Pathology – Research and Practice 210 (2014) 205–209

Contents lists available at ScienceDirect

Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp

Original Article

Correlation of laryngeal squamous cell carcinoma and infections with either HHV-8 or HPV-16/18 Nema Mohamadian Roshan a , Amirhossein Jafarian a,∗ , Hossein Ayatollahi b , Kiarash Ghazvini c , Seyyed Abbas Tabatabaee a a

Department of Pathology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran Cancer Molecular Pathology Research Center, Department of Hematology and Blood Bank, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran c Department of Microbiology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran b

a r t i c l e

i n f o

Article history: Received 25 August 2012 Received in revised form 5 August 2013 Accepted 2 December 2013 Keywords: HPV-16 HPV-18 HHV-8 Laryngeal cancer

a b s t r a c t Each year more than 159,000 new cases of laryngeal cancer are diagnosed globally, and more than 9000 patients die due to this malignancy. Viral infections are a known risk factor for this malignancy. Thus, this study aimed to evaluate the role of HPV-16/18 and HHV-8 infection in patients with laryngeal cancer. In this case–control study, 60 formalin-fixed, paraffin-embedded samples of laryngeal cancer and 22 normal larynx tissue samples from the Pathology Department of Qaem Hospital, Mashhad, Iran were studied. After validating the diagnosis, the samples were evaluated for the detection of HPV-16/18 and HHV-8 DNA using PCR technique. The data were registered and analyzed using SPSS 18.0. The average age for patients and controls was 61.29 ± 11.89 and 55.77 ± 10.10, respectively. Fifty-four patients (90%) and 16 (72.7%) controls were male. PCR results detected no HPV-16/18 DNA in both groups. Although there were 2 positive HHV-8 samples in both laryngeal cancer and normal larynx samples, no significant relation was present (p = 0.291). We found no significant relationship between infection with HHV-8 or HPV-16/18 and the existence of laryngeal cancer. However, more complementary studies are required to re-evaluate our results using more samples and better viral detection techniques. © 2014 Elsevier GmbH. All rights reserved.

Introduction Head and Neck Cancers (HNC) are common in several global regions where smoking and alcohol consumption are high [38]. Oral cavity, pharynx, and larynx cancers were estimated to be the seventh most common cancers in Europe, and Squamous Cell Carcinoma (SCC) is the most common malignancy in this region [10]. Worldwide, laryngeal carcinoma is the 20th most common human malignancy, and 151,000 new laryngeal cancers are diagnosed, with 90,000 deaths reported each year [26,31]. Laryngeal cancer accounts for 12,360 cases of the 48,000 cases of HNC diagnosed annually in the United States [16,20,26]. Some risk factors are believed to have a relationship with HNC, and it has been estimated that the use of tobacco and alcohol accounts for nearly 80% of cases [39]. Also, chronic viral infections may be associated with HNC and have such effect by interfering with tumor suppressor gene functions [4,12]. Also, viruses may act

∗ Corresponding author at: Qaem Hospital, Mashhad, Iran. Tel.: +98 9153148350. E-mail address: [email protected] (A. Jafarian). 0344-0338/$ – see front matter © 2014 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2013.12.001

as cofactors enhancing activation, amplification, and overexpression of oncogenes in neoplastic tissues. Molecular and epidemiological evidence has demonstrated the role of Human Papilloma Virus (HPV) in HNCs [8,29,37]. Also, HPV subtypes 16, 18, and 33 were previously detected in over 99% of cervical cancers worldwide, proving to be an etiologic agent for cancer [36]. In 1985, Löning et al. suggested a relationship between HNC and HPV infection, and since then several studies have investigated this relationship [25]. Unlike studies on HPV in cervical cancer, studies on HPV infection in laryngeal and pharyngeal SCCs have reported a wide variation of frequencies of HPV infection, ranging from 8% to 83%, and had a spectrum of oncogenic and non-oncogenic HPV types [41,42]. Also, Fouret et al. reported HPV to be present in only 5.1% of laryngeal and in 12.0% of hypopharyngeal SCCs [13]. Moreover, HPV was detected in varied frequency, ranging from 7% to 64% in the larynx of healthy people without laryngeal cancer [30,35]. It has been described that two viral genes (HPV E6 and E7 oncogenes) are mainly responsible for HPV-related malignant transformations. These two genes are well known for their ability to bind to the tumor suppressor genes P53 and pRb and to suppress them, which leads to cancer [34].

206

N. Mohamadian Roshan et al. / Pathology – Research and Practice 210 (2014) 205–209

Although molecular and epidemiological evidence suggests an etiologic and cofactor role for HPV in the pathogenesis of HNC, such a role has not been investigated in Iran in patients with different sociocultural backgrounds. An HPV oral infection is mainly transmitted and acquired sexually, and the recent increase in the frequency of oropharyngeal carcinoma is believed to be a result of changing sexual behaviors [5]. In addition to HPV infection, other viral infections show some association with HNC, including Epstein Bar Virus (EBV), Herpes Simplex Virus (HSV), Human Immunodeficiency Virus (HIV), and Human Herpes Virus Type 8 (HHV-8) [7,11,15,21–23,40]. It has been proven that HHV-8 is related to various malignancies, including Kaposi’s sarcoma, primary effusion lymphoma, and Castleman’s disease [3,28,33,34]. Also, there have been diseases with an unproven association with HHV-8, such as multiple myeloma, angiosarcoma, and prostate cancer [17,24,38]. Güvenc¸ et al. investigated the presence of HHV-8 DNA in laryngeal SCC and concluded that besides HPV, HHV-8 might have a role in laryngeal carcinogenesis [15]. However, they also recommend further investigations for the clarification of this finding. Thus, with the various HPV frequencies among different populations in mind and very few existing studies investigating the association of HHV-8 and laryngeal cancer, the present study aimed to examine the relationship between laryngeal cancer and HPV16/18 and HHV-8 infections in Northeast Iran using molecular techniques. Materials and methods Study specimens In this cross-sectional case–control study, a total number of 60 formalin-fixed, paraffin-embedded specimens from laryngeal SCC patients, as well as 22 similar specimens with a normal histopathological pattern and no tumoral tissue as the control group, were retrieved from Qaem Hospital Pathology Department located in Mashhad, Northeast Iran. The corresponding slides were reviewed by a pathologist to assure consistency in the diagnosis and to detect the precise tumor grade, as well as to make a correct diagnosis of benign conditions in control specimens. This study was approved by the Research Deputyship of Mashhad University of Medical Sciences regarding methodological and ethical issues. DNA extraction

Table 1 Characteristics of primers used in this study. Primer

Sequence (5 –3 )

Target

Amplimer length (bp)

␤-ActinF ␤-ActinR GP5 GP6 E6F E6R HPV-18F HPV-18R

TTCCAGCCTTCCTTCCTGG TTGCGCTCAGGAGGAGCAAT TTTGTTACTGTGGTAGATACTAC GAAAAATAAACTGTAAATCATATTC TCAAAAGCCACTGTGTCCTG CGTGTTCTTGATGATCTGCA ACCTTAATGAAAAACCACGA CGTCGTTGGAGTCGTTCCTG

␤-Actin

225

L1

150

HPV-16

692

HPV-18

450

Fig. 1. Electrophoresis of amplified PCR products for HPV DNA GP5–GP6. Line 1: positive control. Line 14: negative control. Line 7: size marker. Other lines are negative results.

all samples, HPV detection was performed by GP5+/GP6+ prime (Table 1 and Fig. 1) positive cases for common HPV. DNA assays were tested for the identification of HPV 16 and 18 subtypes using primers for HPV 16 and HPV 18 specific target sequences [1,14,18]. General HPV-positive cases presented with HPV 16/18 positivity, and negative results were not due to HPV 16 and HPV 18 subtype of low risk type, as confirmed by Genpack® PCR test kits assay. Standard PCR protocol consisted of a denaturation step at 94 ◦ C for 30 s, followed by a primer annealing step at 50 ◦ C for 1 min, and a chain elongation step at 72 ◦ C for 30 s, for each cycle. In the present study, the DNA of common warts for GP5–GP6 and cervical squamous cell carcinoma for HPV 16–18 that were positive in previous studies was used as positive controls. In each PCR batch, 3 samples of purified water were used as negative controls. The PCR amplification was also performed for all specimens to detect HHV-8 DNA using the commercial PCR kit Shosse Kashirkoye

To avoid any cross contamination, all specimens were cut in 6 ␮m sections using isolated disposable items (gloves, blades, and tubes). Produced sections were deparaffinized using xylene, and dried tissue was incubated overnight at 56 ◦ C in a solution composed of 50 mM Tris–HCl (pH 7.5), 10 mM EDTA, 0.5% sodium dodecyl sulfate, 50 mM NaCl and 300 ␮g/mL of proteinase K. Proteinase K was inactivated at 95 ◦ C for 10 min. The samples were centrifuged for 3 min at 12,000 rpm, and finally the supernatant underwent extensive extraction by phenol/chloroform (1:1 ratio) to be used for Polymerase Chain Reaction (PCR). All DNA concentrations were evaluated for efficacy and measured by Nanodrop 3300 (Nanodrop, USA). PCR evaluations The PCR for the detection of HPV DNA was performed in 1.5 ml microtubes with re suspended DNA, 20 mM Tris–HCl (pH 8.3), 8 mM MgCl2 , 7.5 mM DTT, 200 ␮M of each dNTP, 20 pmol of each primer, and 0.25 U of Taq DNA polymerase. First, the extracts were checked for DNA quality by amplification of the human ␤-actin gene. In

Fig. 2. Electrophoresis of amplified PCR products for HHV-8 DNA. Line 1: internal control (␤-globulin gene with 560 bp length). Line 7: positive control. Line 10: negative control. Line 3: size marker. Lines 1, 4, 5, 6, 8 and 9: negative results. Line 2: positive sample.

N. Mohamadian Roshan et al. / Pathology – Research and Practice 210 (2014) 205–209

(DNA Technology JSC, Russia, Cot No. E1-1203-21/1) according to the manufacturer’s instructions. Amplification was done in 40 cycles using VeritiTM Thermo Cycler (Applied Biosystems, USA). Eventually, the amplification products were analyzed by 2% agarose gel electrophoresis. The expected size of the PCR product for the HHV-8 genome was 293 bp. ␤-Globulin gene with 560 bp lengths was used as an internal control (Fig. 2). Statistical analysis Demographical data, as well as pathological and molecular results, were registered and analyzed using SPSS V18.0. Chi-square, Fisher’s exact test, and t-test were employed to perform statistical comparisons. Related tables were produced to discuss the results. p-Values < 0.05 were considered as statistically significant. Results In the present study, 82 larynx specimens from 60 patients with laryngeal SCC as the case group and 22 patients with benign larynx conditions and without laryngeal SCC were examined for the presence of HPV-16/18 and HHV-8 DNA using PCR. The average age of patients and controls was 61.26 ± 11.899 (min = 29, max = 83) and 55.77 ± 10.109 (min = 37, max = 75) years, respectively (p = 0.064). Regarding gender distribution, 90% (n = 54) of patients were male and 10% (n = 6) were female, while 72.7% (n = 16) of controls were male and 27.3% (n = 6) were female (p = 0.075). No significant difference was present between patients and controls regarding age and gender factors. Specific PCR for HPV-16/18 revealed no positive samples in either patients or controls, making no room for statistical comparisons. Moreover, PCR analysis with common HPV primers revealed one positive sample in the patients which was not due to the HPV16/18 types. The results of PCR analysis for HHV-8 revealed 3.3% (n = 2) and 9.1% (n = 2) positive samples among patients and controls, respectively (Table 2). Fisher’s exact test showed no significant difference between the two groups regarding HHV-8 infection (p = 0.291). From the 60 laryngeal SCC specimens enrolled in the study, 41.7% (n = 25), 53.3 (n = 32), and 5% (n = 3) were well differentiated (Grade I), moderately differentiated (Grade II), and poorly differentiated (Grade III), respectively. The majority of tumors involving larynx tissue were glottic (40.4%) followed by transglottic (22.8%), supraglottic (7%), and subglottic (7%). Also, 22.8% of tumors had an unknown origin. The frequency of lymph node involvement was evaluated according to TNM staging criteria [9,19]. Lymph node involvement frequency stage was NX, N0, N1, N2, and N3 with 45.5%, 36.4%, 10.9%, 5.5%, and 1.7%, respectively. The specimens used as control group had various benign pathologies including laryngeal nodule (59.1%, n = 13), laryngeal granuloma (9.1%, n = 2), chronic laryngitis (27.3%, n = 6), and laryngeal cyst (4.5%, n = 1). Table 2 HHV-8 frequency in laryngeal SCC and normal larynx tissue. Total

Normal larynx

Laryngeal SCC

n

%

n

%

n

%

4 78 82

4.9 95.1 100

2 20 22

9.1 89.9 100

2 58 60

3.3 96.7 100

p = 0.291.

Positive Negative Total

207

Discussion Despite several studies conducted to investigate the relationship between HPV and laryngeal cancer the various results make it difficult to obtain a comprehensive conclusion. Also, there has been very little data on the frequency of HPV among HNCs in Iran. Vaccination is also recommended in populations at high risk of HPV-associated cancers. HPV vaccine may play a role in the prevention of laryngeal SCC. Moreover it has recently been reported that HHV-8 could be another etiologic factor for laryngeal SCC [15]. We investigated the molecular association between laryngeal SCC and HPV-16/18 and HHV-8 using PCR as a standard procedure [36]. Formalin-fixed, paraffin-embedded specimens from laryngeal SCC and normal larynx tissue were used for PCR. It has been recently stated that formalin-fixed, paraffin-embedded specimens showed an accuracy of 92.6%, sensitivity of 90.5%, and specificity of 93.9% in the detection of HPV DNA using PCR for laryngeal SCC [26]. Also, the extraordinary progress in molecular pathology made in the last decade led to the fact that such techniques became a matter of routine in diagnostic pathology. Therefore, PCR has become a standard procedure for the detection of viral DNA in laryngeal cancer [2,27,43]. In the present study, the quality of the DNA was validated through ␤-actin amplification, which supported the DNA fragments up to 225 bp, and also through ␤-globulin amplification (internal control of our HHV-8 kit), which supported DNA fragments up to 560 bp, which guarantee the quality of the amplified DNA. Different frequencies for the presence of HPV infection in laryngeal cancer have been reported. Pérez et al. reported HPV DNA presence in 54% of 48 laryngeal cancer patients [32]. Also Clayman et al. reported 46% HPV positivity among 65 laryngeal cancer specimens [6]. However, Fouret et al. and Brandwein et al. reported the frequency of HPV DNA in laryngeal cancer as 5.1% and 8%, respectively [2,13]. Knowledge about cancer caused by HPV is important for prognosis. Head and neck malignancies caused by HPV tend to have a better response to current therapies compared to those caused by alcohol or tobacco use, and also there are new treatments such as therapeutic human papilloma virus vaccination and deintensification for carcinomas caused by HPV [2,5,13]. Although we found no trace of HPV-16/18 DNA in patients with laryngeal SCC, similar results were obtained for normal larynx tissue specimens that made it impossible to compare the results between two groups. One possible reason for the low rate of HPV-16/18 in our study might be the transmission route of HPV. HPV transmission in larynx occurs through oral–genital sexual relations, and those having high risk sexual behaviors and multi sexual partners are at higher risk of the infection [40]. In Iran, due to the sociocultural and governmental issues, having multi sexual partners and high risk sexual relations are forbidden both by religion and law. In addition, oral–genital sexual relation is very uncommon in the country. Therefore it is believed that laryngeal HPV infection is not very common in Iran. The very different prevalence rates of HPV infection in laryngeal cancer, as well as in the larynx of healthy people, may be a result of such sociocultural differences. We also investigated the association of HHV-8 and laryngeal SCC. We found HHV-8 in 3.3% of patients and in 9.1% of controls, which showed no statistically significant difference (p > 0.05). There is only one reported study that evaluated the correlation of laryngeal carcinoma and infection with HHV-8. However, Güvenc¸ et al. reported HHV-8 DNA in 10.47% of 50 laryngeal SCC specimens, and there was no positive result among the 50 normal larynx specimens, which showed a significant relationship between HHV-8 infection and laryngeal cancer [15].

208

N. Mohamadian Roshan et al. / Pathology – Research and Practice 210 (2014) 205–209

Thus, our study could not confirm the results of Güvenc¸ et al., but it would be necessary to perform similar studies with more cases to investigate this relationship. The most prevalent laryngeal tumors in our study were glottis followed by supraglottic and subglottic as reported in other studies [16,20]. Also, regarding tumor grade, 53.3%, 41.7%, and 5% of tumors were moderately, well, and poorly differentiated, respectively. It was previously reported that most HPV-associated laryngeal tumors are poorly differentiated, which again reiterates the low prevalence of laryngeal HPV infection in this region. The higher rate of tumors with unknown or no lymph node involvement may be due to the fact that most of the specimens were obtained from preoperational biopsies or laryngectomies that usually occur in lower stages where no metastasis is present. In the present study we did not investigate factors such as smoking, alcohol consumption and sexual behavior. In summary, our study demonstrated no HPV-16/18 DNA in both normal and carcinoma of larynx specimens. A relationship between HHV-8 and laryngeal SCC was observed neither. However, it is recommended to perform complementary studies with bigger sample size to better investigate the association between HPV/HHV-8 and laryngeal cancer in this geographical region. It is also recommended to include in such studies other factors, such as smoking and alcohol consumption, as well as sexual behavior.

References [1] M. Baay, W. Quint, J. Koudstaal, H. Hollema, J.M. Duk, M. Burger, et al., Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas, Journal of Clinical Microbiology 34 (3) (1996) 745–747. [2] M.S. Brandwein, G.J. Nuovo, H. Biller, Analysis of prevalence of human papillomavirus in laryngeal carcinomas. Study of 40 cases using polymerase chain reaction and consensus primers, The Annals of Otology, Rhinology, and Laryngology 102 (4 Pt 1) (1993) 309–313. [3] C. Casper, The aetiology and management of Castleman disease at 50 years: translating pathophysiology to patient care, British Journal of Haematology 129 (1) (2005) 3–17. [4] P. Cattani, S. Hohaus, A. Bellacosa, M. Genuardi, S. Cavallo, V. Rovella, et al., Association between cyclin D1 (CCND1) gene amplification and human papillomavirus infection in human laryngeal squamous cell carcinoma, Clinical Cancer Research 4 (11) (1998) 2585–2589. [5] A.K. Chaturvedi, E.A. Engels, W.F. Anderson, M.L. Gillison, Incidence trends for human papillomavirus-related and -unrelated oral squamous cell carcinomas in the United States, Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology 26 (4) (2008) 612–619. [6] G.L. Clayman, M.G. Stewart, R.S. Weber, A.K. el-Naggar, E.A. Grimm, Human papillomavirus in laryngeal and hypopharyngeal carcinomas. Relationship to survival, Archives of Otolaryngology – Head & Neck Surgery 120 (7) (1994) 743–748. [7] I. Cruz, A.J. Van den Brule, R.D. Steenbergen, P.J. Snijders, C.J. Meijer, J.M. Walboomers, et al., Prevalence of Epstein–Barr virus in oral squamous cell carcinomas, premalignant lesions and normal mucosa – a study using the polymerase chain reaction, Oral Oncology 33 (3) (1997) 182–188. [8] H. Dahlstrand, A. Nasman, M. Romanitan, D. Lindquist, T. Ramqvist, T. Dalianis, Human papillomavirus accounts both for increased incidence and better prognosis in tonsillar cancer, Anticancer Research 28 (2B) (2008) 1133–1138. [9] S.B. Edge, C.C. Compton, The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM, Annals of Surgical Oncology 17 (6) (2010) 1471–1474. [10] J. Ferlay, P. Autier, M. Boniol, M. Heanue, M. Colombet, P. Boyle, Estimates of the cancer incidence and mortality in Europe in 2006, Annals of Oncology 18 (3) (2007) 581–592. [11] D.G. Finn, Lymphoma of the head and neck and acquired immunodeficiency syndrome: clinical investigation and immunohistological study, Laryngoscope 105 (4 Pt 2, Suppl. 68) (1995) 1–18. [12] C.M. Flaitz, M.J. Hicks, Molecular piracy: the viral link to carcinogenesis, Oral Oncology 34 (6) (1998) 448–453. [13] P. Fouret, F. Martin, A. Flahault, J.L. Saint-Guily, Human papillomavirus infection in the malignant and premalignant head and neck epithelium, Diagnostic Molecular Pathology 4 (2) (1995) 122–127. [14] N. Griffin, I. Bevan, F. Lewis, M. Wells, L. Young, Demonstration of multiple HPV types in normal cervix and in cervical squamous cell carcinoma using the polymerase chain reaction on paraffin wax embedded material, Journal of Clinical Pathology 43 (1) (1990) 52–56.

[15] M.G. Güvenc¸, K. Midilli, A. Özdo˘gan, E. I˙ nci, R. Tahamiler, Ö. Enver, et al., Detection of HHV-8 and HPV in laryngeal carcinoma, Auris, Nasus, Larynx 35 (3) (2008) 357–362. [16] H.T. Hoffman, K. Porter, L.H. Karnell, J.S. Cooper, R.S. Weber, C.J. Langer, et al., Laryngeal cancer in the United States: changes in demographics, patterns of care, and survival, Laryngoscope 116 (9 Pt 2, Suppl. 111) (2006) 1–13. [17] L.J. Hoffman, C.H. Bunker, P.E. Pellett, D.L. Trump, A.L. Patrick, S.C. Dollard, et al., Elevated seroprevalence of human herpesvirus 8 among men with prostate cancer, The Journal of Infectious Diseases 189 (1) (2004) 15–20. [18] D. Hong, W. Lu, F. Ye, Y. Hu, X. Xie, Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells, British Journal of Cancer 101 (10) (2009) 1798–1804. [19] H. Iro, F. Waldfahrer, Evaluation of the newly updated TNM classification of head and neck carcinoma with data from 3247 patients, Cancer 83 (10) (1998) 2201–2207. [20] A. Jemal, R. Siegel, E. Ward, Y. Hao, J. Xu, M.J. Thun, Cancer statistics, 2009, CA: A Cancer Journal for Clinicians 59 (4) (2009) 225–249. [21] I. Kobayashi, K. Shima, I. Saito, T. Kiyoshima, K. Matsuo, S. Ozeki, et al., Prevalence of Epstein–Barr virus in oral squamous cell carcinoma, The Journal of Pathology 189 (1) (1999) 34–39. [22] A. Langford, R. Langer, H. Lobeck, H.J. Stolpmann, H.D. Pohle, P. Reichart, et al., Human immunodeficiency virus-associated squamous cell carcinomas of the head and neck presenting as oral and primary intraosseous squamous cell carcinomas, Quintessence International 26 (9) (1995) 635–654. [23] P.A. Larsson, S. Edstrom, T. Westin, A. Nordkvist, J.M. Hirsch, A. Vahlne, Reactivity against herpes simplex virus in patients with head and neck cancer, International Journal of Cancer. Journal International du Cancer 49 (1) (1991) 14–18. [24] J. Lasota, M. Miettinen, Absence of Kaposi’s sarcoma-associated virus (human herpesvirus-8) sequences in angiosarcoma, Virchows Archiv: An International Journal of Pathology 434 (1) (1999) 51–56. [25] T. Löning, H. Ikenberg, J. Becker, L. Gissmann, I. Hoepfer, H. Zur Hausen, Analysis of oral papillomas, leukoplakias, and invasive carcinomas for human papillomavirus type related DNA, Journal of Investigative Dermatology 84 (5) (1985) 417–420. [26] G. Marioni, Letter to editors: Essential for an update epidemiology of laryngeal carcinoma, Cancer Treatment Reviews 38 (6) (2012) 559. [27] K. Morshed, M. Polz-Dacewicz, M. Szymanski, A. Smolen, Usefulness and efficiency of formalin-fixed paraffin-embedded specimens from laryngeal squamous cell carcinoma in HPV detection by IHC and PCR/DEIA, Folia Histochemica et Cytobiologica 48 (3) (2010) 398–402. [28] R.G. Nador, E. Cesarman, A. Chadburn, D.B. Dawson, M.Q. Ansari, J. Sald, et al., Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi’s sarcoma-associated herpes virus, Blood 88 (2) (1996) 645–656. [29] A. Nasman, P. Attner, L. Hammarstedt, J. Du, M. Eriksson, G. Giraud, et al., Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: an epidemic of viral-induced carcinoma? International Journal of Cancer. Journal International du Cancer 125 (2) (2009) 362–366. [30] D.A. Nunez, S.M. Astley, F.A. Lewis, M. Wells, Human papilloma viruses: a study of their prevalence in the normal larynx, The Journal of Laryngology and Otology 108 (4) (1994) 319–320. [31] D.M. Parkin, F. Bray, J. Ferlay, P. Pisani, Global cancer statistics, 2002, CA: A Cancer Journal for Clinicians 55 (2) (2005) 74–108. [32] M. Pérez-ayala, F. Ruiz-Cabello, F. Esteban, A. Concha, M. Redondo, M. Oliva, et al., Presence of HPV 16 sequences in laryngeal carcinomas, International Journal of Cancer 46 (1) (1990) 8–11. [33] W. Qunibi, O. Al-Furayh, K. Almeshari, S.F. Lin, R. Sun, L. Heston, et al., Serologic association of human herpesvirus eight with posttransplant Kaposi’s sarcoma in Saudi Arabia, Transplantation 65 (4) (1998) 583–585. [34] T. Rampias, C. Sasaki, P. Weinberger, A. Psyrri, E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells, Journal of the National Cancer Institute 101 (6) (2009) 412–423. [35] H. Rihkanen, J. Peltomaa, S. Syrjanen, Prevalence of human papillomavirus (HPV) DNA in vocal cords without laryngeal papillomas, Acta Oto-laryngologica 114 (3) (1994) 348–351. [36] E. Ringstrom, E. Peters, M. Hasegawa, M. Posner, M. Liu, K.T. Kelsey, Human papillomavirus type 16 and squamous cell carcinoma of the head and neck, Clinical Cancer Research 8 (10) (2002) 3187–3192. [37] A.B. Ryerson, E.S. Peters, S.S. Coughlin, V.W. Chen, M.L. Gillison, M.E. Reichman, et al., Burden of potentially human papillomavirus-associated cancers of the oropharynx and oral cavity in the US, 1998–2003, Cancer 113 (10 Suppl.) (2008) 2901–2909. [38] J.W. Said, M.R. Rettig, K. Heppner, R.A. Vescio, G. Schiller, H.J. Ma, et al., Localization of Kaposi’s sarcoma-associated herpesvirus in bone marrow biopsy samples from patients with multiple myeloma, Blood 90 (11) (1997) 4278–4282. [39] R. Sankaranarayanan, E. Masuyer, R. Swaminathan, J. Ferlay, S. Whelan, Head and neck cancer: a global perspective on epidemiology and prognosis, Anticancer Research 18 (6B) (1998) 4779–4786.

N. Mohamadian Roshan et al. / Pathology – Research and Practice 210 (2014) 205–209 [40] E.J. Shillitoe, D. Greenspan, J.S. Greenspan, S. Silverman Jr., Five-year survival of patients with oral cancer and its association with antibody to herpes simplex virus, Cancer 58 (10) (1986) 2256–2259. [41] E.M. Smith, K.F. Summersgill, T. McCulloch, J. Allen, Human papillomavirus and risk of laryngeal cancer, The Annals of Otology, Rhinology and Laryngology 109 (11) (2000) 1069–1076.

209

[42] L. Suzuk, A.E. Noffsinger, Y.Z. Hui, C.M. Fenoglio-Preiser, Detection of human papillomavirus in esophageal squamous cell carcinoma, Cancer 78 (4) (1996) 704–710. [43] M.C. Torrente, J.P. Rodrigo, M. Haigentz Jr., F.G. Dikkers, A. Rinaldo, R.P. Takes, et al., Human papillomavirus infections in laryngeal cancer, Head Neck 33 (4) (2011) 581–586.