In Vitro Cell.Dev.Biol.—Animal DOI 10.1007/s11626-015-9879-x
14-3-3γ affects mTOR pathway and regulates lactogenesis in dairy cow mammary epithelial cells Nagam Khudhair & Chaochao Luo & Ahmed Khalid & Li Zhang & Shuang Zhang & Jinxia Ao & Qingzhang Li & Xuejun Gao
Received: 14 December 2014 / Accepted: 10 February 2015 / Editor: T. Okamoto # The Society for In Vitro Biology 2015
Abstract 14-3-3 proteins are an acidic protein family that is highly conserved and widely distributed in eukaryotic cells. Recent studies have found that 14-3-3 proteins play critical roles in cell signal transductions, cell growth and differentiation, and protein synthesis. 14-3-3γ is an important member of 14-3-3 protein family. In our previous study, we found that 14-3-3γ was upregulated by estrogen in dairy cow mammary epithelial cell (DCMEC), but the function and mechanism of 14-3-3γ is not known. In this experiment, we first cultured and purified the primary DCMEC and found 14-3-3γ located both in the cytoplasm and nucleus by using immunofluorescence assay. Methionine, lysine, estrogen, and prolactin could upregulate the expression of 14-3-3γ, stimulate the secretion of β-casein and triglyceride, and raise the cell viability of DCMEC. We constructed a stable 14-3-3γ overexpression cell line of DCMEC and found that the expressions of mTOR and p-mTOR, the secretion of triglyceride and β-casein (CSN2), and the cell viability of DCMEC were all upregulated. We also observed the effects of 14-3-3γ gene silencing and gained consistent results with 14-3-3γ overexpression. These findings reveal that 14-3-3γ affects the mTOR pathway and regulates lactogenesis in DCMECs.
N. Khudhair : C. Luo : L. Zhang : S. Zhang : J. Ao : Q. Li : X. Gao (*) Key Laboratory of Agricultural Biological Functional Genes, Northeast Agricultural University, Harbin 150030, China e-mail: [email protected] A. Khalid College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China N. Khudhair Biology Department, Education College for Women, Al-Anbar University, Ramadi 31001, Iraq
Keywords 14-3-3γ . Stable overexpression . DCMECs . mTOR . Lactogenesis
Introduction 14-3-3 proteins are a class of highly conserved acidic protein, and there are seven 14-3-3 isoforms found in mammals, respectively, β, γ, ε, η, ζ, δ, and τ (Aitken 2006). The current studies have found that 14-3-3 protein family interacts with nearly 700 species of proteins through a particular sequence of phosphorylated serine or threonine and broadly participates in cell signal transduction, cycle progression, proliferation, and protein synthesis (Zhao et al. 2011, 2012; Lam et al. 2013). Previous reports have shown that 14-3-3 is implicated in modulating the TOR function in yeast (Bertram et al. 1998). Other studies indicate that 14-3-3 positively regulates mTOR pathway (Mori et al. 2000). The 14-3-3γ isoform is encoded by the YWHAZ gene. It has been reported that growth factors can induce 14-3-3γ in human vascular smooth muscle cells (Autieri et al. 1996). Exhaustion of 14-3-3γ results in a prometaphase/metaphase-like arrest in HeLa cells (Kasahara et al. 2013). The expression of 14-3-3γ also promoted cell survival and growth in hematopoietic progenitor cells (Ajjappala et al. 2009). The role of the mTOR pathway in facilitating protein and lipid synthesis and cell proliferation has been well investigated (Porstmann et al. 2008; Bakan and Laplante 2012). It is well known that mTOR positively regulates protein translation through phosphorylation of S6K and of 4E-BP1/ eIF4E. Activated or phosphorylated S6K phosphorylates ribosomal protein S6 (RPS6) to stimulate translation. In our previous study, we found that 14-3-3γ was upregulated by estrogen in dairy cow mammary epithelial cell (DCMEC), but the function and mechanism of 14-3-3γ is not known. In this study, we observed the subcellular
KHUDHAIR ET AL.
localization of 14-3-3γ and the effects of nutrients (amino acids) and hormones on the expression of 14-3-3γ, and further constructed a stable 14-3-3γ overexpression cell line of DCMECs and also exploited gene silencing approach to study the impact of 14-3-3γ on mTOR signaling pathway and lactogenesis in DCMECs, in order to determine whether 143-3γ can affect mTOR pathway and lactogenesis.
Materials and Methods DCMEC culture and treatments. Primary DCMECs were cultured and subcultured as previously described (Ke et al. 2010; Wang et al. 2014) in Dulbecco’s modified Eagle’s mediumF12 (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS), 5 mg/ml insulin (Sigma-Aldrich, Oakville, ON, Canada), 100 U/ml streptomycin, and 100 mg/ml penicillin. For experimental assays, cells in the logarithmic growth phase were cultured in the cell flask at 37°C with 5% CO2. Purified cells were cultured 12 h with a serum-free medium before further treatment; no supplements were included during serum starvation. Detections of cytokeratin 18 and β-casein (CSN2) were performed by immunofluorescence to identify the purity and ability to synthesize milk protein in these primary DCMECs. 14-3-3γ subcellular localization. DCMECs were seeded on glass coverslips to 30%–50% confluency in six-well plates. The cells were rinsed twice with PBS and fixed in 4% (w/v) ice-cold formaldehyde at 4°C for 10 min. The slides were rinsed thrice with Tris-buffered saline/Tween-20 (TBS/T) for 5 min. To detect endogenous cytokeratin 18 (CK18), β-casein, and 14-3-3γ, the fixed DCMECs were incubated in blocking buffer (Tris-buffered saline with 5% BSA and 0.1% TritonX-100) for 1 h at 37°C and then incubated with anti-CK18 primary antibody (Germany Acris company, Herford Germany), anti-CSN2 primary antibody (Santa Cruz company, Dallas, TX), and anti-14-3-3γ primary antibody (Abcam, Cambridge, MA, USA) at 1:100 dilution for 1.5 h at 37°C, respectively. After rinsing three times in TBS/T, the samples were incubated in the dark with fluorescein isothiocyanate (FITC)-conjugated secondary antibodies at 1:200 dilutions for 1 h at 37°C and incubated with DAPI for 15 min at 37°C; the cell membrane was stained with Dio (green fluorescent membrane probes, Sigma-Aldrich). Finally, after rinsing three times in TBS/T, the coverslips were visualized by using confocal laser scanning microscope (Leica TCS-SP2 AOBS, Leica Microsystems, Buffalo Groove, IL). Amino acid and hormone treatments. Purified DCMECs cultured 12 h with a serum-free medium were individually added with methionine (Met, 1.46 mg/ml), lysine (Lys, 0.9 mg/ml), estrogen (E, 2.72×10−2 μg/ml), and prolactin (Prol, 5 μg/ml)
(final concentration) (Peterson et al. 2004; Liu et al. 2012; Tong et al. 2012). pGCMV-IRES-EGFP-14-3-3γ construction and transient transfection. The gene for 14-3-3γ was amplified by PCR to clone the complete coding region, PCR fragments was subcloned into a pMD18-T vector (TaKaRa, Dalian, China) and completely sequenced, then 14-3-3γ fragments were s u b c l o n e d i n t o t h e p G C M V- I R E S - E G F P v e c t o r (GenePharma, Shanghai, China). The recombinant plasmid was obtained and confirmed by digestion with EcoRI and BamHI. To create the pGCMV-IRES-EGFP vector, the 143-3γ forward primer was 5′CGGAATTCCGGATCATCCTC GTCCGG-3′ (EcoRI) and reverse primer was 5′CGGGATTC CGCAGTCCACCTGGGGGC-3′ (BamHI). DCMECs were transfected with the pGCMV-IRES-EGFP14-3-3γ (recombinant plasmid), pGCMV-IRES-EGFP (empty vector), and non-transfected cells were carried through the experiments as controls. Lipofectamine 2000 (LF2000) was used for transfection according to the manufacturer’s recommendations (Invitrogen, Carlsbad, CA). Briefly, DCMECs (1×106 cells per well) were plated in six-well culture plates. For each well, 1 mg of plasmid DNA and 2.5 ml of LF2000 was diluted in 200 ml of OPTI-MEMI medium and incubated at room temperature for 20 min to allow the formation of lipocomplexes; the complexes were then added into the wells. Cells were incubated with a serum-free medium and antibiotic at 37°C for 24 h for further experiments. Stable transfection of pGCMV-IRES-EGFP-14-3-3γ. The method for stable transfection of 14-3-3γ gene was as previously reported (Liu et al. 2012). In order to obtain stably transfected recombinant clones, DCMECs were plated into six-well plates at a density of 1×105 cells per well and transferred into a serum-free medium for 24 h before transfection. Two micrograms of the recombinant vector was used according to the manufacturer’s instructions. The medium was replaced at 24 h after transfection with additional 10% FBS (Gibco) and 600 μg/ml geneticin (G418) (Gibco) containing 1% penicillin and 1% streptomycin (Sigma-Aldrich, St. Louis, MO), and the cells were cultured for the next 3 wk. Small interfering RNA transfection. 14-3-3γ small interfering RNA (siRNA) and negative control siRNAs (GenePharma, Shanghai, China) were transfected into DCMECs with Lipofectamine 2000 (Invitrogen, Carlsbad, CA), respectively, and non-transfected cells were also used as control. Cells were incubated at 37°C for 24 h and then harvested for further experiments. Cell viability assay. By using a CASY-TT Analyzer System (Schärfe System GmbH, Reutlingen, Germany), the cell viability and cell proliferation were determined according to the
14-3-3Γ REGULATES LACTOGENESIS, DAIRY COW
manufacturer’s instructions. Cells were aspirated into a capillary by an electrical field generated by electrodes. The measure was taken when cells passed through a precision measuring pore. A living cell, with an intact cell membrane, could be considered as an electrical isolator and the resistance measurement reflected its true volume. If the cell was dead, it would be described by the size of its nucleus. Briefly, after calibration with dead and live DCMECs, cursor positions were set to 11.75 to 50.00 μm (evaluation cursor) and 7.63 to 50.00 μm (standardization cursor). DCMECs were digested with trypsin and then diluted (1:100) with CASY electrolyte solution prior to examination. Three 100-μl aliquots were used for sample analyses (Huang et al. 2013). β-Casein secretion. The content of β-casein in the cell-free supernatant of the culture was detected by HPLC described by Tong et al. (2012). Triglyceride secretion. The content of triglyceride (TG) in the cell-free supernatant of the culture was assessed using the Triglyceride GPO-POD assay Kit (Applygen Tech Inc., Beijing, China) according to the manufacturer’s instructions (Liang et al 2014). Western blot analysis. Western blot analysis was performed using standard techniques reported by Lu et al. (2013). Briefly, total cell lysate containing about 30 μg of proteins was subjected on 10% SDS-PAGE gel and transferred onto nitrocellulose membranes (Bio-Rad, Shanghai, China). Membranes were blocked with 5% skim milk (in Tris-buffered saline with 5% skim milk and 0.1% Tween-20). Membranes were probed with primary antibodies specific for the following antibodies: 14-3-3γ (Abcam, Cambridge, MA), mTOR, p-mTOR (Cell Signalling Technology, Beverly, MA), and β-actin (Santa Cruz Biotechnology Inc., Santa Cruz, CA), followed by a second incubation with secondary antibodies [1:1000] conjugated to horseradish peroxidase (HRP) (ZSGB-BIO, Beijing, China). The chemiluminescence detection of HRP-conjugated secondary antibodies was performed using Super ECL plus (Applygen, Beijing, China). And the gray scale scanning of Western blots was analyzed using Glyko Band Scan 5.0 software (Glyko, Hayward, CA).
expressions of CK18 and β-casein (CSN2) (Fig. 1A), showing that these primary DCMECs were purified and had the lactogenesis ability. These cells can be used for the followup experiments. The subcellular localization of 14-3-3γ was determined by immunofluorescence analysis, and 14-3-3γ was distributed in both the cytoplasm and nucleus (Fig. 1B). It could be observed that clear blue signals localized at the centers of DCMECs, which were the nucleus; green signals (Dio) were the cell membrane; and red signals were the tetramethylrhodamine isothiocyanate (TRITC)-labeled 14-33γ, which was expressed in both the cytoplasm and nucleus. The expressions of 14-3-3γ in DCMECs treated with methionine, lysine, estrogen, and prolactin were all upregulated (Fig. 1C, D); amino acid and hormone treatments also stimulated the secretion of β-casein and triglyceride, and raised the cell viability of DCMEC; and the hormone groups had better effects than the amino acid groups (Fig. 1E, F, G). These results reveal that 14-3-3γ is an important regulator for lactogenesis in DCMECs and can reply to extracellular stimuli including amino acids and hormones. Transient transfection of 14-3-3γ gene. 14-3-3γ gene was amplified by PCR. The predicted fragment (14-3-3γ gene, 796 bp) was obtained and then cloned into the pGCMVIRES-EGFP vector, verified by EcoRI and BamHI digestion. The pGCMV-IRES-EGFP-14-3-3γ was transiently transfected into DCMECs for 24 h. After transient transfection of 14-3-3γ gene, 14-3-3γ was found highly overexpressed than the empty plasmid group, mTOR had no obvious change, whereas p-mTOR was significantly overexpressed (Fig. 2A, B). The viability of DCMECs was obviously raised (Fig. 2C), and both CSN2 (Fig. 2D) and TG (Fig. 2E) secretions were enhanced in cells after transient transfection of 14-3-3γ gene. These results suggest that 14-3-3γ is a positive regulator of mTOR and regulates lactogenesis of DCMECs including milk protein and milk fat synthesis, as well as cell proliferation.
Results and Analysis
Stable transfection of 14-3-3γ gene. By geneticin selection of DCMECs transfected with pGCMV-IRES-EGFP-143-3γ plasmid for 3 wk, a stable 14-3-3γ overexpression cell line was gained. After stable transfection of 14-3-3γ gene, 143-3γ was found strongly overexpressed than the empty plasmid group; furthermore, mTOR and p-mTOR were significantly overexpressed (Fig. 3A, B). The viability of DCMECs was obviously raised (Fig. 3C), and both CSN2 and TG secretion were enhanced in cells after stable transfection of 143-3γ gene (Fig. 3D, E). These results provide further clear evidence that 14-3-3γ positively regulates mTOR leading to lactogenesis of DCMECs.
Identification of DCMECs and 14-3-3γ expression By the application of laser scanning confocal microscopy, we observed that all the cultured DCMECs were positive for the
14-3-3γ gene silencing. After 14-3-3γ gene silencing, 14-33γ was found heavily repressed than the empty plasmid group; furthermore, the protein levels of mTOR and p-
Statistical analysis. All data were expressed as the mean ± (SD) (n= 3) and were tested for statistical significance (p
14-3-3γ affects mTOR pathway and regulates lactogenesis in dairy cow mammary epithelial cells Nagam Khudhair & Chaochao Luo & Ahmed Khalid & Li Zhang & Shuang Zhang & Jinxia Ao & Qingzhang Li & Xuejun Gao
Received: 14 December 2014 / Accepted: 10 February 2015 / Editor: T. Okamoto # The Society for In Vitro Biology 2015
Abstract 14-3-3 proteins are an acidic protein family that is highly conserved and widely distributed in eukaryotic cells. Recent studies have found that 14-3-3 proteins play critical roles in cell signal transductions, cell growth and differentiation, and protein synthesis. 14-3-3γ is an important member of 14-3-3 protein family. In our previous study, we found that 14-3-3γ was upregulated by estrogen in dairy cow mammary epithelial cell (DCMEC), but the function and mechanism of 14-3-3γ is not known. In this experiment, we first cultured and purified the primary DCMEC and found 14-3-3γ located both in the cytoplasm and nucleus by using immunofluorescence assay. Methionine, lysine, estrogen, and prolactin could upregulate the expression of 14-3-3γ, stimulate the secretion of β-casein and triglyceride, and raise the cell viability of DCMEC. We constructed a stable 14-3-3γ overexpression cell line of DCMEC and found that the expressions of mTOR and p-mTOR, the secretion of triglyceride and β-casein (CSN2), and the cell viability of DCMEC were all upregulated. We also observed the effects of 14-3-3γ gene silencing and gained consistent results with 14-3-3γ overexpression. These findings reveal that 14-3-3γ affects the mTOR pathway and regulates lactogenesis in DCMECs.
N. Khudhair : C. Luo : L. Zhang : S. Zhang : J. Ao : Q. Li : X. Gao (*) Key Laboratory of Agricultural Biological Functional Genes, Northeast Agricultural University, Harbin 150030, China e-mail: [email protected] A. Khalid College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China N. Khudhair Biology Department, Education College for Women, Al-Anbar University, Ramadi 31001, Iraq
Keywords 14-3-3γ . Stable overexpression . DCMECs . mTOR . Lactogenesis
Introduction 14-3-3 proteins are a class of highly conserved acidic protein, and there are seven 14-3-3 isoforms found in mammals, respectively, β, γ, ε, η, ζ, δ, and τ (Aitken 2006). The current studies have found that 14-3-3 protein family interacts with nearly 700 species of proteins through a particular sequence of phosphorylated serine or threonine and broadly participates in cell signal transduction, cycle progression, proliferation, and protein synthesis (Zhao et al. 2011, 2012; Lam et al. 2013). Previous reports have shown that 14-3-3 is implicated in modulating the TOR function in yeast (Bertram et al. 1998). Other studies indicate that 14-3-3 positively regulates mTOR pathway (Mori et al. 2000). The 14-3-3γ isoform is encoded by the YWHAZ gene. It has been reported that growth factors can induce 14-3-3γ in human vascular smooth muscle cells (Autieri et al. 1996). Exhaustion of 14-3-3γ results in a prometaphase/metaphase-like arrest in HeLa cells (Kasahara et al. 2013). The expression of 14-3-3γ also promoted cell survival and growth in hematopoietic progenitor cells (Ajjappala et al. 2009). The role of the mTOR pathway in facilitating protein and lipid synthesis and cell proliferation has been well investigated (Porstmann et al. 2008; Bakan and Laplante 2012). It is well known that mTOR positively regulates protein translation through phosphorylation of S6K and of 4E-BP1/ eIF4E. Activated or phosphorylated S6K phosphorylates ribosomal protein S6 (RPS6) to stimulate translation. In our previous study, we found that 14-3-3γ was upregulated by estrogen in dairy cow mammary epithelial cell (DCMEC), but the function and mechanism of 14-3-3γ is not known. In this study, we observed the subcellular
KHUDHAIR ET AL.
localization of 14-3-3γ and the effects of nutrients (amino acids) and hormones on the expression of 14-3-3γ, and further constructed a stable 14-3-3γ overexpression cell line of DCMECs and also exploited gene silencing approach to study the impact of 14-3-3γ on mTOR signaling pathway and lactogenesis in DCMECs, in order to determine whether 143-3γ can affect mTOR pathway and lactogenesis.
Materials and Methods DCMEC culture and treatments. Primary DCMECs were cultured and subcultured as previously described (Ke et al. 2010; Wang et al. 2014) in Dulbecco’s modified Eagle’s mediumF12 (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS), 5 mg/ml insulin (Sigma-Aldrich, Oakville, ON, Canada), 100 U/ml streptomycin, and 100 mg/ml penicillin. For experimental assays, cells in the logarithmic growth phase were cultured in the cell flask at 37°C with 5% CO2. Purified cells were cultured 12 h with a serum-free medium before further treatment; no supplements were included during serum starvation. Detections of cytokeratin 18 and β-casein (CSN2) were performed by immunofluorescence to identify the purity and ability to synthesize milk protein in these primary DCMECs. 14-3-3γ subcellular localization. DCMECs were seeded on glass coverslips to 30%–50% confluency in six-well plates. The cells were rinsed twice with PBS and fixed in 4% (w/v) ice-cold formaldehyde at 4°C for 10 min. The slides were rinsed thrice with Tris-buffered saline/Tween-20 (TBS/T) for 5 min. To detect endogenous cytokeratin 18 (CK18), β-casein, and 14-3-3γ, the fixed DCMECs were incubated in blocking buffer (Tris-buffered saline with 5% BSA and 0.1% TritonX-100) for 1 h at 37°C and then incubated with anti-CK18 primary antibody (Germany Acris company, Herford Germany), anti-CSN2 primary antibody (Santa Cruz company, Dallas, TX), and anti-14-3-3γ primary antibody (Abcam, Cambridge, MA, USA) at 1:100 dilution for 1.5 h at 37°C, respectively. After rinsing three times in TBS/T, the samples were incubated in the dark with fluorescein isothiocyanate (FITC)-conjugated secondary antibodies at 1:200 dilutions for 1 h at 37°C and incubated with DAPI for 15 min at 37°C; the cell membrane was stained with Dio (green fluorescent membrane probes, Sigma-Aldrich). Finally, after rinsing three times in TBS/T, the coverslips were visualized by using confocal laser scanning microscope (Leica TCS-SP2 AOBS, Leica Microsystems, Buffalo Groove, IL). Amino acid and hormone treatments. Purified DCMECs cultured 12 h with a serum-free medium were individually added with methionine (Met, 1.46 mg/ml), lysine (Lys, 0.9 mg/ml), estrogen (E, 2.72×10−2 μg/ml), and prolactin (Prol, 5 μg/ml)
(final concentration) (Peterson et al. 2004; Liu et al. 2012; Tong et al. 2012). pGCMV-IRES-EGFP-14-3-3γ construction and transient transfection. The gene for 14-3-3γ was amplified by PCR to clone the complete coding region, PCR fragments was subcloned into a pMD18-T vector (TaKaRa, Dalian, China) and completely sequenced, then 14-3-3γ fragments were s u b c l o n e d i n t o t h e p G C M V- I R E S - E G F P v e c t o r (GenePharma, Shanghai, China). The recombinant plasmid was obtained and confirmed by digestion with EcoRI and BamHI. To create the pGCMV-IRES-EGFP vector, the 143-3γ forward primer was 5′CGGAATTCCGGATCATCCTC GTCCGG-3′ (EcoRI) and reverse primer was 5′CGGGATTC CGCAGTCCACCTGGGGGC-3′ (BamHI). DCMECs were transfected with the pGCMV-IRES-EGFP14-3-3γ (recombinant plasmid), pGCMV-IRES-EGFP (empty vector), and non-transfected cells were carried through the experiments as controls. Lipofectamine 2000 (LF2000) was used for transfection according to the manufacturer’s recommendations (Invitrogen, Carlsbad, CA). Briefly, DCMECs (1×106 cells per well) were plated in six-well culture plates. For each well, 1 mg of plasmid DNA and 2.5 ml of LF2000 was diluted in 200 ml of OPTI-MEMI medium and incubated at room temperature for 20 min to allow the formation of lipocomplexes; the complexes were then added into the wells. Cells were incubated with a serum-free medium and antibiotic at 37°C for 24 h for further experiments. Stable transfection of pGCMV-IRES-EGFP-14-3-3γ. The method for stable transfection of 14-3-3γ gene was as previously reported (Liu et al. 2012). In order to obtain stably transfected recombinant clones, DCMECs were plated into six-well plates at a density of 1×105 cells per well and transferred into a serum-free medium for 24 h before transfection. Two micrograms of the recombinant vector was used according to the manufacturer’s instructions. The medium was replaced at 24 h after transfection with additional 10% FBS (Gibco) and 600 μg/ml geneticin (G418) (Gibco) containing 1% penicillin and 1% streptomycin (Sigma-Aldrich, St. Louis, MO), and the cells were cultured for the next 3 wk. Small interfering RNA transfection. 14-3-3γ small interfering RNA (siRNA) and negative control siRNAs (GenePharma, Shanghai, China) were transfected into DCMECs with Lipofectamine 2000 (Invitrogen, Carlsbad, CA), respectively, and non-transfected cells were also used as control. Cells were incubated at 37°C for 24 h and then harvested for further experiments. Cell viability assay. By using a CASY-TT Analyzer System (Schärfe System GmbH, Reutlingen, Germany), the cell viability and cell proliferation were determined according to the
14-3-3Γ REGULATES LACTOGENESIS, DAIRY COW
manufacturer’s instructions. Cells were aspirated into a capillary by an electrical field generated by electrodes. The measure was taken when cells passed through a precision measuring pore. A living cell, with an intact cell membrane, could be considered as an electrical isolator and the resistance measurement reflected its true volume. If the cell was dead, it would be described by the size of its nucleus. Briefly, after calibration with dead and live DCMECs, cursor positions were set to 11.75 to 50.00 μm (evaluation cursor) and 7.63 to 50.00 μm (standardization cursor). DCMECs were digested with trypsin and then diluted (1:100) with CASY electrolyte solution prior to examination. Three 100-μl aliquots were used for sample analyses (Huang et al. 2013). β-Casein secretion. The content of β-casein in the cell-free supernatant of the culture was detected by HPLC described by Tong et al. (2012). Triglyceride secretion. The content of triglyceride (TG) in the cell-free supernatant of the culture was assessed using the Triglyceride GPO-POD assay Kit (Applygen Tech Inc., Beijing, China) according to the manufacturer’s instructions (Liang et al 2014). Western blot analysis. Western blot analysis was performed using standard techniques reported by Lu et al. (2013). Briefly, total cell lysate containing about 30 μg of proteins was subjected on 10% SDS-PAGE gel and transferred onto nitrocellulose membranes (Bio-Rad, Shanghai, China). Membranes were blocked with 5% skim milk (in Tris-buffered saline with 5% skim milk and 0.1% Tween-20). Membranes were probed with primary antibodies specific for the following antibodies: 14-3-3γ (Abcam, Cambridge, MA), mTOR, p-mTOR (Cell Signalling Technology, Beverly, MA), and β-actin (Santa Cruz Biotechnology Inc., Santa Cruz, CA), followed by a second incubation with secondary antibodies [1:1000] conjugated to horseradish peroxidase (HRP) (ZSGB-BIO, Beijing, China). The chemiluminescence detection of HRP-conjugated secondary antibodies was performed using Super ECL plus (Applygen, Beijing, China). And the gray scale scanning of Western blots was analyzed using Glyko Band Scan 5.0 software (Glyko, Hayward, CA).
expressions of CK18 and β-casein (CSN2) (Fig. 1A), showing that these primary DCMECs were purified and had the lactogenesis ability. These cells can be used for the followup experiments. The subcellular localization of 14-3-3γ was determined by immunofluorescence analysis, and 14-3-3γ was distributed in both the cytoplasm and nucleus (Fig. 1B). It could be observed that clear blue signals localized at the centers of DCMECs, which were the nucleus; green signals (Dio) were the cell membrane; and red signals were the tetramethylrhodamine isothiocyanate (TRITC)-labeled 14-33γ, which was expressed in both the cytoplasm and nucleus. The expressions of 14-3-3γ in DCMECs treated with methionine, lysine, estrogen, and prolactin were all upregulated (Fig. 1C, D); amino acid and hormone treatments also stimulated the secretion of β-casein and triglyceride, and raised the cell viability of DCMEC; and the hormone groups had better effects than the amino acid groups (Fig. 1E, F, G). These results reveal that 14-3-3γ is an important regulator for lactogenesis in DCMECs and can reply to extracellular stimuli including amino acids and hormones. Transient transfection of 14-3-3γ gene. 14-3-3γ gene was amplified by PCR. The predicted fragment (14-3-3γ gene, 796 bp) was obtained and then cloned into the pGCMVIRES-EGFP vector, verified by EcoRI and BamHI digestion. The pGCMV-IRES-EGFP-14-3-3γ was transiently transfected into DCMECs for 24 h. After transient transfection of 14-3-3γ gene, 14-3-3γ was found highly overexpressed than the empty plasmid group, mTOR had no obvious change, whereas p-mTOR was significantly overexpressed (Fig. 2A, B). The viability of DCMECs was obviously raised (Fig. 2C), and both CSN2 (Fig. 2D) and TG (Fig. 2E) secretions were enhanced in cells after transient transfection of 14-3-3γ gene. These results suggest that 14-3-3γ is a positive regulator of mTOR and regulates lactogenesis of DCMECs including milk protein and milk fat synthesis, as well as cell proliferation.
Results and Analysis
Stable transfection of 14-3-3γ gene. By geneticin selection of DCMECs transfected with pGCMV-IRES-EGFP-143-3γ plasmid for 3 wk, a stable 14-3-3γ overexpression cell line was gained. After stable transfection of 14-3-3γ gene, 143-3γ was found strongly overexpressed than the empty plasmid group; furthermore, mTOR and p-mTOR were significantly overexpressed (Fig. 3A, B). The viability of DCMECs was obviously raised (Fig. 3C), and both CSN2 and TG secretion were enhanced in cells after stable transfection of 143-3γ gene (Fig. 3D, E). These results provide further clear evidence that 14-3-3γ positively regulates mTOR leading to lactogenesis of DCMECs.
Identification of DCMECs and 14-3-3γ expression By the application of laser scanning confocal microscopy, we observed that all the cultured DCMECs were positive for the
14-3-3γ gene silencing. After 14-3-3γ gene silencing, 14-33γ was found heavily repressed than the empty plasmid group; furthermore, the protein levels of mTOR and p-
Statistical analysis. All data were expressed as the mean ± (SD) (n= 3) and were tested for statistical significance (p
