EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS
Regulation of Mitochondrial Function and Cel‐ Department of Pathology & La‐ 2 boratory Medicine, Institute of lular Energy Metabolism by Protein Kinase C‐ Reproductive Health and Regener‐ λ/τ: A Novel Mode of Balancing Pluripotency ative Medicine, 3Department of Molecular and Integrative Physiol‐ ogy, University of Kansas Medical BIRAJ MAHATO1, PRATIK HOME1, GANESHKUMAR RAJENDRAN1, ARINDAM Center, Kansas City, Kansas, USA. PAUL1,2, BISWARUP SAHA1, AVISHEK GANGULY1, SOMA RAY1, NAIRITA ROY3, RUSSELL H. SWERDLOW3, AND SOUMEN PAUL1,2,* Address correspondence to: Soumen Paul, Institute for Repro‐ Key words. Embryonic Stem cells • Mitochondria • PGC1α • Protein Kinase C ductive Health and Regenerative λ/τ • Energy Metabolism, Medicine, Department of Patholo‐ gy & Laboratory Medicine, Univer‐ sity of Kansas Medical Center, Kan‐ ABSTRACT sas City, Kansas 66160. Tel: 913‐ 588‐7236; Fax: 913‐588‐7180; Pluripotent stem cells (PSCs) contain functionally immature mitochondria Email: [email protected] and rely upon high rates of glycolysis for their energy requirements. Thus, altered mitochondrial function and promotion of aerobic glycolysis is key Received May 06, 2014; accepted to maintain and induce pluripotency. However, signaling mechanisms that for publication July 23, 2014 regulate mitochondrial function and reprogram metabolic preferences in self‐renewing vs. differentiated PSC populations are poorly understood. ©AlphaMed Press Here, using murine embryonic stem cells (ESCs) as a model system, we 1066‐5099/2014/$30.00/0 demonstrate that atypical protein kinase C isoform, PKC lambda/iota (PKCλ/τ), is a key regulator of mitochondrial function in ESCs. Depletion of This article has been accepted for PKCλ/τ in ESCs maintains their pluripotent state as evident from germline publication and undergone full offsprings. Interestingly, loss of PKCλ/τ in ESCs leads to impairment in mi‐ peer review but has not been tochondrial maturation, organization and a metabolic shift toward glycoly‐ through the copyediting, typeset‐ sis under differentiating condition. Our mechanistic analyses indicate that ting, pagination and proofreading a PKCλ/τ‐HIF1α‐PGC1α axis regulates mitochondrial respiration and bal‐ process which may lead to differ‐ ances pluripotency in ESCs. We propose that PKCλ/τ could be a crucial reg‐ ences between this version and the ulator of mitochondrial function and energy metabolism in stem cells and Version of Record. Please cite this other cellular contexts. STEM CELLS 2014; 00:000–000 article as doi: 10.1002/stem.1817 ing PSCs. Recent studies have implicated multiple fac‐ INTRODUCTION tors, including uncoupling protein 2 (UCP2) and glyco‐ lytic enzymes Hexokinase II and Pyruvate Dehydrogen‐ Cellular metabolic state plays an important role in regu‐ ase in glycolytic shift in PSCs [3, 6]. In addition, tran‐ lation of pluripotency and an association between mito‐ scription factors, like Hypoxia inducible factor (HIF)1α chondrial function and pluripotency has strongly been and CITED2 have been implicated in promoting glyco‐ established [1‐4]. PSCs contain functionally immature lytic metabolism in ESCs and iPSCs [7, 16, 17]. However, mitochondria leading to enhanced glycolytic mechanism signaling pathways, which are important for transition [5‐9]. Also, inhibition of glycolysis in PSCs promotes of mitochondrial function and a metabolic shift from their differentiation [8, 10‐12]. Furthermore, repro‐ glycolysis to oxidative phosphorylation during PSC dif‐ gramming of somatic cells to induced pluripotent stem ferentiation is largely undefined. cells (iPSCs) is associated with a transition from oxida‐ Recently PKC isoforms have been implicated in regu‐ tive to glycolytic metabolism and disruption of this lating PSC differentiation. We demonstrated that loss of metabolic switch strongly inhibits reprogramming effi‐ atypical PKC isoform, PKCζ, promotes self‐renewal in ciency [6, 9, 13‐15] The strong connection between mi‐ both mouse [18] and rat ESCs [19]. Another study impli‐ tochondrial function with pluripotency raises the ques‐ cated PKCζ along with PKCδ and PKCε in balancing self‐ tion, what mechanisms regulate mitochondrial function renewal vs. differentiation in human PSCs [20]. Howev‐ and energy metabolism in self‐renewing vs. differentiat‐ 1
STEM CELLS 2014;00:00‐00 www.StemCells.com
©AlphaMed Press 2014
2
PKCλ/ι regulates mitochondria in ESCs
er, functional importance of other atypical PKC isoform, PKCλ/τ in PSCs is poorly understood. Gene‐knockout studies in mice showed that ablation of PKCλ/τ results in abnormalities early in gestation leading to embryonic lethality [21, 22], indicating that PKCλ/τ is important for early development in post implantation mouse embryo. This observation is complemented by another recent study that showed loss of PKCλ/τ in ESCs impairs embryoid body (EB) maturation [22]. We show here that PKCλ/τ‐depletion in ESCs inhibits mitochondrial biogenesis and maturation, promotes glycolytic energy metabolism and maintains ESCs in a naive pluripotent state. In contrast, both differentiation potential and metabolic shift can be restored upon rescue of PKCλ/τ expression. Our results uncovered a novel function of PKCλ/τ in which it balances self‐renewal vs. differentia‐ tion of ESCs by modulating mitochondrial biogenesis and function, thereby regulating cellular energy metab‐ olism.
MATERIALS AND METHODS
ESC culture and reagents For maintaining ESCs in undifferentiated state, cells were cultured in serum free N2B27 (Invitrogen, Grand Island, NY) medium on 0.1% gelatin coated plates with leukemia inhibitory factor (LIF, Millipore, Billerica, MA, #ESG 1106) and 2i [PD 0325901 (Milipore #444966, MEK inhibitor) and CHIR99021 (Stemgent, Cambridge, MA, #04004, GSK3 inhibitor)]. For all experiments, cells were maintained at 5% CO2 and at atmospheric O2 concentra‐ tion. For differentiation, cells were cultured in the ab‐ sence of LIF/2i.
Alkaline phosphatase assay Pluripotent cells were stained for alkaline phosphatase using kit from Millipore (#SCR 004) and following pro‐ cedures according to the manufacturer’s instructions.
RNAi
shRNAs targeting mouse PKCλ/τ (Prkcτ) mRNA were cloned into pLKO.1puro (Plasmid No. 8453, Addgene, Cambridge MA) and E14 ESCs were transduced and se‐ lected with puromycin by following procedures men‐ tioned previously [23, 24]. shRNA construct with target sequence GTCGCTCTCGGTATCCTGTC (ShRNA1A), corre‐ sponding to the 3’untranslated region (UTR) region of Prkcτ mRNA, was used to generate PKCλ/τKD ESCs. E14 ESCs, transduced with empty vectors were used as con‐ trol. Other shRNAs, targeting the amino acid coding region of Prkcτ mRNA, are mentioned below. For deple‐ tion of HIF1α in PKCλ/τKD ESCs, the pLKO.1hygro (Plasmid #24150, Addgene) was used to express a hygromycin resistance gene and an shRNA construct with target sequence TATGCACTTTGTCGCTATTAA against the HIF1α mRNA. Transduced cells were select‐ ed in presence of both puromycin (1μg/ml) and hygromycin (200µg/ml). www.StemCells.com
Generation of induciblePKCλ/τ (iPKCλ/τ) ESCs Ainv15 ESCs and Cre‐mediated recombination was used to generate iPKCλ/τ ESCs following procedures de‐ scribed earlier [25]. In brief, Prkcτ cDNA (Open Biosystems, Clone ID 40142595, GenBank: BC130257.1) was cloned into the engineered PALP targeting vector, described earlier [25], and was co‐electroporated with a Cre recombinase‐expressing plasmid in Ainv15 ESCs. Clones were selected via G418‐selection and appropriate recombination was confirmed via PCR genotyping, and doxicyclin (DOX)‐inducible expression of PKCλ/τ. The endogenous Prkcτ mRNA in iPKCλ/τ ESCs was depleted by expressing shRNA from lentiviral vectors as de‐ scribed above and selected in presence of both G418 and puromycin. For rescue of PKCλ/τ, cells were treated with DOX (1μg/ml).
Chimera Generation and Germ Line Transmis‐ sion Chimera generation and germ line transmission was tested following published procedures [18]. In brief, PKCλ/τ knocked‐down (PKCλ/τKD) ESCs were injected into the blastocoel cavity of blastocysts, isolated from C57BL/6 pregnant (E3.5) females. After injection, blas‐ tocysts were surgically transferred into recipient pseudopregnant females. High‐percentage chimeras, generated from PKCλ/τKD ESCs, were selected from coat color and mated with C57BL/6 adult mice to test for germline transmission.
Quantitative Real Time PCR and PCR array For mRNA expression analyses, total RNA was isolated using RNA isolation kit (Qiagen Inc., Valencia, CA, Cat no. 74104) and processed as described earlier [26]. Oli‐ gonucleotides, used for qRT‐PCR analyses are described below in Supplemental Table S2. For expression anal‐ yses of mitochondrial ETC complex members, isolated mRNAs from experimental cells were tested using Mouse Mitochondrial Energy Metabolism RT² Profiler™ PCR Array (Cat No. PAMM‐008ZA‐2, SA Biosciences, Qiagen Inc.). We followed procedures described by the manufacturer. Expression patterns were further vali‐ dated using qRT‐PCR. mRNA expression of ETC complex assembly factors were tested using qRT‐PCR. Oligonu‐ cleotides for several complex I members and Complex I assembly factors are mentioned in the supplemental table S2. Oligonucleotides that are used for qRT‐PCR of other ETC complex members and assembly factors are available on request.
Western blot analysis Western blot analysis was performed as mentioned earlier [26]. Antibodies are described below in the sup‐ plemental table S2.
©AlphaMed Press 2014
3
Quantitative chromatin immunoprecipitation (ChIP) Assay Real time PCR‐based quantitative ChIP analysis was per‐ formed according to a previously described protocol [25]. Subconfluent cells were trypsinized and protein‐ DNA cross‐linking was conducted by treating cells with formaldehyde at a final concentration of 1% for 10 min at room temperature with gentle agitation. Glycine was added to quench the reaction. Antibodies against HIF‐ 1α (Abcam, Cambridge, MA, # ab463), PGC1α (Biovision, Milpitas, CA #3934100) were used to immunoprecipitate protein‐DNA cross‐linked frag‐ ments. Primers were designed to amplify 60‐ to 100‐bp amplicons and were based on sequences in Ensembl Genome Browser for mouse locus. Samples from three or more immunoprecipitations were analyzed. Products were measured using Power SYBR Green reagent (#4367659, Applied Biosystems, Grand Island, NY) in 25‐ μl reactions. The amount of product was determined relative to a standard curve of input chromatin. Dissoci‐ ation curves showed that PCRs yielded single products. Sequences of the primers are described in the supple‐ mental table 2.
Immunofluorescence and live cell imaging Cells were cultured on Lab‐Tek chambered Slides (#154453, Thermo Fisher Scientific, Hudson,NH) washed with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde followed by permeabilization with 0.25% Triton X‐100. Blocking was done with PBS con‐ taining 10% FBS and 0.1% TX‐100. Primary antibody incubations were performed in blocking solution at 1:100 dilution over night at 4°C followed by wash with 0.1% TX‐100in PBS. Cells were incubated with Alexafluor‐conjugated secondary antibodies (Molecular probes, Grand Island, NY) at 1:400 dilutions at room temperature for 1 h. Washed cells were mounted on slides with Slowfade anti‐fade (Invitrogen, Grand Island, NY, #S36938) reagent containing DAPI as nuclear stain. For live cell microscopy cells were cultured on Lab‐Tek chambered coverglass (Thermo Fisher Scientific, #155383) and stained with 5 µM MitoSox red from Mo‐ lecular probes (# M36008). Finally cells were observed on a laser scanning confocal microscope (Carl Zeiss).
Oxygen consumption rate (OCR) and extracel‐ lular acidification rate (ECAR) measurements OCR was determined by XF cell mito‐stress test kit (#101706‐100, Seahorse Biosciences, Chicopee, MA) as described previously (7). In brief cells were cultured in XF24 well to ensure about 90% surface coverage at the time of experiment. Culture media were exchanged for unbuffered DMEM medium supplemented with 2mM glutamine. Selective inhibitors were injected during the measurements to achieve the final concentration of Oligomycin (2.5 mM), FCCP (300nM), antimycin (2mM) and rotenone (2mM). One group served as a control with running media added. www.StemCells.com
PKCλ/ι regulates mitochondria in ESCs XF Glycolysis stress test kit (#102194‐100, Seahorse Biosciences) was used to measure ECAR. Cells were seeded in an XF24 plate and ECAR was measured after adding Glucose (7.5mM), Oligomycin (2.5µM) and 2‐ deoxyglucose (2DG) (50mM) following manufacturer’s instruction.
Quantification of mitochondrial DNA (mtDNA) copy numbers Quantitative RT‐PCR based strategy was used to meas‐ ure mtDNA copy numbers following procedures de‐ scribed earlier [27]. Number of mtDNA copies per cell was normalized by measuring number of Gapdh copies using the following formula mtDNA copies/cell = (num‐ ber of the tRNA‐Tyr/mt‐Co1 gene) / (number of the Gapdh gene/2).
Complex I activity assay Mitochondrial complex I activity was measured by using Complex I Enzyme Activity Microplate Assay Kit from Abcam (# ab109721) according to the manufacturer’s instructions. Briefly, Cells were lysed in passive lysis buffer (# E194A, Promega, Madison, WI) and protein concentration was measured and adjusted with phos‐ phate buffered saline (PBS). Supernatant was collected after detergent extraction with 1/10 volume of deter‐ gent for 30 min on ice and used for the measurement of OD at 450nm in the presence of prepared assay buffer.
Electron microscopy Cells were cultured in gelatin‐coated coverglass and fixed with 2.5% glutaraldehyde in PBS, PH7.4 for 1 hr at room temperature. Samples were washed 3 times with PBS at room temperature and post‐fixed for 1hr at 4 C in 1% osmium tetroxide with 1% potassium ferricyanide. Afterwards samples were dehydrated us‐ ing graded ethanol series. After this Thompson molds™ slots were filled with complete medium formula of em‐ bed 812 resin. Place the mold in 60 degree C overnight. Sections (80nM) were made using a diamond knife and Leica UC‐7. Samples were then imaged in a JEOL JEM‐ 1400 TEM at 80KV transmission electron microscope.
Measurement of lactate production Lactate levels were determined using lactate assay kit (# K607100, Biovision,) following manufacturer’s instruc‐ tions. In the assay, lactate is enzymatically oxidized and the product of this reaction reacts with lactate probe and emits fluorescence at Ex/Em=535/587nm. Cells were cultured for 5 days with change in media in each couple of days. After day 4, fresh media was added and 24 h later medium was collected and cell number was determined. Lactate production was measured and normalized to the cell number.
Luciferase assay For luciferase assay, PGC1α promoter region [from (+)78 to (‐)2533bp ] was cloned in PGL3 basic vector ©AlphaMed Press 2014
4
PKCλ/ι regulates mitochondria in ESCs
(Promega, # E1751). Wild type and hypoxia response element (HRE) mutated 1st intron of PGC1α was cloned upstream to the promoter. Plasmid were transfected in ESCs using a Nucleofector (Lonza, Allendale, NJ). Cell lysates were collected and luciferase activity was meas‐ ured in a Veritas Microplate Luminometer using the luciferase assay buffer (Promega). The luciferase activity for each sample was normalized to the protein concen‐ tration of the lysate. At least three independent prepa‐ rations of each plasmid were analyzed and the results were averaged.
RESULTS
Depletion of PKCλ/τ promotes naive pluripotency in ESCs PKCλ/τ is highly expressed in ESCs (Fig. 1A) and also present in an active phosphorylated [28] form (Fig. S1A). So, we tested whether depletion of PKCλ/τ affects ESC proliferation and differentiation. We stably deplet‐ ed PKCλ/τ in ESCs by RNA interference (RNAi) using short hairpin RNAs (shRNAs) (Fig. 1B and Fig. S1B). For our experiments, we selected an shRNA molecule that targets the 3’ untranslated region (UTR) of PKCλ/τ (Prkcι) mRNA and specifically knocks down PKCλ/τ ex‐ pression without affecting expressions of other PKC isoforms (Fig. 1A, B and Fig. S1C, D). We tested prolifer‐ ation and differentiation potentials of PKCλ/τ‐depleted E14 ESCs (PKCλ/τKD ESCs). We found that loss of PKCλ/τ does not alter ESC colony morphology, prolifer‐ ation or chromosomal stability (Fig. S2A, B, C) when cells were cultured with LIF and PD0325901/CHIR99021 (2i), which support pluripotent state. However, inter‐ estingly, loss of PKCλ/τ impairs differentiation potential of ESCs. Unlike wild‐type E14 ESCs or E14 ESCs that ex‐ press an empty vector (control ESCs), PKCλ/τKD ESCs maintained undifferentiated ESC colony morphology (Fig. 1C) and high‐level expressions of pluripotency markers OCT4 and NANOG (Fig. 1D, and Fig. S2D) when cultured in differentiating culture condition in the ab‐ sence of LIF and 2i. To test whether impaired ESC differentiation upon RNAi is indeed due to loss of PKCλ/τ function, we gen‐ erated a PKCλ/τ‐inducible ESC line (iPKCλ/τ ESCs) using Ainv15 ESC model (Fig. S3A). Ainv15 ESCs were engi‐ neered to ectopically express transgenes in a tetracy‐ cline‐inducible fashion [29] and successfully used by us [25]. Upon DOX treatment, the iPKCλ/τ ESCs express an RNAi‐immune (without the 3’UTR) PKCλ/τ mRNA, there‐ by rescuing PKCλ/τ protein expression (Fig. 1E) in the presence of the shRNAs that target the 3’UTR of PKCλ/τ mRNA. We found that, similar to E14 ESCs, depletion of endogenous PKCλ/τ in iPKCλ/τ ESCs impaired differentia‐ tion in the absence of LIF/2i and they maintained undif‐ ferentiated colony morphology and expression of pluripotency markers (Fig. 1F, G and Fig. S3B). However, rescue of PKCλ/τ expression from RNAi immune www.StemCells.com
transgene with DOX restored their differentiation poten‐ tial, confirming importance of PKCλ/τ function in pro‐ moting ESC differentiation. To test whether the PKCλ/τKD ESCs are maintained at a naive ESC state [30] or at a primed epiblast stem cells (EpiSC)‐like state, we tested (i) alkaline phospha‐ tase (AP) expression, (ii) their dependence on activin/Nodal signaling by culturing them in the pres‐ ence of ALK inhibitor SB431542, and (iii) by assessing their efficiency for germ‐line transmission in vivo. When cultured in the absence of LIF and 2i, PKCλ/τKD ESCs expressed high levels of AP (Fig. 2A). Similarly, iPKCλ/τ ESCs in the absence of DOX expressed high levels of AP and differentiation of iPKCλ/τ ESCs upon rescue of PKCλ/τ expression with DOX repressed AP expression (Fig. 2A). Also, PKCλ/τKD ESCs were not dependent on Activin/nodal signaling for maintaining ESC colony for‐ mation (Fig. 2B). Furthermore, PKCλ/τ D ESCs that were maintained for several passages in differentiating culture condition readily yielded chimeric mice upon blastocyst injection (Fig. 2C). Crossing of chimeric offsprings with wild‐type C57BL/6 mice confirmed germline transmission (Fig. 2D). Taken together, our studies indicate that PKCλ/τ function is important to induce ESC differentiation and depletion of PKCλ/τ promotes a naive pluripotent state in ESCs.
PKCλ/τ‐depletion alters metabolic prefer‐ ences and mitochondrial function in ESCs PSC differentiation is associated with maturation of mitochondrial structure and metabolic reprogramming from glycolysis to oxidative phosphorylation 2. Thus, we tested whether maintenance of pluripotency in PKCλ/τ D ESCs is associated with a metabolic shift to‐ wards glycolysis. To characterize the metabolic profiles of PKCλ/τ D ESCs, we measured the oxygen consump‐ tion rate (OCR) and the extracellular acidification rate (ECAR) [31]. The OCR indicates cellular aerobic respira‐ tion, whereas ECAR is an indicative parameter for glyco‐ lytic energy metabolism [31‐33]. We found that, under differentiating culture condi‐ tion in the absence of LIF/2i, basal OCR is induced in wild type control ESCs. However, PKCλ/τKD ESCs showed significantly reduced basal OCR (Fig. 3A and Fig. S4A left panel) compared to control ESCs when cultured in the absence of LIF/2i. To further confirm whether PKCλ/τ‐depletion is associated with altered mitochon‐ drial function in ESCs, OCR was monitored after cells were metabolically stressed by adding oligomycin, carbonilcyanide p‐triflouromethoxyphenylhydrazone (FCCP) and antimycin A/rotenone in succession. In the absence of LIF/2i, treatment of oligomycin, an ATP syn‐ thase inhibitor 34, induced greater loss of OCR (Fig. 3A and Fig. S4A, middle panel) in control ESCs compared to that in PKCλ/τKD ESCs. The greater loss of OCR upon inhibition of mitochondrial ATP synthesis indicated that higher levels of mitochondrial respiration are coupled with ATP production in control ESCs. To measure re‐ ©AlphaMed Press 2014
5 serve respiratory capacity, an indicative parameter of maximal respiratory efficiency of mitochondria, we next added FCCP, an ionophore that induces high proton conductance into the mitochondrial membrane with rapid acceleration of the electron transport chain (ETC) [35]. FCCP treatment in the absence of LIF/2i resulted in significantly higher OCR increase in control ESCs than that in PKCλ/τKD ESCs (Fig. 3A and Fig. S4A right panel), indicating higher maximal respiratory capacity of mito‐ chondria in those cells. Finally, treatment of antimycin A/Rotenone, inhibitors of ETC complexs III and I, respec‐ tively, revealed that the rate of oxygen consumption due to non‐mitochondrial sources was similar in both control and PKCλ/τKD ESCs. Interestingly, OCR analysis in iPKCλ/τ ESCs showed that, rescue of PKCλ/τ expres‐ sion rescued altered mitochondrial respiration (Fig. S4B and C). Collectively, these results indicated that induc‐ tion of mitochondrial respiration during ESCs differenti‐ ation is dependent upon PKCλ/τ signaling. Next we tested whether PKCλ/τ loss promotes gly‐ colysis in ESCs by monitoring ECAR. ECAR was moni‐ tored after addition of glucose, oligomycin and 2‐deoxy‐ D‐glucose (2DG) in succession (Fig. 3B). Glucose and Oligomycin were added to monitor glycolysis rate and maximal glycoltic capacity, respectively, and 2DG, an inhibitor of glycolysis, confirmed the presence of glyco‐ lytic flux. We found that, in the absence of LIF/2i, PKCλ/τ‐depletion strongly increased both rate of gly‐ colysis (Fig. 3B, and Fig. S5A, left panel) and glycolytic capacity (Fig. 3B, and Fig. S5A, right panel) in ESCs, lead‐ ing to increase in lactate production (Fig. S5B). Fur‐ thermore, ECAR analysis in iPKCλ/τ ESCs showed that, rescue of PKCλ/τ expression strongly reduced glycolysis rate and glycolytic capacity (Fig. S5C and D). These ob‐ servations indicate that loss of PKCλ/τ in ESCs promotes a preference for glycolytic metabolism. Lower mitochondrial respiration in PKCλ/τKD ESCs could be due to multiple reasons; including reduced numbers of mitochondria or developmentally immature mitochondria. We found that, under differentiating cul‐ ture condition, depletion of PKCλ/τ results in significant inhibition of mitochondrial DNA (mtDNA) synthesis (Fig. 3C). Furthermore, transmission electron microscopy revealed that mitochondria in PKCλ/τKD ESCs are globu‐ lar in shape and lack proper cristae formation (Fig. 3D), indicating a developmentally immature state. Also, con‐ focal microscopy showed that mitochondrial rear‐ rangement within PKCλ/τKD ESCs was mostly peri‐ nuclear, whereas in control ESCs mitochondria were distributed throughout the cytoplasm (Fig. S6). Interest‐ ingly, mtDNA synthesis and immature mitochondria were also observed in iPKCλ/τ cells upon depletion of endogenous PKCλ/τ and rescue of RNAi immune PKCλ/τ with DOX significantly increased mtDNA synthe‐ sis and induced mitochondrial maturation (Fig. 3E,F). Taken together, these data revealed that loss of PKCλ/τ in ESCs inhibits mitochondrial biogenesis, their matura‐ tion and cellular rearrangement. www.StemCells.com
PKCλ/ι regulates mitochondria in ESCs
Loss of PKCλ/τ inhibits mitochondrial com‐ plex I function To better understand the reason behind altered mito‐ chondrial function, we tested gene expression patterns of (i) mitochondrial electron transport chain (ETC) com‐ plex members, and (ii) assembly factors for ETC com‐ plexes. We found that NADH dehydrogenase (ubiqui‐ none) 1 alpha subcomplex 1 (NDUFA1), a member of the ETC complex I as well as complex I assembly factors, NADH dehydrogenase (ubiquinone) complex I, assembly factor 4 (NDUFAF4) and NDUFAF6, were significantly down regulated in PKCλ/τKD ESCs (Fig. 4A, and Table S1). Previous research showed that complex I biogene‐ sis and assembly factors are important to carry out normal mitochondrial function and malfunction of complex I may promote the cell to choose glycolytic metabolism instead of oxidative phosphorylation [36]. So, we tested mitochondrial complex I function and found that complex I activity is inhibited in PKCλ/τKD ESCs (Fig. 4B). As mitochondrial complex I dysfunction is often associated with generation of reactive oxygen species (ROS) 36, we checked the production of mito‐ chondrial ROS (mtROS) in PKCλ/τKD ESCs. Live cell con‐ focal microscopy showed that PKCλ/τKD ESCs have more mtROS compare to the control ESCs (Fig. 4C). Fur‐ thermore, rescue of PKCλ/τ expression in iPKCλ/τ ESCs rescued complex I activity (Fig. 4B) and prevented mtROS production (Fig. 4C). These results indicated that along with efficient mitochondrial biogenesis, PKCλ/τ signaling is also important for proper function of mitochondrial complex I during ESC differentiation.
PKCλ/τ is critical to promote PGC1α expres‐ sion in differentiating ESCs mtDNA synthesis as well as transcription of mitochon‐ dria associated proteins are often regulated by peroxi‐ some proliferator‐activated receptor‐γ co‐activator (PGC)‐1α [37] and PGC1 βPGC1α and PGC1β modulate function of nuclear respiratory factor 1 (NRF1), NRF2, and mitochondrial transcription factor A (TFAM), there‐ by altering gene expression to modulate mitochondrial biogenesis and function [37]. Interestingly, identifica‐ tion of genome‐wide PGC1α target genes [38] revealed that Ndufa1 is a PGC1α target. PGC1α is also implicated as a key regulator of cellular ROS production [37]. So, we tested expressions of PGC1α and PGC1β in control vs. PKCλ/τKD ESCs. We found that that PGC1α (Ppargc1α) mRNA and protein expressions were in‐ duced in differentiating ESCs (Fig. 4D, E) and depletion of PKCλ/τ impaired PGC1α induction (Fig. 4D, E) with‐ out affecting expression of PGC1β (Fig. 4D). Earlier studies indicated that PGC1α is a positive regulator of NRF1, NRF2 and TFAM expression 39. Fur‐ thermore, genome wide binding site analyses revealed that, along with Ndufa1, Tfam, Nrf1, Nrf2, and polymer‐ ase gamma (Polg), a DNA polymerase that replicates mtDNA, are also PGC1α targets [38]. So, we tested their ©AlphaMed Press 2014
6 expression in PKCλ/τKD ESCs. We found that PKCλ/τ‐ depletion does not affect Nrf2 expression in ESCs (Fig. 4F). However, PGC1α expression is associated with downregulation of Tfam, Nrf1 and PolG mRNA expres‐ sion in PKCλ/τKD ESCs (Fig. 4F). Collectively, these re‐ sults indicated that ESC differentiation is associated with induction of master mitochondrial regulator PGC1α, and this induction is critically dependent on PKCλ/τ function. This conclusion was further supported by the fact that rescue of PKCλ/τ expression in iPKCλ/τ cells restored PGC1α (Fig. 4G) and Tfam, Nrf1 and PolG expressions (Fig. 4H).
Identification of a PKCλ/τ‐HIF1α‐PGC1α regu‐ latory axis Our studies showed that depletion of PKCλ/τ in ESCs maintains pluripotency, which is associated with tran‐ scriptional induction of pluriopotency genes, like Oct4 and Nanog. In contrast, PKCλ/τ depletion also leads to suppression of Pgc1α transcription. So, we hypothe‐ sized that downstream to PKCλ/τ, transcription factor/s are involved in upregulation of pluripotency genes and downregulation of Pgc1α transcription. Interestingly, earlier studies revealed that hypoxia inducible factor 1‐ alpha (HIF1α) could mediate both of these functions. HIF1α could upregulate expressions of Nanog and Oct4 [40] and is implicated in regulating mitochondrial func‐ tions and to promote a metabolic shift towards glycoly‐ sis in ESCs and iPSCs [7, 16, 41]. Furthermore, HIF1α is also implicated in suppression of PGC1α expression in different cellular contexts [42, 43]. Therefore, we tested HIF1α protein expression in PKCλ/τKD ESCs. Intriguing‐ ly, we found that loss of PKCλ/τ strongly stabilizes HIF1α protein in ESCs (Fig. 5A). This observation was further confirmed in iPKCλ/τ ESCs, in which rescue of PKCλ/τ expression with DOX prevented HIF1α stabiliza‐ tion (Fig. 5A). Furthermore, chromatin immunoprecipitation (ChIP) analyses in PKCλ/τKD ESCs indicated that stabilization of HIF1α leads to binding of HIF1α at the Nanog loci (Fig.S7A). These results indicat‐ ed that, downstream to PKCλ/τ depletion, stabilization and function of HIF1α might be important to modulate expression of pluripotency genes and PGC1α. There‐ fore, in the next set of experiments we asked functional importance of HIF1α induction in regulating pluripotency genes and altering PGC1α expression and mitochondrial function in PKCλ/τKD ESCs. To test importance of HIF1α stabilization in PKCλ/τKD ESCs, we depleted HIF1α in PKCλ/τKD ESCs (Fig. 5B, and Fig. S7B) and assessed their differentiation potential. We employed an shRNA‐mediated RNAi ap‐ proach to deplete HIF1α in PKCλ/τKD ESCs. We found that depletion of HIF1α in PKCλ/τKD ESCs is associated with (i) rescue of differentiation potential (Fig. 5C) along with suppression of pluripotency genes (Fig. S7C), (ii) induction of PGC1α and other mitochondrial regulators (Fig. 5D and Fig. S7D), (iii) induction of mtDNA synthesis www.StemCells.com
PKCλ/ι regulates mitochondria in ESCs and complex I activity (Fig. 5E, F), and (iv) strong reduc‐ tion of glycolysis (Fig. 5G). These results confirmed that downstream to PKCλ/τ‐depletion, HIF1α function alters mitochondrial function in ESCs, promoting glycolysis and inhibiting their differentiation. As PGC1α expression is rescued upon HIF1α deple‐ tion, we tested whether HIF1α directly modulates ex‐ pression of PGC1α in PKCλ/τKD ESCs. We performed bioinformatics and identified a conserved [B(C/G/T)R(A/G)CGTGS(C/G)] [44] hypoxia responsive element (HRE) within the first intron of the PGC1α locus (Fig. 6A). Our ChIP analysis in PKCλ/τKD ESCs showed that HIF1α specifically occupies the intronic HRE (Fig. 6B). Furthermore, transient transfection analysis with a luciferase reporter gene confirmed that deletion of the conserved HRE activates PGC1α promoter in PKCλ/τKD ESCs (Fig. 6C). These data strongly support the concept that, in PKCλ/τKD ESCs, HIF1α directly represses PGC1α transcription and implicates a PKCλ/τ‐HIF1α‐PGC1α axis (Fig. 7) in regulating mitochondrial function during ESC differentiation. DISCUSSION PSCs harbor enormous potential for regenerative medi‐ cine. Therefore, a significant amount of present day research is directed towards understanding PSC biology. Although evidences are emerging regarding the interre‐ lationship between mitochondrial function and pluripotency, molecular mechanisms of mitochondrial regulation in PSCs are poorly understood. The results described in this study establish a PKCλ/τ‐PGC1α mo‐ lecular axis that regulates mitochondrial biogenesis, reorganization and respiratory function, thereby pro‐ moting ESC differentiation. Consequently, loss of PKCλ/τ in murine ESCs impairs their differentiation po‐ tential and promotes pluripotency. Not surprisingly, PKCλ/τ‐null mouse embryos succumb during gastrula‐ tion. One of the most intriguing observations in this study is stabilization of HIF1α in the PKCλ/τ‐depleted ESCs in the presence of high oxygen tension (cells were cul‐ tured at an atmospheric oxygen (21%) level). So the question arises, how does HIF1α stabilization occur in PKCλ/τ‐depleted ESCs? As an increase in cellular ROS level could stabilize HIF1α [45], it is possible that ROS production due to defective complex 1 activity in PKCλ/τKD ESCs is promoting HIF1α stabilization (Fig. 7). However, rescue of PGC1α expression, mtDNA synthe‐ sis and mitochondrial respiration upon depletion of HIF1α (Fig. 5D‐F) indicates that, rather, HIF1α stabiliza‐ tion accounts for altered mitochondrial function in PKCλ/τKD ESCs. Thus, at present it is unknown to us how depletion of PKCλ/τ stabilizes HIF1α in murine ESCs. However, we predict that an anchoring protein, receptor for activated protein kinase C1 (RACK1) [46, 47], might be involved in this process. RACK1 interacts with multiple PKC isoforms [46]. Furthermore, phos‐ ©AlphaMed Press 2014
7
PKCλ/ι regulates mitochondria in ESCs
phorylation of RACK1 at Ser146 is important for the degradation of HIF1α in atmospheric oxygen level [48]. Phosphorylated RACK1 can form a dimer and target HIF1α to the proteasome complex for degradation [48]. Thus, it is possible that, during ESC differentiation, the PKCλ/τ‐RACK1 pathway is involved in HIF1α degrada‐ tion (Fig. 7) and loss of PKCλ/τ disrupts this pathway leading to stabilization of HIF1α. Given the importance of HIF1α in physiological processes and pathological conditions [49], it is important to further study mecha‐ nistic details of interrelationships between PKCλ/τ and HIF1α as well as cellular contexts of this event. The other interesting aspect of this study is direct transcriptional regulation of PGC1α by HIF1α. Several previous studies have shown that, depending on a cellu‐ lar context; hypoxia could modulate PGC1α expression both in a positive [50] and a negative [42, 43] fashion. However, PGC1α induction by hypoxia does not require HIF1α activity [50]. Rather, we have shown that, under our experimental conditions, HIF1α negatively regulates PGC1α and leads to impairment of mitochondrial bio‐ genesis and function. To our knowledge this is the first report showing direct repression of PGC1α expression by HIF1α. It will be interesting to check whether this mechanism is functional in other cellular contexts, es‐ pecially in cancer cells, which are characterized by acti‐ vated glycolysis and HIF1α stabilization [51]. Lastly, a fine balance of cellular metabolism is cru‐ cial during developmental processes. However, much remains unknown regarding the metabolic controllers that mediate mammalian tissue development. This knowledge gap is a critical barrier for the successful bridging of stem cell research with regenerative thera‐ py. Whereas, global gene expression, epigenetic and protein expression profiling are important to identify the key regulators and signaling networks in cultured PSCs, it is equally important to understand metabolic regulators in PSC‐derived progenitors, which could mimic developmental stages similar to adult stem cells. Interestingly, recent studies indicated that adult stem cells could also rely primarily on glycolysis for their en‐ ergy metabolism [52, 53]. We showed that PKCλ/τ‐ PGC1α axis is important regulator for mitochondrial function and cellular metabolism in ESC‐derived progen‐ itors. Therefore, it stands to reason that a similar mech‐ anism may also be shared in adult stem cells. Assuming that the proliferation, aging, and differentiation of adult stem cells are affected by altered cellular metabolism, it will be intriguing to target PKCλ/τ signaling pathway to chemically define culture conditions to study PSCs as
REFERENCES 1 Rafalski VA, Mancini E, Brunet A. Energy metabolism and energy‐sensing pathways in mammalian embryonic and adult stem cell fate. J Cell Sci. 2012;125:5597‐5608.
www.StemCells.com
well as adult stem cells for long‐term culture and di‐ rected differentiation. These studies might also unearth novel insights into our knowledge of mitochondrial dis‐ eases and aging. CONCLUSION Pluripotent stem cells (PSCs) hold excellent promise for regenerative medicine due to their multi‐differentiation potency. Interestingly, PSCs contain functionally imma‐ ture mitochondria with a preference for glycolytic ener‐ gy metabolism. In contrast, PSC differentiation is asso‐ ciated with mitochondrial maturation and a metabolic shift towards oxidative phosphorylation. However, sig‐ naling pathways that control mitochondrial maturation and function during PSC differentiation is largely un‐ known. Here, using mouse embryonic stem cells (ESCs) as model system, we discovered that atypical protein kinase C isoform, PKCλ/τ, is crucial for mitochondrial biogenesis, maturation and function during ESC differ‐ entiation. Our study has unearthed a yet unidentified signaling pathway, which is crucial to regulate cellular energy metabolism to balance self‐renewal vs. differen‐ tiation of PSCs. ACKNOWLEDGMENTS This research was supported by NIH grants HD062546, HD075233, and HL094892 to SP, American Heart Associa‐ tion postdoctoral Fellowship to PH and a gift from the Ronald. D. Deffenbaugh Foundation. We thank Drs. Jay L. Vivian and Sumedha Gunewardena for providing DNA constructs and helping with Bioinformatics, respectively. The electron microscopy research laboratory of the Kan‐ sas University Medical Center was used for electron mi‐ croscopy analyses. CONFLICT OF INTEREST Authors have no conflict‐of‐interest to disclose.
AUTHOR CONTRIBUTIONS B Mahato, P Home, G Rajendran, A Paul, B Saha, A Ganguly, S Ray and N Ray performed experiments. RH Swerdlow designed experiments. S Paul designed exper‐ iments and wrote the manuscript.
2 Xu X, Duan S, Yi F, et al. Mitochondrial regulation in pluripotent stem cells. Cell Metab. 2013;18:325‐332. 3 Varum S, Rodrigues AS, Moura MB, et al. Energy metabolism in human pluripotent stem cells and their differentiated counterparts. PLoS One. 2011;6:e20914.
4 Zhang J, Nuebel E, Daley GQ, et al. Metabolic regulation in pluripotent stem cells during reprogramming and self‐renewal. Cell Stem Cell. 2012;11:589‐595. 5 Mandal S, Lindgren AG, Srivastava AS, et al. Mitochondrial function controls proliferation and early differentiation
©AlphaMed Press 2014
8 potential of embryonic stem cells. Stem Cells. 2011;29:486‐495. 6 Zhang J, Khvorostov I, Hong JS, et al. UCP2 regulates energy metabolism and differentiation potential of human pluripotent stem cells. EMBO J. 2011;30:4860‐4873. 7 Zhou W, Choi M, Margineantu D, et al. HIF1alpha induced switch from bivalent to exclusively glycolytic metabolism during ESC‐ to‐EpiSC/hESC transition. EMBO J. 2012;31:2103‐2116. 8 Prowse AB, Chong F, Elliott DA, et al. Analysis of mitochondrial function and localisation during human embryonic stem cell differentiation in vitro. PLoS One. 2012;7:e52214. 9 Folmes CD, Nelson TJ, Martinez‐ Fernandez A, et al. Somatic oxidative bioenergetics transitions into pluripotency‐ dependent glycolysis to facilitate nuclear reprogramming. Cell Metab. 2011;14:264‐ 271. 10 Ezashi T, Das P, Roberts RM. Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci U S A. 2005;102:4783‐4788. 11 Kondoh H, Lleonart ME, Nakashima Y, et al. A high glycolytic flux supports the proliferative potential of murine embryonic stem cells. Antioxid Redox Signal. 2007;9:293‐ 299. 12 Varum S, Momcilovic O, Castro C, et al. Enhancement of human embryonic stem cell pluripotency through inhibition of the mitochondrial respiratory chain. Stem Cell Res. 2009;3:142‐156. 13 Prigione A, Lichtner B, Kuhl H, et al. Human induced pluripotent stem cells harbor homoplasmic and heteroplasmic mitochondrial DNA mutations while maintaining human embryonic stem cell‐like metabolic reprogramming. Stem Cells. 2011;29:1338‐1348. 14 Panopoulos AD, Yanes O, Ruiz S, et al. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell Res. 2012;22:168‐177. 15 Suhr ST, Chang EA, Tjong J, et al. Mitochondrial rejuvenation after induced pluripotency. PLoS One. 2010;5:e14095. 16 Prigione A, Rohwer N, Hoffmann S, et al. HIF1alpha Modulates Cell Fate Reprogramming Through Early Glycolytic Shift and Upregulation of PDK1‐3 and PKM2. Stem Cells. 2014;32:364‐376. 17 Li Q, Hakimi P, Liu X, et al. Cited2, a transcriptional modulator protein, regulates metabolism in murine embryonic stem cells. J Biol Chem. 2014;289:251‐263. 18 Dutta D, Ray S, Home P, et al. Self‐ renewal versus lineage commitment of embryonic stem cells: protein kinase C signaling shifts the balance. Stem Cells. 2011;29:618‐628. 19 Rajendran G, Dutta D, Hong J, et al. Inhibition of protein kinase C signaling maintains rat embryonic stem cell pluripotency. J Biol Chem. 2013;288:24351‐ 24362.
PKCλ/ι regulates mitochondria in ESCs 20 Kinehara M, Kawamura S, Tateyama D, et al. Protein kinase C regulates human pluripotent stem cell self‐renewal. PLoS One. 2013;8:e54122. 21 Soloff RS, Katayama C, Lin MY, et al. Targeted deletion of protein kinase C lambda reveals a distribution of functions between the two atypical protein kinase C isoforms. J Immunol. 2004;173:3250‐3260. 22 Seidl S, Braun U, Roos N, et al. Phenotypical analysis of atypical PKCs in vivo function display a compensatory system at mouse embryonic day 7.5. PLoS One. 2013;8:e62756. 23 Dutta D, Ray S, Vivian JL, et al. Activation of the VEGFR1 chromatin domain: an angiogenic signal‐ETS1/HIF‐2alpha regulatory axis. J Biol Chem. 2008;283:25404‐25413. 24 Home P, Ray S, Dutta D, et al. GATA3 is selectively expressed in the trophectoderm of peri‐implantation embryo and directly regulates Cdx2 gene expression. J Biol Chem. 2009;284:28729‐28737. 25 Home P, Saha B, Ray S, et al. Altered subcellular localization of transcription factor TEAD4 regulates first mammalian cell lineage commitment. Proc Natl Acad Sci U S A. 2012;109:7362‐7367. 26 Home P, Ray S, Dutta D, et al. GATA3 is selectively expressed in the trophectoderm of peri‐implantation embryo and directly regulates Cdx2 gene expression. J Biol Chem. 2009;284:28729‐28737. 27 Facucho‐Oliveira JM, Alderson J, Spikings EC, et al. Mitochondrial DNA replication during differentiation of murine embryonic stem cells. J Cell Sci. 2007;120:4025‐4034. 28 He L, Sabet A, Djedjos S, et al. Metformin and insulin suppress hepatic gluconeogenesis through phosphorylation of CREB binding protein. Cell. 2009;137:635‐646. 29 Kyba M, Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid‐myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell. 2002;109:29‐37. 30 Nichols J, Smith A. Pluripotency in the embryo and in culture. Cold Spring Harb Perspect Biol. 2012;4:a008128. 31 Swerdlow RH, E L, Aires D, et al. Glycolysis‐respiration relationships in a neuroblastoma cell line. Biochim Biophys Acta. 2013;1830:2891‐2898. 32 Silva DF, Selfridge JE, Lu J, et al. Bioenergetic flux, mitochondrial mass and mitochondrial morphology dynamics in AD and MCI cybrid cell lines. Hum Mol Genet. 2013;22:3931‐3946. 33 Hill BG, Benavides GA, Lancaster JR, Jr., et al. Integration of cellular bioenergetics with mitochondrial quality control and autophagy. Biol Chem. 2012;393:1485‐1512. 34 Chappell JB, Greville GD. Effects of oligomycin on respiration and swelling of isolated liver mitochondria. Nature. 1961;190:502‐504. 35 To MS, Aromataris EC, Castro J, et al. Mitochondrial uncoupler FCCP activates proton conductance but does not block store‐ operated Ca(2+) current in liver cells. Arch Biochem Biophys. 2010;495:152‐158.
36 Stefanatos R, Sanz A. Mitochondrial complex I: a central regulator of the aging process. Cell Cycle. 2011;10:1528‐1532. 37 Austin S, St‐Pierre J. PGC1alpha and mitochondrial metabolism‐‐emerging concepts and relevance in ageing and neurodegenerative disorders. J Cell Sci. 2012;125:4963‐4971. 38 Charos AE, Reed BD, Raha D, et al. A highly integrated and complex PPARGC1A transcription factor binding network in HepG2 cells. Genome Res. 2012;22:1668‐1679. 39 Wu Z, Puigserver P, Andersson U, et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC‐1. Cell. 1999;98:115‐124. 40 Mathieu J, Zhang Z, Zhou W, et al. HIF induces human embryonic stem cell markers in cancer cells. Cancer Res. 2011;71:4640‐ 4652. 41 Pereira SL, Graos M, Rodrigues AS, et al. Inhibition of Mitochondrial Complex III Blocks Neuronal Differentiation and Maintains Embryonic Stem Cell Pluripotency. PLoS One. 2013;8:e82095. 42 Liu Y, Ma Z, Zhao C, et al. HIF‐1alpha and HIF‐2alpha are critically involved in hypoxia‐ induced lipid accumulation in hepatocytes through reducing PGC‐1alpha‐mediated fatty acid beta‐oxidation. Toxicol Lett. 2014. 43 Tsukada K, Tajima T, Hori S, et al. Hypoxia‐inducible factor‐1 is a determinant of lobular structure and oxygen consumption in the liver. Microcirculation. 2013;20:385‐393. 44 Dutta D, Ray S, Vivian JL, et al. Activation of the VEGFR1 chromatin domain: an angiogenic signal‐ETS1/HIF‐2alpha regulatory axis. J Biol Chem. 2008;283:25404‐25413. 45 Sena LA, Chandel NS. Physiological roles of mitochondrial reactive oxygen species. Mol Cell. 2012;48:158‐167. 46 Adams DR, Ron D, Kiely PA. RACK1, A multifaceted scaffolding protein: Structure and function. Cell Commun Signal. 2011;9:22. 47 Liu YV, Semenza GL. RACK1 vs. HSP90: competition for HIF‐1 alpha degradation vs. stabilization. Cell Cycle. 2007;6:656‐659. 48 Liu YV, Hubbi ME, Pan F, et al. Calcineurin promotes hypoxia‐inducible factor 1alpha expression by dephosphorylating RACK1 and blocking RACK1 dimerization. J Biol Chem. 2007;282:37064‐37073. 49 Semenza GL. Hypoxia‐inducible factors in physiology and medicine. Cell. 2012;148:399‐408. 50 Shoag J, Arany Z. Regulation of hypoxia‐ inducible genes by PGC‐1 alpha. Arterioscler Thromb Vasc Biol. 2010;30:662‐666. 51 Semenza GL. HIF‐1: upstream and downstream of cancer metabolism. Curr Opin Genet Dev. 2010;20:51‐56. 52 Miharada K, Karlsson G, Rehn M, et al. Cripto regulates hematopoietic stem cells as a hypoxic‐niche‐related factor through cell surface receptor GRP78. Cell Stem Cell. 2011;9:330‐344. 53 Simsek T, Kocabas F, Zheng J, et al. The distinct metabolic profile of hematopoietic stem cells reflects their location in a hypoxic niche. Cell Stem Cell. 2010;7:380‐390.
www.StemCells.com
©AlphaMed Press 2014
9
PKCλ/ι regulates mitochondria in ESCs
See www.StemCells.com for supporting information available online. STEM CELLS ; 00:000–000
www.StemCells.com
©AlphaMed Press 2014
10
PKCλ/ι regulates mitochondria in ESCs
Figure 1. Depletion of PKCλ/τ promotes ESC self‐renewal. A, Micrographs of an undifferentiated ESC colony showing expression of PKCλ/τ. B, Western blots showing knock‐ down of PKCλ/τ in ESCs with shRNA constructs. The shRNA1, which showed strong RNAi, targets the 3’ UTR region of PKCλ/τ mRNA. C, Micrographs show that PKCλ/τKD ESCs maintain undifferentiated colony morphology when cul‐ tured in differentiating culture condition (without LIF/2i), whereas the control ESCs, in which PKCλ/τ expression is maintained, undergo differentiation. D, Immunofluorescence analysis showing expression of pluripotency factors, OCT4 and NANOG in PKCλ/τKD cells in the absence of LIF/2i. E, iPKCλ/τ ESCs, expressing PKCλ/τ shRNA1, were treat‐ ed with DOX for different time intervals and western blot analyses were performed to compare PKCλ/τ expression with respect to Ainv15 ESCs, from which iPKCλ/τ ESCs were derived. Western blots show rescue of PKCλ/τ protein expression in iPKCλ/τ ESCs upon DOX treatment. F, Micrographs show that rescue of PKCλ/τ expression in iPKCλ/τ cells induces their differentiation. G, Western blots showing expressions of OCT4 and NANOG in iPKCλ/τ cells in the absence and presence of LIF/2i, PKCλ/τ shRNA and DOX. (All scale bars, 100μm).
www.StemCells.com
©AlphaMed Press 2014
11
PKCλ/ι regulates mitochondria in ESCs
Figure 2. Depletion of PKCλ/τ maintains ESCs in a naive pluripotent state: A, Micrographs show alkaline phosphatase activity in PKCλ/τKD ESCs and iPKCλ/τ ESCs, when cultured without LIF/2i. Rescue of PKCλ/τ with DOX in iPKCλ/τ ESCs induced differentiation with loss of alkaline phosphatase activity. B, PKCλ/τKD ESCs were cultured in the absence of LIF/2i and with or without SB431542, which inhibits activin/nodal signaling. Microgrpahs show that undifferentiated ESC colony morphology is maintained with or without SB431542. C, Chimeric mice generated with PKCλ/τKD ESCs that were cultured without LIF/2i for 4 consecutive passages. E, Germline offsprings (agouti coat color) generated from PKCλ/τKD ESC‐derived chimera. (All scale bars, 100μm).
www.StemCells.com
©AlphaMed Press 2014
12
PKCλ/ι regulates mitochondria in ESCs
Figure 3. Depletion of PKCλ/τ inhibits mtDNA synthesis and mitochondrial maturation and promotes glycolysis in ESCs: A, Control ESCs and PKCλ/τKD ESCs were subjected for mitochondrial stress test by adding oligomycin, FCCP, and AntimycinA/Rotenone at different time intervals and changes in OCRs were measured. Basal respiration, mitochon‐ drial coupled respiration (light pink shade), reserved respiratory capacity (deep pink shade) and non‐mitochondrial respirations (blue shade) of control ESCs without LIF/2i are indicated. B, Control ESCs and PKCλ/τKD ESCs were sub‐ jected for glycolysis stress test by adding glucose, oligomycin, and 2DG at different time intervals and changes in ECARs were measured. Glycolysis rate (light pink shade), maximal glycolytic capacity (deep pink shade), and glycolytic reserve of PKCλ/τKD ESCs without LIF/2i are indicated. C, Plot shows significant (p≤0.01) reduction of mtDNA synthe‐ sis in PKCλ/τKD ESCs compared to the control ESCs, when cultured in differentiating culture condition. D, Electron micrographs showing mitochondria in control ESCs and PKCλ/τKD ESCs. In the absence of LIF/2i, mitochondrial matu‐ ration was impaired in PKCλ/τKD ESCs. (E) iPKCλ/τ ESCs, expressing PKCλ/τ shRNA1, were treated with or without DOX. Plot shows significant (p≤0.05) induction of mtDNA synthesis in iPKCλ/τ cells upon rescue of PKCλ/τ expression with DOX. (E) Electron micrographs showing mitochondria in iPKCλ/τ ESCs that were treated with or without DOX. (All scale bars, 500nm).
www.StemCells.com
©AlphaMed Press 2014
13
PKCλ/ι regulates mitochondria in ESCs
Figure 4. PKCλ/τ promotes mitochondrial complex I activity and PGC1α expression in differentiating ESCs. A, qRT‐PCR analyses (mean ± standard error; three independent experiments) showing mRNA expressions of mito‐ chondrial complex I members that are encoded by nuclear DNA and complex I assembly factors in PKCλ/τKD ESCs relative to control ESCs. B, Control, PKCλ/τKD ESCs and iPKCλ/τ ESCs were cultured without LIF/2i and mitochondrial complex I activities were measured. The plot shows significant inhibition (p≤0.01) of complex I activity with PKCλ/τ‐ depletion and significant induction of activity (p≤0.05) upon rescue of PKCλ/τ expression in iPKCλ/τ cells. C, Confocal images showing mitochondrial ROS production (monitored with Mitosox) in control ESCs, PKCλ/τKD ESCs and iPKCλ/τ ESCs, when those were cultured without LIF/2i. iPKCλ/τ ESCs were cultured with DOX to rescue PKCλ/τ expression. D, qRT‐PCR analyses showing mRNA expressions of PGC1α and PGC1β in control and PKCλ/τKD ESCs, cultured with or without LIF/2i. PGC1α mRNA expressions was significantly (p
