Accepted Article
Received Date : 09-Jan-2014 Accepted Date : 30-May-2014 Article type
: Original Paper
Wuchereria bancrofti 20/22 a homologue of Abundant Larval Transcript L3 stage filarial antigen: molecular and immunological characterization
a
Aparnaa Ramanathana, Mahalakshmi Natarajana, Harini Asaia, Jeyaprita Parasurama Jawharlala, Anugraha Gandhirajana, Nitin Purushotatam Amdareb, Vishal Kishor Khatrib, Maryada Venkata Rami Reddyb, Perumal Kaliraja* Centre For Biotechnology, Anna University, Chennai 600025, India
Centre for Biotechnology, Anna University, Guindy, Chennai-600025, Tamilnadu, India.
b
Department of Biochemistry, Mahatma Gandhi Institute of Medical Sciences, Sevagram 442102,
India
* Corresponding Author (P.Kaliraj): Tel.: +91 44 22350772; fax: +91 44 22352642. E-mail address: [email protected]
Abstract: The Chromadorea Abundant Larval Transcript (ALT) family of proteins contains ALT, one of the most studied putative vaccine candidate in experimental filariasis. This study reports the
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/pim.12120 This article is protected by copyright. All rights reserved.
Accepted Article
characterization of Wuchereria bancrofti 20/22 (Wb20/22) as a member of chromadorea the ALT family of proteins from the L3 stage of W.bancrofti. The high reactivity with serum from the Endemic Normal (EN) population sugggests that Wb20/22 could be a target of elicit protective immunity. The glutamic acid rich region of Wb20/22 was predicted to harbor the longest linear Bcell epitope by insilico prediction tools. The significance of this region was revealed by studying the mutant form of Wb20/22, Without Acidic Domain (WOAD) which was cloned and the immune response was compared with Wb20/22. The signal sequence of Wb20/22 was also an immunodominant region, and mutant construct without signal sequence (WOSS) was cloned and characterized. The peak antibody titer elicited by WOAD was higher than Wb20/22 or WOSS, which pointed to the immunomodulatory role of glutamic acid rich region. Wb20/22 elicited very high levels of IL-10 and diminished levels of IL-4 and IL-5 which could be the reason for low antibody titer. The prophylactic efficacy of WOAD conferred protection (62.26%) which was higher than Wb20/22 (49.82%) and WOSS (54.78%).
Key words: Filariasis, Abundant Larval Transcript, W.bancrofti 20/22, Th1, Th2, B epitope, T
epitope, Vaccine
1. INTRODUCTION Lymphatic filariasis is a debilitating disease, associated with morbidity rather than mortality, is caused by Wuchereria bancrofti and Brugia malayi (1). The clinical manifestations of this disease are mainly due to the overt immune response elicited by the host. These parasites employ various immunomodulatory evasion strategies during the larval stage, that results in suppression of the host immune system from generating inflammatory response, which serves as a target for establishment
This article is protected by copyright. All rights reserved.
Accepted Article
of infection (2). In order to prevent this debilitating disease, apart from chemotherapeutic methods, prophylactic vaccination strategy has to be put into practice, especially in the endemic regions. The protective immune response elicited towards the larval stages may inhibit the development, growth and molting of L3 to L4 (3-5), suggesting that neutralization of these targets might help combating the evasion strategies adopted by filarial nematodes. Protection studies in jirds gave a promising result of 74% parasite clearance upon immunization with recombinant ALT (rALT) protein (6).Other filarial nematode species also possess ALTlike genes (7-8) with the characteristic signal peptide, variable acidic domain and a conserved cysteine rich domain. However identification of new vaccine candidate from the same family might prove to be more promising as ALT like genes vary in their acidic domain hence could trigger protective immunity. In this study we identified a gene Wb20/22 from Wuchereria bancrofti L3 cDNA that was 86% identical to ALT with strikingly similar characteristic features. We thus cloned the gene encoding this protein and evaluated the immune response of this protein in the human population and in an animal model as well as studying parasite clearance.
2. Materials and Methods
2.1 Cloning of Wuchereria bancrofti 20/22 (Wb20/22) The Wb20/22 gene from Wuchereria bancrofti was amplified from L3 stage specific cDNA library using gene specific primers. The open reading frame (ORF) of Wb20/22 was cloned in T7 expression vector, pRSET A (Invitrogen). Wb20/22 was PCR amplified with following primer sequences in forward 5’ CGGGATCCCGAATGAACAAACTTTTAATAG 3’ and reverse 5’ CCAAGCTTGGTCAATCGTACGAAC 3’ flanking BamHI and HindIII restriction sites. Wb20/22 mutant WOSS was cloned in T7 expression vector, pRSET B using the following primer sequences in
forward
5’CGCGGATCCGCGAAAACAATCAA3’
This article is protected by copyright. All rights reserved.
and
reverse
5’
Accepted Article
CCAAGCTTGGTCAATCGTACGAAC 3’ flanked by
BamHI and HindIII restriction sites.
Wb20/22 mutant WOAD was constructed using internal primers flanked by XhoI restriction site as 96bp and 269bp product. The above mentioned forward primer and reverse primer 5’ CCCTCGAGGGTGCTTCATTTGATTGTTT 3’ was used for 96bp amplicon. Forward primer 5’GGCTCGAGCCGAATATACGGCTAAA 3’ and reverse primer with HindIII restriction site of Wb20/22 was used to amplify the 269bp product. Both products were PCR amplified and ligated. This 330bp product was cloned in T7 expression vector pRSETA (henceforth will be referred as pRA) (Fig 1). All the clones were confirmed by sequencing. The PCR conditions for amplification was kept at 60°C for all the genes.
2.2 Expression and Purification of Wb20/22, WOSS and WOAD For expression, the recombinant pRAWb20/22 was transformed in E.coli BL21 RIL Codon
plus strain (Stratagene) to overcome reduced expression due to the presence of rare codons. When the OD600 of the culture reached 0.8, 1mM of IPTG (Isopropyl thio-β-D-galacto pyranoside) was
added to induce gene expression and incubated at 28°C for 3hours. Expression was analysed on SDS-PAGE, which was confirmed by western blot analysis with anti histidine antibody (Sigma). His-tagged Wb20/22 was purified by immobilized metal affinity chromatography (IMAC) on chelating sepharose fast flow (Ni2+) matrix (Amersham Pharmacia Biotech).Wb20/22 protein was eluted at 100mM imidazole. The same conditions were followed for expression and purification of WOSS protein which appeared around 25Kda.
E.coli GJ1158 strain was transformed with recombinant plasmid pRAWOAD. Osmotic inducer 100mM NaCl was added to induce expression at 0.6 O.D (at 600nm) for 4 hours at 37°C.The expressed protein was confirmed by western analysis with anti-His antibody. WOAD was purified by gel electro elution method as described previously (9).
This article is protected by copyright. All rights reserved.
Accepted Article
2.3 Collection of Human Sera The blood samples were collected from different clinical groups of lymphatic filariasis patients from endemic regions. Individuals residing in villages around Vellore town, Tamil Nadu were enrolled for the study after obtaining an informed consent in accordance with the guidelines of the human ethical committee of Anna University, Chennai. Sera were classified into Microfilaraemia (MF), Chronic Pathology (CP) or Endemic Normal (EN) based on the detection of circulating parasites, parasite antigens or by evaluating clinical symptoms of lymphatic filariasis. Circulating microfilariae were detected in the blood of subjects as described previously (10). The presence of circulating antigen was detected using an Og4C3 kit (11) and a WbSXP based enzyme-linked immunosorbent assay (ELISA) (12). Serum from individuals living in non-endemic region (Non
endemic normal, NEN) (European), was used as control.
2.4 Reactivity with clinical sera and Isotype determination The reactivity of clinical serum against Wb20/22, WOSS and WOAD was performed by
ELISA as described previously (13). The level of human antibody isotype against Wb20/22, WOSS, WOAD and BmALT-2 (henceforth ALT) was determined using ELISA according to the manufacturer’s protocol (Sigma Aldrich).
2.5 Immunization of Jirds with Wb20/2, WOSS and WOAD Six to eight week old male jirds were procured from Mahatma Gandhi Institute of Medical
Sciences, Sevagram, Maharashtra, India. All experiments were performed in accordance with ‘Indian Animal Ethics Committee’ regulations and experiment protocol was approved by institutional animal care committee. A group of 6 jirds was injected via the intraperitoneal route with: 25µg of Wb20/22 suspended in 100µl of PBS and mixed with alum at 1:1 ratio or 25µg of WOSS or 25µg of WOAD were also immunized in the same manner with alum. The same dose of
This article is protected by copyright. All rights reserved.
Accepted Article
booster was given on days 14, 21, 28 and 35. Blood was collected on days 0, 14, 21, 28, 35 and 42. Serum was separated and stored at -80°C.
2.6 Titration of Anti Wb20/22, Anti WOSS and Anti WOAD antibodies Antigen-specific IgG levels in the sera were determined by ELISA. Polyvinyl micro titer
plates were coated with Wb20/22, WOSS or WOAD (100ng/well). The plates were blocked with 5% skimmed milk, and after washing with PBST and PBS a 2 fold serial dilution was performed using respective antisera. The colour was developed using anti-mouse antibody conjugated with alkaline phosphatase / p-nitrophenyl phosphate substrate (1 mg/ml) in substrate buffer and absorbance was recorded at 405nm.
2.7 ELISA to determine Isotype specific antibodies For determination of antibody isotypes, serum diluted at 1:100 from different immunization
groups were incubated for 1hr at 37°C, with proteins coated on ELISA plates. Isotype ELISA was performed as per manufacturer instruction (Sigma). The absorbance was recorded at 405nm.
2.8 Splenocyte Proliferation Assay To study T cell response induced by Wb20/22, WOSS and WOAD splenocyte proliferation
assay was performed(14). jirds were splenectomized aseptically and the Splenocytes were separated and washed twice with fresh culture medium RPMI 1640. Lysis buffer (0.1% ammonium chloride) was added to the pellet to remove the red blood cells and then the lymphocytes were counted. The single cell suspension was cultured in triplicate in 96-well plates at 2 x106 cells/ml in RPMI 1640 medium (100 µl/well) supplemented with gentamycin (80 µg/ml), 25 mM HEPES, 2 mM glutamine
This article is protected by copyright. All rights reserved.
Accepted Article
and 10% fetal bovine serum. The cells were then stimulated in vitro with recombinant proteins, ALT antigen or positive control Concanavalin A (Con A) (1 µg/well each). Cell proliferation was performed as per manufacturer’s protocol (USB, Amersham Pharmacia).
2.9 Analysis of Cytokine levels
For cytokine analysis 4x106 cells/ml were stimulated with Wb20/22, WOSS, WOAD or ALT. The culture supernatants were centrifuged at 5000rpm for 15 min, passed through a 0.22-µm filter and assayed for cytokine levels using sandwich ELISA for anti-mouse IL-2, IL-4, IL-5 and IFN-γ(eBiosciences) according to the manufacturer’s instructions. All concentrations were derived from standard curves and data expressed in pg/ml.
2.10 Immunoprotection studies The immunized jirds were challenged with parasites recovered from insects by crushing them (15). 10 Live B.malayi L3 larvae were counted under the microscope and inoculated into each micropore chamber. The chambers were implanted in the peritoneum of jirds for 48 hours at which time the animals were sacrificed and micropore chambers were recovered. The contents of each chamber were examined microscopically for cell adherence, and viability of parasites. The percentage protection was expressed as the average number of worms recovered from the control animals minus average number of worms recovered from the vaccinated animals/average number of worms recovered from the control animal’s×100.
2.11 Statistical analysis Statistical analysis was performed using Graphpad Prism version 5(GraphPad Software,
USA). Comparisons between two individual data points were made using a Student’s t-test. For
This article is protected by copyright. All rights reserved.
Accepted Article
multiple comparisons ANOVA, along with the Bonferroni’s post-test was used. A probability (P) value ≤0.05was considered statistically significant.
3 RESULTS 3.1 Isolation and sequence analysis of Wb20/22 Wb20/22 (NCBI accession number AF285860.1) was a 558bp PCR amplicon from the L3
stage cDNA library of Wuchereria bancrofti (Fig 2). The Wb20/22 clone encoded a single ORF acidic protein (pI - 4.18) of 185 amino acids with a calculated molecular mass of 21.7 kDa. Nucleotide BLAST of Wb20/22 showed an 86% similarity with Brugia malayi ALT-2 variant-alt2b (AF183574) and Brugia malayi ALT-2 variant -Alt2a. A 82% identity with Acanthocheilonema viteae Av18 (AVU47545) and 80% with Dirofilaria immitis larval 20/22 kDa protein (DIU29459) was also identified. Further, Wb20/22 gene also showed 76% & 79% identity to Chromadorea ALT protein (Bm1_14360) and Bm ALT2 protein (AF183573) respectively. Multiple sequence alignment of Wb20/22 with other ALT genes revealed the difference in the variable acidic region of Wb20/22 (Fig 3). To indentify the antigenic properties of the Wb20/22, the epitopic regions of this protein
were mapped in B epipred tool (16). The longest linear epitope was found to be from 19 to 121 amino acid. Domain analysis of this protein using scan prosite (17) revealed that amino acid positions 25 to 104 was Glutamic acid rich, which falls within the above identified epitopic region.
3.2 Cloning of Wb20/22 The open reading frame (ORF) of Wb20/22 was cloned in T7 expression vector, pRSET A
(Invitrogen, CA, USA). Wb20/22 was PCR amplified from L3 cDNA library using gene specific
This article is protected by copyright. All rights reserved.
Accepted Article
primers and cloned in pRSETA vector at BamHI and HindIII sites with T4 DNA Ligase. WOSS was cloned in pRSETB vector to study the role of N-terminal signal sequence in Wb20/22. In order to identify the role of glutamic acid domain, Wb20/22 was cloned in the absence of acidic domain (WOAD) by using internal primers.
All the clones were sequenced with T7 vector specific
primers.
3.3 Expression and Purification The said clones were expressed as histidine tagged fusion proteins. The SDS-PAGE profile
of whole cell lysate showed an apparent mass of 25kDa for Wb20/22, WOSS. WOAD was expressed at 18kDa and a dimer was observed at 35kDa The recombinant protein Wb20/22 was purified by Nickel affinity chromatography and eluted in 100mM imidazole. WOAD protein was purified by Gel electro elution. Western blot confirmed the presence of 25kDa for purified Wb20/22, WOSS and 18Kda for purified WOAD against anti histidine antibody (Fig 4). The protein preparations were checked for the presence of endotoxins by the Limulus Amebocyte Lysate (LAL) assay, which indicated that the protein preparations had endotoxin activity less than 0.5 EU/ mg endotoxin by weight. According to the European Pharmacopoeia the safety level for endovenous administration is 5 EU/kg/h that corresponds to 0.1 EU per mouse 20 g/per hour (18).
3.4 Humoral reactivity of Wb20/22, WOSS, WOAD &ALT with clinical serum samples Wb20/22 showed differential reactivity among the clinical serum samples EN, MF, CP &
NEN. ELISA results showed that significant amounts of anti Wb20/22, anti WOSS, anti WOAD and anti ALT antibodies were present in the sera of EN, MF and CP individuals compared to sera from NEN individuals (Fig 5). Further the data suggested that EN individuals show significantly (one way ANOVA P
Received Date : 09-Jan-2014 Accepted Date : 30-May-2014 Article type
: Original Paper
Wuchereria bancrofti 20/22 a homologue of Abundant Larval Transcript L3 stage filarial antigen: molecular and immunological characterization
a
Aparnaa Ramanathana, Mahalakshmi Natarajana, Harini Asaia, Jeyaprita Parasurama Jawharlala, Anugraha Gandhirajana, Nitin Purushotatam Amdareb, Vishal Kishor Khatrib, Maryada Venkata Rami Reddyb, Perumal Kaliraja* Centre For Biotechnology, Anna University, Chennai 600025, India
Centre for Biotechnology, Anna University, Guindy, Chennai-600025, Tamilnadu, India.
b
Department of Biochemistry, Mahatma Gandhi Institute of Medical Sciences, Sevagram 442102,
India
* Corresponding Author (P.Kaliraj): Tel.: +91 44 22350772; fax: +91 44 22352642. E-mail address: [email protected]
Abstract: The Chromadorea Abundant Larval Transcript (ALT) family of proteins contains ALT, one of the most studied putative vaccine candidate in experimental filariasis. This study reports the
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/pim.12120 This article is protected by copyright. All rights reserved.
Accepted Article
characterization of Wuchereria bancrofti 20/22 (Wb20/22) as a member of chromadorea the ALT family of proteins from the L3 stage of W.bancrofti. The high reactivity with serum from the Endemic Normal (EN) population sugggests that Wb20/22 could be a target of elicit protective immunity. The glutamic acid rich region of Wb20/22 was predicted to harbor the longest linear Bcell epitope by insilico prediction tools. The significance of this region was revealed by studying the mutant form of Wb20/22, Without Acidic Domain (WOAD) which was cloned and the immune response was compared with Wb20/22. The signal sequence of Wb20/22 was also an immunodominant region, and mutant construct without signal sequence (WOSS) was cloned and characterized. The peak antibody titer elicited by WOAD was higher than Wb20/22 or WOSS, which pointed to the immunomodulatory role of glutamic acid rich region. Wb20/22 elicited very high levels of IL-10 and diminished levels of IL-4 and IL-5 which could be the reason for low antibody titer. The prophylactic efficacy of WOAD conferred protection (62.26%) which was higher than Wb20/22 (49.82%) and WOSS (54.78%).
Key words: Filariasis, Abundant Larval Transcript, W.bancrofti 20/22, Th1, Th2, B epitope, T
epitope, Vaccine
1. INTRODUCTION Lymphatic filariasis is a debilitating disease, associated with morbidity rather than mortality, is caused by Wuchereria bancrofti and Brugia malayi (1). The clinical manifestations of this disease are mainly due to the overt immune response elicited by the host. These parasites employ various immunomodulatory evasion strategies during the larval stage, that results in suppression of the host immune system from generating inflammatory response, which serves as a target for establishment
This article is protected by copyright. All rights reserved.
Accepted Article
of infection (2). In order to prevent this debilitating disease, apart from chemotherapeutic methods, prophylactic vaccination strategy has to be put into practice, especially in the endemic regions. The protective immune response elicited towards the larval stages may inhibit the development, growth and molting of L3 to L4 (3-5), suggesting that neutralization of these targets might help combating the evasion strategies adopted by filarial nematodes. Protection studies in jirds gave a promising result of 74% parasite clearance upon immunization with recombinant ALT (rALT) protein (6).Other filarial nematode species also possess ALTlike genes (7-8) with the characteristic signal peptide, variable acidic domain and a conserved cysteine rich domain. However identification of new vaccine candidate from the same family might prove to be more promising as ALT like genes vary in their acidic domain hence could trigger protective immunity. In this study we identified a gene Wb20/22 from Wuchereria bancrofti L3 cDNA that was 86% identical to ALT with strikingly similar characteristic features. We thus cloned the gene encoding this protein and evaluated the immune response of this protein in the human population and in an animal model as well as studying parasite clearance.
2. Materials and Methods
2.1 Cloning of Wuchereria bancrofti 20/22 (Wb20/22) The Wb20/22 gene from Wuchereria bancrofti was amplified from L3 stage specific cDNA library using gene specific primers. The open reading frame (ORF) of Wb20/22 was cloned in T7 expression vector, pRSET A (Invitrogen). Wb20/22 was PCR amplified with following primer sequences in forward 5’ CGGGATCCCGAATGAACAAACTTTTAATAG 3’ and reverse 5’ CCAAGCTTGGTCAATCGTACGAAC 3’ flanking BamHI and HindIII restriction sites. Wb20/22 mutant WOSS was cloned in T7 expression vector, pRSET B using the following primer sequences in
forward
5’CGCGGATCCGCGAAAACAATCAA3’
This article is protected by copyright. All rights reserved.
and
reverse
5’
Accepted Article
CCAAGCTTGGTCAATCGTACGAAC 3’ flanked by
BamHI and HindIII restriction sites.
Wb20/22 mutant WOAD was constructed using internal primers flanked by XhoI restriction site as 96bp and 269bp product. The above mentioned forward primer and reverse primer 5’ CCCTCGAGGGTGCTTCATTTGATTGTTT 3’ was used for 96bp amplicon. Forward primer 5’GGCTCGAGCCGAATATACGGCTAAA 3’ and reverse primer with HindIII restriction site of Wb20/22 was used to amplify the 269bp product. Both products were PCR amplified and ligated. This 330bp product was cloned in T7 expression vector pRSETA (henceforth will be referred as pRA) (Fig 1). All the clones were confirmed by sequencing. The PCR conditions for amplification was kept at 60°C for all the genes.
2.2 Expression and Purification of Wb20/22, WOSS and WOAD For expression, the recombinant pRAWb20/22 was transformed in E.coli BL21 RIL Codon
plus strain (Stratagene) to overcome reduced expression due to the presence of rare codons. When the OD600 of the culture reached 0.8, 1mM of IPTG (Isopropyl thio-β-D-galacto pyranoside) was
added to induce gene expression and incubated at 28°C for 3hours. Expression was analysed on SDS-PAGE, which was confirmed by western blot analysis with anti histidine antibody (Sigma). His-tagged Wb20/22 was purified by immobilized metal affinity chromatography (IMAC) on chelating sepharose fast flow (Ni2+) matrix (Amersham Pharmacia Biotech).Wb20/22 protein was eluted at 100mM imidazole. The same conditions were followed for expression and purification of WOSS protein which appeared around 25Kda.
E.coli GJ1158 strain was transformed with recombinant plasmid pRAWOAD. Osmotic inducer 100mM NaCl was added to induce expression at 0.6 O.D (at 600nm) for 4 hours at 37°C.The expressed protein was confirmed by western analysis with anti-His antibody. WOAD was purified by gel electro elution method as described previously (9).
This article is protected by copyright. All rights reserved.
Accepted Article
2.3 Collection of Human Sera The blood samples were collected from different clinical groups of lymphatic filariasis patients from endemic regions. Individuals residing in villages around Vellore town, Tamil Nadu were enrolled for the study after obtaining an informed consent in accordance with the guidelines of the human ethical committee of Anna University, Chennai. Sera were classified into Microfilaraemia (MF), Chronic Pathology (CP) or Endemic Normal (EN) based on the detection of circulating parasites, parasite antigens or by evaluating clinical symptoms of lymphatic filariasis. Circulating microfilariae were detected in the blood of subjects as described previously (10). The presence of circulating antigen was detected using an Og4C3 kit (11) and a WbSXP based enzyme-linked immunosorbent assay (ELISA) (12). Serum from individuals living in non-endemic region (Non
endemic normal, NEN) (European), was used as control.
2.4 Reactivity with clinical sera and Isotype determination The reactivity of clinical serum against Wb20/22, WOSS and WOAD was performed by
ELISA as described previously (13). The level of human antibody isotype against Wb20/22, WOSS, WOAD and BmALT-2 (henceforth ALT) was determined using ELISA according to the manufacturer’s protocol (Sigma Aldrich).
2.5 Immunization of Jirds with Wb20/2, WOSS and WOAD Six to eight week old male jirds were procured from Mahatma Gandhi Institute of Medical
Sciences, Sevagram, Maharashtra, India. All experiments were performed in accordance with ‘Indian Animal Ethics Committee’ regulations and experiment protocol was approved by institutional animal care committee. A group of 6 jirds was injected via the intraperitoneal route with: 25µg of Wb20/22 suspended in 100µl of PBS and mixed with alum at 1:1 ratio or 25µg of WOSS or 25µg of WOAD were also immunized in the same manner with alum. The same dose of
This article is protected by copyright. All rights reserved.
Accepted Article
booster was given on days 14, 21, 28 and 35. Blood was collected on days 0, 14, 21, 28, 35 and 42. Serum was separated and stored at -80°C.
2.6 Titration of Anti Wb20/22, Anti WOSS and Anti WOAD antibodies Antigen-specific IgG levels in the sera were determined by ELISA. Polyvinyl micro titer
plates were coated with Wb20/22, WOSS or WOAD (100ng/well). The plates were blocked with 5% skimmed milk, and after washing with PBST and PBS a 2 fold serial dilution was performed using respective antisera. The colour was developed using anti-mouse antibody conjugated with alkaline phosphatase / p-nitrophenyl phosphate substrate (1 mg/ml) in substrate buffer and absorbance was recorded at 405nm.
2.7 ELISA to determine Isotype specific antibodies For determination of antibody isotypes, serum diluted at 1:100 from different immunization
groups were incubated for 1hr at 37°C, with proteins coated on ELISA plates. Isotype ELISA was performed as per manufacturer instruction (Sigma). The absorbance was recorded at 405nm.
2.8 Splenocyte Proliferation Assay To study T cell response induced by Wb20/22, WOSS and WOAD splenocyte proliferation
assay was performed(14). jirds were splenectomized aseptically and the Splenocytes were separated and washed twice with fresh culture medium RPMI 1640. Lysis buffer (0.1% ammonium chloride) was added to the pellet to remove the red blood cells and then the lymphocytes were counted. The single cell suspension was cultured in triplicate in 96-well plates at 2 x106 cells/ml in RPMI 1640 medium (100 µl/well) supplemented with gentamycin (80 µg/ml), 25 mM HEPES, 2 mM glutamine
This article is protected by copyright. All rights reserved.
Accepted Article
and 10% fetal bovine serum. The cells were then stimulated in vitro with recombinant proteins, ALT antigen or positive control Concanavalin A (Con A) (1 µg/well each). Cell proliferation was performed as per manufacturer’s protocol (USB, Amersham Pharmacia).
2.9 Analysis of Cytokine levels
For cytokine analysis 4x106 cells/ml were stimulated with Wb20/22, WOSS, WOAD or ALT. The culture supernatants were centrifuged at 5000rpm for 15 min, passed through a 0.22-µm filter and assayed for cytokine levels using sandwich ELISA for anti-mouse IL-2, IL-4, IL-5 and IFN-γ(eBiosciences) according to the manufacturer’s instructions. All concentrations were derived from standard curves and data expressed in pg/ml.
2.10 Immunoprotection studies The immunized jirds were challenged with parasites recovered from insects by crushing them (15). 10 Live B.malayi L3 larvae were counted under the microscope and inoculated into each micropore chamber. The chambers were implanted in the peritoneum of jirds for 48 hours at which time the animals were sacrificed and micropore chambers were recovered. The contents of each chamber were examined microscopically for cell adherence, and viability of parasites. The percentage protection was expressed as the average number of worms recovered from the control animals minus average number of worms recovered from the vaccinated animals/average number of worms recovered from the control animal’s×100.
2.11 Statistical analysis Statistical analysis was performed using Graphpad Prism version 5(GraphPad Software,
USA). Comparisons between two individual data points were made using a Student’s t-test. For
This article is protected by copyright. All rights reserved.
Accepted Article
multiple comparisons ANOVA, along with the Bonferroni’s post-test was used. A probability (P) value ≤0.05was considered statistically significant.
3 RESULTS 3.1 Isolation and sequence analysis of Wb20/22 Wb20/22 (NCBI accession number AF285860.1) was a 558bp PCR amplicon from the L3
stage cDNA library of Wuchereria bancrofti (Fig 2). The Wb20/22 clone encoded a single ORF acidic protein (pI - 4.18) of 185 amino acids with a calculated molecular mass of 21.7 kDa. Nucleotide BLAST of Wb20/22 showed an 86% similarity with Brugia malayi ALT-2 variant-alt2b (AF183574) and Brugia malayi ALT-2 variant -Alt2a. A 82% identity with Acanthocheilonema viteae Av18 (AVU47545) and 80% with Dirofilaria immitis larval 20/22 kDa protein (DIU29459) was also identified. Further, Wb20/22 gene also showed 76% & 79% identity to Chromadorea ALT protein (Bm1_14360) and Bm ALT2 protein (AF183573) respectively. Multiple sequence alignment of Wb20/22 with other ALT genes revealed the difference in the variable acidic region of Wb20/22 (Fig 3). To indentify the antigenic properties of the Wb20/22, the epitopic regions of this protein
were mapped in B epipred tool (16). The longest linear epitope was found to be from 19 to 121 amino acid. Domain analysis of this protein using scan prosite (17) revealed that amino acid positions 25 to 104 was Glutamic acid rich, which falls within the above identified epitopic region.
3.2 Cloning of Wb20/22 The open reading frame (ORF) of Wb20/22 was cloned in T7 expression vector, pRSET A
(Invitrogen, CA, USA). Wb20/22 was PCR amplified from L3 cDNA library using gene specific
This article is protected by copyright. All rights reserved.
Accepted Article
primers and cloned in pRSETA vector at BamHI and HindIII sites with T4 DNA Ligase. WOSS was cloned in pRSETB vector to study the role of N-terminal signal sequence in Wb20/22. In order to identify the role of glutamic acid domain, Wb20/22 was cloned in the absence of acidic domain (WOAD) by using internal primers.
All the clones were sequenced with T7 vector specific
primers.
3.3 Expression and Purification The said clones were expressed as histidine tagged fusion proteins. The SDS-PAGE profile
of whole cell lysate showed an apparent mass of 25kDa for Wb20/22, WOSS. WOAD was expressed at 18kDa and a dimer was observed at 35kDa The recombinant protein Wb20/22 was purified by Nickel affinity chromatography and eluted in 100mM imidazole. WOAD protein was purified by Gel electro elution. Western blot confirmed the presence of 25kDa for purified Wb20/22, WOSS and 18Kda for purified WOAD against anti histidine antibody (Fig 4). The protein preparations were checked for the presence of endotoxins by the Limulus Amebocyte Lysate (LAL) assay, which indicated that the protein preparations had endotoxin activity less than 0.5 EU/ mg endotoxin by weight. According to the European Pharmacopoeia the safety level for endovenous administration is 5 EU/kg/h that corresponds to 0.1 EU per mouse 20 g/per hour (18).
3.4 Humoral reactivity of Wb20/22, WOSS, WOAD &ALT with clinical serum samples Wb20/22 showed differential reactivity among the clinical serum samples EN, MF, CP &
NEN. ELISA results showed that significant amounts of anti Wb20/22, anti WOSS, anti WOAD and anti ALT antibodies were present in the sera of EN, MF and CP individuals compared to sera from NEN individuals (Fig 5). Further the data suggested that EN individuals show significantly (one way ANOVA P
