead acetate treatment markedly decreased cell viability (Fig. 2j). These findings suggest that DPSCs can survive and grow well within the chitosan scaffolds, while maintaining good viability.
differentiated neural cell-specific markers CNP (oligodendrocytes), GFAP (astrocytes), and MAP-2 (neurons) were expressed at low levels in DPSCs, but increased significantly at 10 % (CNP), 27 % (GFAP), and 29 % (MAP-2) when cultured in the differentiation-inducing NIM media (Fig. 3b–d). We found a similar pattern of expression of cell type-specific differentiation markers also at the protein level. As shown in Fig. 4, western blotting assay revealed high Nestin expression in undifferentiated DPSCs that decreased in the presence of NIM media, irrespective of the presence of the chitosan scaffold (Fig. 4a). Expression of neural cell type-specific markers CNP, GFAP, and MAP-2 also increased in the differentiated cells, regardless of their attachment to a scaffold, following incubation in NIM media (Fig. 4b–d). We further confirmed these observations by calculating the optical densities of the protein bands normalized to GAPDH. We found a significant decline in nestin expression and upregulation of CNP, GFAP, and MAP-2 expression in differentiation conditions, both with and without the scaffold (Fig. 4a–d). Our observations suggest that attachment to a chitosan scaffold does not impact the multipotency of DPSCs and their ability to successfully differentiate into cells expressing different neural cell type-specific biomarkers. To identify the cellular morphology of DPSC-derived neural cells, both chitosan scaffold-attached as well unattached cells were labeled by immunofluorescent staining against MAP-2, GFAP, and CNP, after induction of
Neural Differentiation of DPSCs within the Chitosan Scaffolds To determine the neural differentiation potential of DPSCs seeded within the chitosan scaffold, we examined the expression of neuronal, astrocytic, and oligodendrocytic markers in differentiated cells. First, we performed RT-PCR assays to determine gene expression at the mRNA level. We found that DPSCs expressed the pan-neural progenitor marker, Nestin, at high levels, irrespective of whether they were cultured with or without the chitosan scaffold (Fig. 3a). However, as expected, induction of differentiation by culturing in NIM media significantly decreased Nestin expression from about 50 to 10 % (normalized to GAPDH, Fig. 3a). In contrast,
123
Cell Mol Neurobiol
Fig. 2 Characterization of chitosan scaffold. a–i Optical microscopic photographs of DPSCs after 24, 48, and 72 h of being seeded. DPSCs cells seeded in the presence of chitosan scaffold; Original
magnification 1009. j The viability of chitosan DPSCs was not influenced by co-culture with the scaffold. However, as expected, the lead acetate treatment markedly decreased cell viability
differentiation. Approximately, 1 % cells were CNP-positive in the DPSC group without NIM induction (Fig. 5a–c, g–i and m). In contrast, *3 % and *5.2 % cells were found to be CNP-positive in the DPSC?NIM group and the S?DPSC?NIM group, respectively (Fig. 5d–f, j–m). While there were very few MAP-2-positive cells in the untreated groups (undifferentiated DPSCs, scaffoldattached or otherwise) (Fig. 6a–c, g–i and m), this percentage increased to 8–12 % after NIM treatment (Fig. 6d– f, j–m). Finally, as shown in Fig. 7, although undifferentiated DPSCs did not express GFAP, incubation in NIM
media induced 70–80 % cells to differentiate into GFAPpositive astrocytes.
123
Discussion Three-dimensional biomimetic scaffolds have wide application in biomedical tissue engineering because of their nanoscaled architecture, including nanofibers and nanopores, that are similar to the extracellular matrix found in vivo. These scaffolds are essential for cellular
Cell Mol Neurobiol Fig. 3 Analysis of DPSCs’s neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by RT-PCR. a RT-PCR analysis of Nestin mRNA expressions. b RT-PCR analysis of CNP mRNA expressions. c RT-PCR analysis of GFAP mRNA expressions. d RT-PCR analysis of MAP-2 mRNA expressions. The level of Nestin were decline, the other levels of these RNA were significantly increased in the DPSC?NIM and S?DPSC?NIM compared with that in DPSC and S?DPSC after culture for 14 days. (*P \ 0.05, n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7)
Fig. 4 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and SC?DPSC and SC?DPSC?NIM by Western blot. a Western blot analysis of Nestin expressions. b Western blot analysis of CNP expressions. c Western blot analysis of GFAP expressions. d Western blot analysis of MAP-2 expressions. The level of Nestin were decline, the other levels of these protein were significantly increased in the DPSC?NIM and S?DPSC?NIM compared with that in DPSC and S?DPSC after BDNF, NGF, and bFGF induction for 14 days. (*P \ 0.05, n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7)
123
Cell Mol Neurobiol Fig. 5 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of CNP (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and S?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM. In this study, CNP and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
organization and intercellular communication within the engineered tissue. However, use of any such scaffold in the closed micro-environment of the brain presents a critical challenge. Some scaffolds described in the literature have provided highly successful environments for
123
cell growth in vitro but are unsuitable for use in clinical practice. The chitosan scaffold is a porous scaffold that can be molded into any shape. It has been studied widely, and used and tested in clinical regenerative medicine.
Cell Mol Neurobiol Fig. 6 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of MAP-2 (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and S?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM. In this study, MAP-2 and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
As expected, due to the hydrophilic nature of the chitosan scaffolds, we obtained an average pore diameter of 269.87 ± 18.55 lm, and a high swelling efficiency of
84.33 ± 10.92 %. SEM analyses demonstrated the highly porous structure, albeit with irregular morphology, of the scaffolds. This is an important and desirable characteristic
123
Cell Mol Neurobiol Fig. 7 Analysis of dental pupl stem cells neural differentiation potential between DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM by immunofluorescence. (a, d, g, j) Immunofluorescence staining of GFAP (red). (b, e, h, k) Blue Hoechst stain. (c, f, i, l) Merge. The immunofluorescence staining of nerve marker in the DPSC?NIM and SC?DPSC?NIM had a high intensity compared with the DPSC and S?DPSC after induction for 14 days. Scale bar = 25 lm. m Quantitative evaluation of differentiated ratio: DPSC versus DPSC?NIM versus S?DPSC versus S?DPSC?NIM. The ratio of positive cells versus total number of cells in the culture: comparison of DPSC and DPSC?NIM and S?DPSC and S?DPSC?NIM In this study, GFAP and rhodopsinpositive cells were counted 14 days after induction. (*P \ 0.05; n = 7; #P \ 0.05, n = 7; &P \ 0.05, n = 7) (Color figure online)
for application in tissue engineering. The porosity is an especially important factor, since the primary purpose of the chitosan scaffolds is to enable and support improved neural differentiation of DPSCs. Porosity is also crucial for
123
cell proliferation, since they provide a conducive structural microenvironment to allow cell migration as well as efficient transport of nutrients and metabolic wastes (Lee et al. 2008).
Cell Mol Neurobiol
The cytotoxicity of biomaterials is an important property that will determine their clinical applicability. Materials used in tissue engineering should ideally not release any toxic products or facilitate adverse reactions, features that can be evaluated through in vitro cytotoxicity tests. There is evidence in the literature that chitosan biopolymers support and enhance cell proliferation (Ji et al. 2011). In addition, several studies have demonstrated that chitosan is a nontoxic, biodegradable, and biocompatible material that can potentially be used in various biomedical applications, including drug delivery, wound dressing, tissue engineering, skin substitutes, nerve regeneration, hemostatic action, implants, and antibacterial coating (Kean and Thanou 2010). Our results corroborate these findings and further show that DPSCs can adhere to and proliferate on the surface of the scaffold, demonstrating the latter’s biocompatibility and lack of cytotoxicity. Results from the CCK-8 assay strongly support this conclusion, implying that chitosan is a good candidate to be considered for use in tissue engineering for delivery of human DPSCs to sites of injury. In vitro neural differentiation studies of rat and human DPSCs have shown that these stem/precursor cell populations have the ability to differentiate into neurons, identified by expression of early neuronal markers and cellular morphology (Miura et al. 2003; Nosrat et al. 2004). In vivo studies have shown that rat DPSCs and human exfoliated deciduous teeth (SHED) survive and express neuronal markers when transplanted into the adult rodent brain (Miura et al. 2003; Nosrat et al. 2004). In this study, we investigated the neural differentiation potential of DPSCs isolated from dental pulp, and potentially derived from neural crest cells. These cells are highly proliferative MSCs and likely to be an optimal source of postnatal stem cells for neural cell replacement therapy (Chai et al. 2000) since they tend to express neural cell type-specific markers even before completing differentiation. This is in accordance with previous reports (Arthur et al. 2008). The growth and differentiation properties of human dental pulp cells was recently investigated on a variety of natural scaffolds, including different types of collagen, gelatin, and chitosan (Kim et al. 2009). In this study, we analyzed the potential of DPSCs to grow and differentiate into multiple types of neural cells within a 3D highly porous chitosan scaffold. Analysis of differentiated cells by immunostaining, western blotting, and RT-PCR proved that DPSCs could indeed differentiate into MAP-21 neurons, GFAP1 astrocytes and CNP1 oligodendrocytes. When DPSCs were seeded into the scaffold and cultured in neural induction media, the expression of these markers was upregulated. Our findings strongly suggest that the chitosan scaffold can be used as a vector to support and transport DPSCs to initiate and facilitate nerve repair.
In summary, the development of biocompatible 3D scaffolds that can be combined with stem cells to provide a suitable vehicle for regenerative therapy is an important new field of biomaterial research. The next step in the use of the chitosan scaffold for neural tissue engineering would be to examine and understand its behavior and properties in clinical conditions. More specifically, it will be important to determine if the physical and mechanical properties of these scaffolds are adequate for clinical use, and to understand if they enable the kind of complete neural differentiation seen in animal experiments. The current study represents the first step in this direction. We have successfully fabricated 3D porous chitosan scaffolds where DPSCs can attach, grow, and differentiate into neural cells. The successful co-culture of DPSCs within the chitosan scaffolds suggests that these stem cells are adequately compatible with this type of biomaterial. This work provides evidence that the use of a chitosan scaffold with DPSCs is a promising approach to pursue in devising therapeutic strategies to facilitate the healing and regeneration of injured brain tissues. Acknowledgments This work was supported by Graduate Student Innovation of Science and Technology Projects in Jiangsu Province and in Nantong University (Grants No.YKC13084); the ‘‘Top Six Types of Talents’’ Financial Assistance of Jiangsu Province Grant (No. 7 and No. 10); National Natural Science Foundation of China (Grant No. 31171038), Jiangsu Natural Science Foundation (BK2011385); the Grant of Nantong University for Innovation Talent and a project funded by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions. We thank Department of Human Anatomy of Medical College in Nantong University for technical assistance and equipment support.
References Arthur A, Rychkov G, Shi S, Koblar SA, Gronthos S (2008) Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 26:1787–1795 Arthur A, Shi S, Zannettino AC, Fujii N, Gronthos S, Koblar SA (2009) Implanted adult human dental pulp stem cells induce endogenous axon guidance. Stem Cells 27:2229–2237 Bjorklund A, Lindvall O (2000) Cell replacement therapies for central nervous system disorders. Nat Neurosci 3:537–544 Chai Y, Jiang X, Ito Y, Bringas P Jr, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 127:1671–1679 d’Aquino R, De Rosa A, Laino G, Caruso F, Guida L, Rullo R, Checchi V, Laino L, Tirino V, Papaccio G (2009) Human dental pulp stem cells: from biology to clinical applications. J Exp Zool B Mol Dev Evol 312B:408–415 Dokmeci MR, Khademhosseini A (2011) Preface to special topic: microfluidics in cell biology and tissue engineering. Biomicrofluidics 5:22101 Feng X, Xing J, Feng G, Sang A, Shen B, Xu Y, Jiang J, Liu S, Tan W, Gu Z, Li L (2013) Age-dependent impaired neurogenic
123
Cell Mol Neurobiol differentiation capacity of dental stem cell is associated with Wnt/beta-catenin signaling. Cell Mol Neurobiol 33:1023–1031 Fukuda J, Khademhosseini A, Yeo Y, Yang X, Yeh J, Eng G, Blumling J, Wang CF, Kohane DS, Langer R (2006) Micromolding of photocrosslinkable chitosan hydrogel for spheroid microarray and co-cultures. Biomaterials 27:5259–5267 Gaspar VM, Sousa F, Queiroz JA, Correia IJ (2011) Formulation of chitosan-TPP-pDNA nanocapsules for gene therapy applications. Nanotechnology 22:015101 Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 97:13625–13630 Itoh S, Suzuki M, Yamaguchi I, Takakuda K, Kobayashi H, Shinomiya K, Tanaka J (2003a) Development of a nerve scaffold using a tendon chitosan tube. Artif Organs 27:1079–1088 Itoh S, Yamaguchi I, Suzuki M, Ichinose S, Takakuda K, Kobayashi H, Shinomiya K, Tanaka J (2003b) Hydroxyapatite-coated tendon chitosan tubes with adsorbed laminin peptides facilitate nerve regeneration in vivo. Brain Res 993:111–123 Ji C, Khademhosseini A, Dehghani F (2011) Enhancing cell penetration and proliferation in chitosan hydrogels for tissue engineering applications. Biomaterials 32:9719–9729 Kas HS (1997) Chitosan: properties, preparations and application to microparticulate systems. J Microencapsul 14:689–711 Kean T, Thanou M (2010) Biodegradation, biodistribution and toxicity of chitosan. Adv Drug Deliv Rev 62:3–11 Kerkis I, Ambrosio CE, Kerkis A, Martins DS, Zucconi E, Fonseca SA, Cabral RM, Maranduba CM, Gaiad TP, Morini AC, Vieira NM, Brolio MP, Sant’Anna OA, Miglino MA, Zatz M (2008) Early transplantation of human immature dental pulp stem cells from baby teeth to golden retriever muscular dystrophy (GRMD) dogs: local or systemic? J Transl Med 6:35 Kim IY, Seo SJ, Moon HS, Yoo MK, Park IY, Kim BC, Cho CS (2008) Chitosan and its derivatives for tissue engineering applications. Biotechnol Adv 26:1–21 Kim NR, Lee DH, Chung PH, Yang HC (2009) Distinct differentiation properties of human dental pulp cells on collagen, gelatin, and chitosan scaffolds. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 108:e94–e100 Lee M, Wu BM, Dunn JC (2008) Effect of scaffold architecture and pore size on smooth muscle cell growth. J Biomed Mater Res A 87:1010–1016
123
Li Z, Ramay HR, Hauch KD, Xiao D, Zhang M (2005) Chitosanalginate hybrid scaffolds for bone tissue engineering. Biomaterials 26:3919–3928 Li X, Yang Z, Zhang A, Wang T, Chen W (2009) Repair of thoracic spinal cord injury by chitosan tube implantation in adult rats. Biomaterials 30:1121–1132 Muzzarelli RA (2010) Chitins and chitosans as immunoadjuvants and non-allergenic drug carriers. Mar Drugs 8:292–312 Nakashima M, Akamine A (2005) The application of tissue engineering to regeneration of pulp and dentin in endodontics. J Endod 31:711–718 Nosrat IV, Smith CA, Mullally P, Olson L, Nosrat CA (2004) Dental pulp cells provide neurotrophic support for dopaminergic neurons and differentiate into neurons in vitro; implications for tissue engineering and repair in the nervous system. Eur J Neurosci 19:2388–2398 Ribeiro MP, Espiga A, Silva D, Baptista P, Henriques J, Ferreira C, Silva JC, Borges JP, Pires E, Chaves P, Correia IJ (2009) Development of a new chitosan hydrogel for wound dressing. Wound Repair Regen 17:817–824 Sakai K, Yamamoto A, Matsubara K, Nakamura S, Naruse M, Yamagata M, Sakamoto K, Tauchi R, Wakao N, Imagama S, Hibi H, Kadomatsu K, Ishiguro N, Ueda M (2012) Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuroregenerative mechanisms. J Clin Invest 122:80–90 Shi W, Nie D, Jin G, Chen W, Xia L, Wu X, Su X, Xu X, Ni L, Zhang X, Chen J (2012) BDNF blended chitosan scaffolds for human umbilical cord MSC transplants in traumatic brain injury therapy. Biomaterials 33:3119–3126 Tamaki Y, Nakahara T, Ishikawa H, Sato S (2013) In vitro analysis of mesenchymal stem cells derived from human teeth and bone marrow. Odontology 101:121–132 Xu Y, Gu Z, Shen B, Xu G, Zhou T, Jiang J, Xing J, Liu S, Li M, Tan W, Feng G, Sang A, Li L (2013) Roles of Wnt/beta-catenin signaling in retinal neuron-like differentiation of bone marrow mesenchymal stem cells from nonobese diabetic mice. J Mol Neurosci 49:250–261 Yamagata M, Yamamoto A, Kako E, Kaneko N, Matsubara K, Sakai K, Sawamoto K, Ueda M (2013) Human dental pulp-derived stem cells protect against hypoxic-ischemic brain injury in neonatal mice. Stroke 44:551–554
